t .r.
:fEN OMSTANDIGHE!'E urr n
!.RLlO!_EE.!' IF~l?WVL~t-:HWORD NIEj
11U1n~ivelrsimtymFrmee~StIate~I~m~~~
34300002549487
Universiteit Vrystaat
Assessing genetic diversity and identification of
Microcystis aeruginosa strains through AFLP and peR-
RFLPanalyses.
by
Paul Johan Oberholster
Submitted to fulfilment of the requirements for the degree
Magister Scientiae
In the Department of Plant Sciences,
Faculty of Natural and Agricultural Sciences
University of the Free State
Bloemfontein
December 2003
Supervisor: Prof JU Grobbelaar
Co-supervisor: Prof AM Botha-Oberholster
Acknowledgements
I would like to thank the following people and institutions
Prof. J.U. Grobbelaar for financial support and expertise during this study and
preparation of this manuscript.
Prof. A-M. Botha-Oberholster for suggestions, guidance and bearing with me
during the course of the study.
The University of Pretoria; Department of Genetics for their facilities and
materials provided.
The Water Research Commision and National Research Foundation for funding
this project.
The National Research Foundation for the bursary provided.
Leanne Coetzee, City Council of Tshwane and Karin van Ginkei, Department of
Water Affairs and Forestry for providing research materials.
Much appreciation to my wife and sons, family and friends for their interest and
support.
11
Universiteit van die
Vrj's~G;l~
BLOEM;':ONT;:~; 1'1
7 - APR 2005
UV SASOL aU3UOTEiEK
DECLARATION
I the undersigned hereby declare that the work carried out in this thesis is my
own original work and that I have not previously in its entirety or in part submitted
it at any university for a degree.
Paul Johan Oberholster
23 December 2003
UI
RESEARCH OUTPUT
The following peer-reviewed publications and conference presentations
resulted from this study:
1. OBERHOLSTER PJ, BOTHA A-M & GROBBELAAR JU (2004)
Microcystis aeruginosa: source of toxic microcystins in drinking water.
African Journal of Biotechnology 3(1): 159-168.
2. OBERHOLSTER PJ, BOTHA A-M, COETZEE L & GROBBELAAR JU
(2004) Microcystis aeruginosa strain identification using PCR analysis.
Proceedings of the WISA meeting. ISBN 1-920-0172-8-3.
3. OBERHOLSTER PJ, BOTHA A-M & GROBBELAAR JU (2003)
Microcystis aeruginosa strain identification using molecular tools. Algal
Biotechnology meeting, Qiandao, China, October 2003 (poster).
4. OBERHOLSTER PJ, BOTHA A-M & GROBBELAAR JU (2004)
Application of molecular tools for the identification of Microcystis
aeruginosa strains. SAMS meeting, University of Stellenbosch,
Stellenbach, 4-7 April 2004 (poster).
IV
Table of Contents
Page Number
List of Abbreviations viii
List of Units x
List of Figures xi
List of Tables xii
Chapter 1 Introduction 1
References 6
Chapter 2 Literature Review 8
2.1 Cyanobacteria 8
2.2 Association of environmental parameters on cyanobacterial
blooms and toxicity of microcystin 10
2.2.1 Physical factors 10
Temperature 10
Light and buoyancy 11
2.2.2 Chemical factors 13
Nitrogen and phosphorus ratios 13
Iron and zinc 13
2.3 The toxicity of microcystins in cyanobacteria 14
2.3.1 Synthesis of microcystins 16
Chloroplast DNA 16
Plasmids 16
Thiotemplate mechanism 17
2.3.2 Analysis of microcystins 17
2.3.3 Control and degradation of cyanobacterial blooms 19
Chemical control 19
Biological control 20
2.3.4 Toxicity 23
Mechanism of action of microcystins 24
Phosphatase inhibition 25
Other effects of microcystins 26
2.4 Identification, diversity and population structure 27
2.4.1 Molecular tools for culture identification 27
v
rRNA and rDNA genes 27
Polymerase chain reaction-restriction fragment length
polymorphism 28
Amplified fragment length polymorph isms 28
2.5 References 30
Chapter 3 Assessment of the genetic diversity of Microcystis aeruginosa strains
using Amplified fragment length polymorph isms (AFLPs) 42
Introduction 42
Material and Methods 44
Chemicals, Strains and Culture Conditions 44
DNA extraction 46
AFLP analysis 47
Data analysis 48
Results 48
Fast screening of AFLP primer combinations 48
Genetic diversity as defined by AFLP fingerprinting 49
Discussion 50
Acknowledgements 52
References 52
Appendix A 55
1. Amplified fragment length polymorph isms 55
Chapter 4 PCR-RFLP identification system for Microcystis aeruginosa utilizing
the mcyB gene sequence 60
Introduction 60
Material and Methods 61
Chemicals 61
Cyanobacterial strains, isolates, cultivation and lyophilization 61
Environmental samples 61
Axenic strains 62
Media and culture 62
DNA extraction 63
Polymerase Chain Reaction (PCR) 64
PCR Cleanup 65
Sequencing 67
Composition of the genetic map 68
PCR of mcyB fragments for restriction analyses 68
Restriction of PCR fragments 69
Results 70
Discussion 77
References 79
Appendix B 83
VI
Summary 94
Opsomming 97
vn
List of Abbreviations
aa Amino acid
ABS Absorbed photon flux
Adda 3-amino-9-methoxy-2,6,8-trimethyl-1 O-phenyldeca-4,6-dienoic
acid
AFLP Amplified Fragment Length Polymorphism
ATP Adenosine triphosphate
AMP Adenosine monophosphate
AP Alkaline phosphatase
BCIP 5-bromo-4-chloro-3-indolyl phosphate
bp Base pair
CCAP Culture Collection of Algae and Protozoa, UK
CTAB N-cetyl-N-N-N-trimethyl ammonium bromide
dATP Deoxyadenine triphosphate
dCTP Deoxycytidine triphosphate
ddH20 Double distilled water
dGTP Deoxyguanosine triphosphate
DIG Digoxigenin
DMF Dimethylformamide
DNA Deoxyribonucleic acid
dNTP Deoxynuclein triphosphate
DTE Dithioerythritol
OTT Dithiothreitol
dTTP Deoxythymine triphosphate
dUTP Deoxyuracil triphosphate
EC Enzyme code
EDTA Ethylenediamine tetra-acetic acid, disodium magnesium
ELISA Enzyme-linked immunosorbent assay
ET Electron transport past QA-
e-value expectancy value
Fo Minimal fluorescence of a dark adapted sample
Fm Maximal fluorescence of a dark adapted sample
GC Gas chromatography
HPLC High performance liquid chromatography
Ik, the light intensity at the onset of light saturated photosynthesis in
urnol photon m-2 S-1
i.p. intraperitoneally
IPTG Isopropyl-f3-D-galactoside
i.v. intravenous
kb Kilobase
kDa Kilodalton
LB Luria Bertrani
LDso Lethal dose
LDH Lactate dehydrogenase
Vlll
MC Microcystin
Mdha N-methyl-dehydroalanine
MMPB 3-methoxy-2-methyl-4-phenylbutric acid
mRNA Messenger ribonucleic acid
NBT Nitroblue tetrazolium salt
NIES National Institute for Environmental Studies, Japan
pBmax maximum biomass specific photosynthetic rate in urnol O2 mg chi
a-1 h-1
PCC Pasteur Culture Collection
PCR Polymerase Chain Reaction
PCR-RFLPs Polymerase Chain Reaction-Restriction Fragment Length
Polymorph isms
pp Protein phosphatase
PPi Inorganic pyrophosphate
RC Reaction Centre
rONA Ribosomal deoxyribonucleic acid
rRNA Ribosomal ribonucleic acid
SOS Sodium dodecyl sulfate
SSC (20X) 0.3 M NaCitrate, 3 M NaCI, pH 7.0
STET 0.1 M NaCI, 10 mM Tris-HCI, 1 mM EOTA, 5 % Triton®X-100
TAE (1X) 40 mM Tris-acetate, 1 mM EOTA, pH 8.0
TE 10mM Tris-HCI, 1 mM EOTA, pH 8.0
TOC Total organic carbon
Tris 2-amino-2-(hydroxymethyl)-1,3-propanediol
tRNA Transfer ribonucleic acid
UP University of Pretoria
UV Ultraviolet
UV Strain in the University of the Free State Culture collection
WHO World Health Organization
X-gal 5- brom o-4-ch loro-3-i ndolyl- ~-O-ga lactosid e
X-phosphate Toluidinium salt
IX
List of Units
Anti-digoxigenin-AP conjugate
One unit is the quantity of enzyme that hydrolyses 1 ).lM p-
nitrophenylphosphatase in 1 minute at 37 oe.
LD50
Dose of toxin that kills 50 % of the animals tested.
Klenow
One unit is the enzyme activity that incorporates 10 nmol of total
nucleotides into an acid-precipitate fraction in 30 minutes under assay
conditions.
Restriction Enzyme
One unit is the enzyme activity that completely cleaves 1).lg",DNA in 1 h at
enzyme specific temperature in a total volume of 25 ul.,
Taq DNA Polymerase
One unit is the quantity of enzyme required to catalyze the incorporation of
10 nmol of dNTP's into acid insoluble material in 30 minutes at 74 oe.
Weiss Units
One unit is the quantity of enzyme that catalyses the exchange of 1 nmole
of 32p from pyrophosphate into [y, ,o-32P]ATP in 20 minutes at 37 oe.
x
List of Figures
Page Number
Figure 2.1 Cyanobacterial bloom visible as green scum on the water
of the Hartbeespoort Dam. 9
Figure 2.2 Chemical structure of microcystin-LR. 15
Figure 2.3 A schematic representation illustrating the process to generate
amplified fragment length polymorph isms (AFLPs). 29
Figure 3.1 AFLP band patterns generated using primer combinations
EcoR1 +ACAlMse1 +CAC (A) and EcoR1 +ACAlMse1 +CAG (B). 49
Figure 3.2 Combined cluster analysis derived from AFLP analysis of 13
Microcystis aeruginosa strains using eight AFLP primers. 50
Figure A1. Primer screening with either IRDye700™-labeled EcoR1 (I) or
IRDye800™-labeled EcoR1 (II) primers. 55
Figure 4.1 Representation to demonstrate the process involved in the
regeneration of PCR-RFLP polymorphic fragments using the mcyB
gene sequence. 69
Figure 4.2 PCR fragments obtained after amplification of Microcystis aeruginosa
strains with primer pair Tax 1OP/Tox 4M. 75
Figure 4.3 Fragments obtained after restriction of with Microcystis aeruginosa
strains after amplification with primer pair Tax 3P/Tox 2M. 76
Figure B1. Sequence alignment of the mcyB genes from M. aeruginosa strains
PC7813 and UV027 to published sequences on GenBank 83
Figure B2. Differences in restriction sites in the sequences from Microcystis
aeruginosa strains PCC7813 (A) and UV027 (B) obtained after
analysis using the software programme Webcutter 2.0. 86
Xl
List of Tables
Page Number
Table 3.1 Table of Microcystis aeruginosa strains used in the study describing
the origin of strains. 45
Table A1. Datamatrix composed after analysis of AFLP fingerprints of 13
Microcystis aeruginosa strains. 56
Table A2. Genetic distances obtained after analysis using UPGMA. 59
Table 4.1 Table of Microcystis aeruginosa strains used in the study describing
the origin of strains, as well as the toxicity. 62
Table 4.2 Primers used in the study describing sequence, orientation and
melting temperatures. 66
Table 4.3 List of unique restriction enzyme sites obtained after analysis of the
mcyB gene sequences from strains PCC7813 and UV027. 71
Table 4.4 Number of indels observed after restriction of the mcyB gene with
selected enzymes of Microcystis aeruginosa strains. 77
Xll
Chapter I
Introduction
Cyanobacteria are one of the earth's most ancient life forms. Evidence of their existence on
earth, derived from fossil records, encompasses a period of some 3.5 billion years, i.e. the
late Precambrian era (Robarts and Zohary 1987). Cyanobacteria are the dominant
phytoplankton group in eutrophic freshwater bodies worldwide. They have caused animal
poisoning in many parts of the world and may present risks to human health through
drinking and recreational activity (Carmichael and Falconer 1993). Cyanobacteria produce
two main groups of toxins namely neurotoxins and peptide hepatotoxins (Carmichael
1992). They were first characterized from the unicellular species Microcystis aeruginosa,
which is the most common toxic cyanobacterium in eutrophic freshwaters (Carmichael
1992).
The first livestock mortalities in South Africa caused by cyanobacteria blooms were
observed by Steyn (1945) who noted that over a period of twenty-five to thirty years, the
deaths of many thousands of livestock around pans in the North West and Mpumelanga
Provinces, South Africa were reported by farmers in the region, who referred to the
condition as 'pan sickness'. The first death suspected to be due to algal poisoning were
brought to the attention of staff at Onderstepoort Veterinary Laboratories by farmers from
the Amersfoort district in 1927. Since then numerous reports exist, documenting the
incidents of stock losses in South Africa such as the poisoning of an entire dairy herd in
1996 near Kareedouw in the Tsitsikamma area.
South Africa Js a water-stressed country where water planners and managers are faced
with increasingly complex issues. The country is largely semi-arid and prone to erratic and
unpredictable extremes of droughts and floods. Rivers are the main source of water in
South Africa. Country-wide, the average annual rainfall is a little less than 500 mm,
compared to the world average of about 860 mm. On average, only some 9 per cent of all
rainfall, reach the rivers. The average annual potential evaporation is higher than the
rainfall in all but a few isolated areas where rainfall exceed 1 400 mm per year.
Consequently, only about 32 000 million kilolitres of the annual run-off can be economically
exploited using current methods. Apart from erratic rainfall and the low ratio of run-off,
resistance to the provision of funding for cyanobacterial research is often based on the
argument that there are far greater health problems and that funding needs to be directed
to the alleviation of diseases (Harding and Plaxton 2001). This argument is in contrast with
the fact that the quality of many water sources in South Africa is declining. The decline is
primarily a result of eutrophication and pollution by trace metals that are micro-pollutants
(DWA 1986).
In this study samples of cyanobacterial blooms were collected from the Hartbeespoort ,
Rietvlei and Roodeplaat Dams, respectively. These dams are located in the populous and
economically important industrial hub of Gauteng and North-West Provinces. The
Hartbeespoort Dam was completed in 1925, and was formed by the damming of the
Crocodile River below its confluence with the Magalies River 25 km to the west of Pretoria.
When the dam is full, the shore-line is 56 km, the surface area is 1 283 ha. and the volume
of water is estimated at 13 000 000 rrr', with a maximum depth of 9.6 m. The dam lies in a
basin of shale and diabase of the Pretoria series. It serves as a source of water for
irrigation purposes to the extensive farming area to the north of the Magalies Mountains, as
2
well as domestic consumption for the town of Brits. The dam lies in an area of summer
rainfall, and in the transition between the Highveld and Bushveld vegetation types. As a
result it is not subject to seasonal extremes of temperature so typical of the Highveld
(Allanson and Gieskes 1961).
Hartbeespoort Dam's eutrophication problems arise largely from two sources, namely
treated sewage from Johannesburg's Northern Sewerage Works, and untreated sewage
and other pollutants from the Jukskei River, which runs through Alexandra. These sources
contribute significant quantities of phosphates and nitrates, causing the dam to be
hypereutrophic (Robarts and Zohary 1987). During April 2003 a cyanobacteria bloom of 30
cm thick and covering an area of 4 ha was detected in the Hartbeespoort Dam. This
particular bloom did not only pose a health risk to both animals and humans, but could
negatively impact on suppliers and users of potable water. The development of undesirable
blooms detracts the visual appearance of the dam, obstruct swimmers, fishermen and
motorboats; clog irrigation and stock water pipes; and disrupt water treatment plants.
When the scum decay, major odour problems result that also affects the taste of the water.
The decaying biomass furthermore removes oxygen and could cause fish kills and the
deaths of other aquatic life forms. Because of the potential problems the Department of
Water Affairs invested half a million Rand to get contractors to remove the cyanobacteria
by pumpsuction (Louw 2003).
The Roodeplaat dam was completed in 1950 and was constructed to store water that could
be used for irrigation purposes. The dam has a storage capacity of 40 000 000 m3 and is
built in the Pienaars River some 20 km north-east of Central Pretoria. The catchment area
is 684 km2, and the average rainfall in the catchment is 720 mm per annum. The geology
3
consists of qwartzite and shale, with grass and bushveld as vegetation cover. The original
natural run-off supplied a good quality raw water to the dam. However, as the catchment
area developed, a denser population settled with both accommodated in industrial and
domestic areas, giving rise to ever increasing pollution. Over and above natural run-off
flowing into the dam, the dam receives treated water from two sewage treatment plants,
Zeekoegat and Baviaanspoort (Langenegger and Partners 1997).
The Rietvlei dam is situated approximately 15 km south-east of Pretoria and its catchment,
covering an area of 481 krn", extends predominantly south-east to include Kempton Park's
north-easten urban area. The Johannesburg International airport forms the catchment's
eastern boundary. The river originates in a marshy area east of Kempton Park and en route
to the Rietvlei dam, passes through a number of wetlands. The catchment area is
extensively utilized by agricultural activities where water is withdrawn for irrigation. The
water's natural run-off is augmented by springs and effluent from the Hartbeesfontein
sewage works. During 1994, the Pretoria Metropolitan Substructure launched a
comprehensive study of Rietvlei Dam to consider the available management options to
ensure the long-term viability of the Rietvlei system as a source of economical, high quality
drinking water to the citizens of Pretoria (Van der Walt et al. 2001).
This study of Rietvlei Dam was completed in 1996 and the conclusion was that the quality
of the water in Rietvlei Dam has deteriorated considerably over the past 20 years (Van der
Wait et al. 2001). This was attributed to increased effluent discharges into the catchment,
reduced effluent quality and the reduction in natural runoff, which dilutes and flushes out
pollutants. As a result of the deteriorating water quality, regular blooms of cyanobacteria
occur, and will continue to occur with increasing severity, with the consequent bad odours
4
and tastes. The water from Rietvlei Dam has been utilized as a drinking water source for
the City of Pretoria since 1934. Since then, the treatment plant at the Rietvlei Dam had to
be repeatedly extended to accommodate changes in the raw water characteristics,
particularly to deal with the eutrophication of the dam. The original processes of
flocculation, settling, filtration and chlorination had been augmented with dissolved air
flotation in 1988, while granular activated carbon [GAC] was added in 1999. The cost for
implementing activated carbon filtration as part of the treatment process for the production
of potable water from Rietvlei Dam was R 20.4 million with a estimated operational cost
increase of 23c/m3 (Van der Walt et al. 2001).
To understand the genetic diversity and population structure of Microcystis aeruginosa, it is
important to study diversity of isolated strains and their counterparts in nature, and only
then can physiological data gained from culture studies begin to be confidently extrapolated
to natural conditions (Castenholz and Waterbury 1989). Inadequate culture conditions
leading to the loss of various morphological characteristics, with researchers inability to
grow certain organisms in the laboratory, and misidentifications of strains in culture
collections make it difficult in many cases to apply taxonomic assignments based on
cultures to field populations (Wilmotte 1994). Both classification systems for the
bacteriological approach, as well as the traditional botanical approach, rely primarily on
morphological characteristics of cells and colonies, and do not necessarly lead to the
identification of phylogenetically coherent taxa. At all taxonomic levels, the DNA based
methodology (i.e. polymorph isms in genomic DNA or specific gene sequences) is currently
the most promising approach. Variation in genomic DNA sequences is independent of
cultivation or growth conditions. The other advantage is that the information can be
retrieved by PCR from small quantities of DNA extracted from laboratory cultures or from
5
the natural environment (Pan et al. 2002). The purpose of the present study was thus, to
compare the genetic diversity of geographicly unrelated Microcystis aeruginosa strains in
culture, to that of Microcystis strains obtained in nature (i.e. Hartbeespoort, Roodeplaat and
Rietvlei dams) using amplified fragment length polymorph isms (Chapter 3). The second
objective of the study was to produce a fast screening method based on the polymerase
chain reaction to detect the presence or absense of the mycotoxins in water, based on the
premesis that the presence of the mcyB gene is indicative of toxicity. Differences in the
mcyB gene sequence was further used to differenciate between the different Microcystis
strains (Chapter 4).
References
Allanson BR & Gieskes JMTM. 1961. An introduction to the Limnology of the
Hartbeespoort Dam with special reference to the effect of industrial and domestic
pollution. Part Ill. Hydrobiologia 18: 76-95.
Carmichael WW. 1992. Cyanobacteria secondary metabolites - the cyanotoxins. Journal
of Applied Bacteriology 72: 445-459.
Carmichael WW & Falconer IR. 1993. Diseases related to freshwater blue-green algal
toxins, and control measures. In: Algal toxins in seafood and drinking water,
Falconer IR (ed). Academic Press. pp. 187-209.
Castenholz RW & Waterbury JB. 1989. Oxygenic photosynthetic bacteria, group I.
Cyanobacteria. In J. T. Staley, M. P. Bryant, N. Pfennig, and J.G. Holt(ed.),
Bergey,s manual of systematic bacteriology. Williams and Wilkins Co., Baltimore,
Md. pp. 1710-1728.
6
DWA (Department of Water Affairs). 1986. Management of the water reeourses of the
Rebublic of South Africa. Department of Water Affairs (DWA). CTP Book Printers,
Cape Town. pp. 3-4.
Harding WR & Plaxton B. 2001. Cyanobacteria in South Africa: A review. WRC Report
No: TT 153/01. pp. 9-10.
Langenegger 0 & Partners CC. 1999. Feasibility study of raw water sources which could
supplement the bulk in the Northern Pretoria area. Report to Pretoria Metro, City
Engineers Department.
Pan H, Song LR, Liu YD & Borner T. 2002. Detection of hepatotoxic Microcystis strains by
PCR with intact cell from both culture and environmental samples. Arch. Microbiol.
178: 421-427.
Louw M. 2003. Alge van dam gesuig om stank weg te kry. Beeld Newspaper, 9 April
2003.
Robarts RD & Zohary T. 1987. Temperature effects on photosynthetic capacity,
respiration, and growth rates of bloom-form ing cyanobacteria. NZ J. Marine and
Freshwater Res. 21: 391-399.
Steyn DG. 1945. Poisoning of animals and human beings by algae. S. Afr J. Sc. 41: 243-
244.
Wilmotte, A. 1994. Molecular evolution and taxonomy of the cyanobacteria, pp. 1-25. In D.
A. Bryant (ed.), The molecular biology of cyanobacteria. Kluwer Academic
Publishers, Dordrecht, The Netherlands. pp. 1-25.
Van der Walt CJ, Taljaard C, Zdyb L & Haarhof J. 2001. Granular activated carbon for the
treatment of eutrophic water at Rietvlei Dam. Presented at the WISA Biennial
Conference, 28 May-1 June 2000. Chemical Technology July/August 2001.
7
Chapter II
Literature review
2.1 Cyanobacteria
Cyanobacteria are the dominant phytoplankton group in eutrophic freshwaters (Davidson
1959; Negri et al. 1995). They are prokaryotes possessing a cell wall composed of
peptidoglycan and lipopolysaccharide layers instead of the cellulose of green algae
(Skulberg et al. 1993). All Cyanobacteria are photosynthetic and possess chlorophyll a
(Chi a). Morphological diversity ranges from uniceiis; to small colonies of cells to simple
and branched filamentaus farms (Weier et al. 1982).
The cytoplasm contains many ribosomes and appears granular. In filamentaus forms, fine
plasmodesmata connect adjacent cells. The plasmalemma may form invaginations but in
addition, there are a series of parallel membranes within the cytoplasms that are separate
from the plasmalemma. The process of photosynthesis occurs on these membranes,
which contain Chi a, and a few other accessory pigments are grouped together in rods and
discs that are called phycobilisomes, that are attached to the outside of the membranes
(Weier et al. 1982). These pigments capture light between wavelengths 550 to 650 nm, and
pass their light energy on the Chi a.
Other cytoplasmic inclusions are gas vesicles, granules of glycogen, lipid droplets,
granules of arginine and aspartic acid polymers and polyhedral carboxysomes. Gas
vesicles are especially prominent in floating aquatic species and it is likely that they
contribute to buoyancy. The nucleoplasm is sharply delimited from the cytoplasm, even
though there is no nuclear membrane as in bacterial cells, it is composed of a circular,
double-stranded molecule of DNA. Cell volume ranges from 5 to 50 IJm3, in contrast to
8
0.01 to 5 IJm3 for bacteria. They have about twice as much DNA as does E. co/i, with one
chromosome (Weier et al. 1982).
About one third of all cyanobacteria species are able to fix atmospheric nitrogen. In most of
the cases, nitrogen fixation occurs in specialized cells called heterocysts. These are
enlarged cells with an envelope. The internal membranes no longer lie in parallel arrays,
and these cells may have lost photosystem II, hence do not generate O2. A
plasmodesmata connect the heterocysts to adjacent cells within a filament. It is possible
that the thick wall maintain an anaerobic condition in the cytoplasm (Weier et al. 1982).
Cyanobacteria are especially abundant in shallow, warm, nutrient rich or polluted water that
is low in oxygen, and can grow to form thick scums that could colour the water, creating
blooms (Figure 2.1 )(Stotts et al. 1993). Most blooms disappear in a few days, but the cells
can release toxins lethal to animals that swim in or drink the water (Weier et al. 1982).
Figure 2.1 Cyanobacterial bloom visible as green scum on the water of the Hartbeespoort
Dam (December 2002).
9
2.2 Association of environmental parameters with cyanobacterial blooms and
toxicity of microcystin
Fieldstudies in South Africa (Wicks and Thiel 1990) have shown that certain environmental
factors are associated with the quantity of toxins found in cyanobacterial blooms. The
effects of environmental factors on toxin production by cyanobacteria have also been
shown by laboratory studies (Sivonnen 1990; Utkilen and Gjolme 1992).
2.2.1 Physical factors
Temperature
In general, cyanobacteria prefer warm conditions, and low temperatures are one of the
major factors that end cyanobacterial blooms. Robarts and Zohary (1987) found that
Microcystis was severely limited at temperatures below 15°C and were optimal at
temperatures around 25°C. Temperature alone may only partly determine bloom formation
and it is accepted that a combination of factors are responsible for a bloom to develop.
These are increasing temperatures, decreasing nutrients and increased water column
stability. This also explains why succession of algae usually follow patterns in freshwater
bodies from diatoms through chlorophytes to cyanobacteria.
Van der Westhuizen and Eloff (1985) determined that temperature has a most pronounced
effect on toxicity. The highest growth rate was obtained at 32°C, while the highest toxicity
was found at 20°C, but declined at temperatures higher than 28°C. At temperatures of 3TC
and 36°C toxicity was 1.6 and 4 times, respectively less than cells cultured at 28°C,
suggesting that highest growth rate is not correlated with highest toxicity. They considered
10
the decreased toxin production to be possibly related to decreased stress levels at
temperatures above 200e.
Temperature changes were found to induce variations in both the concentration and
peptide composition of the toxin (Yokoyama and Park 2003). A third toxic peptide [C] was
discovered at a higher concentration than either peptides A or B at 16°e. Peptide e was
suspected of containing aspartic acid rather than B-methylaspartic acid. Small quantities of
phenylalanine and arginine were detected in peptide C, as well as alanine [23%], leucine
[26%], aspartic acid [23%] and glutamic acid [27%]. The percentage content of peptide A
increased between 16°e and 36°e, while overall toxicity decreased sharply. This being due
to a decrease in the concentration of peptides A and B. Peptide e disappeared gradually at
higher temperatures, Van der Westhuizen and Eloff (1985) acribed this to reduced
synthesis or increased decomposition, rather than leaching, since cells were still growing
after the growth phase.
Light and buoyancy
The effect of light intensity on the fine structure of M. aeruginosa was investigated under
laboratory conditions. The optimal growth rate for M. aeruginosa cells was 3 600-18
000 lux (k lux x 18 :::0 1 urnol photons.m-2.s-1)(Abelovich and Shilo 1972). The lag phases
lasted approximately 5 days, followed by an 11-day period of exponential growth. At light
levels in the excess of 18 000 lux the growth rate declined rapidly. Pigment ratios and
visual pigmentation were found to change considerably at different light intensities. At 3 600
lux and lower, cultures were green for the duration of the experiment period of 28 days. At
5 700 lux, cultures were yellow, and at 18 000 lux they were orange. The ratio of Chl a to
carotenoids, plotted against light intensity showed that as light intensity increased,
11
carotenoid pigments increased relative to Chi a. A reduction in this ratio occurred with
ageing. Carotenoid pigments shield cells from high light intensity, preventing the
destruction of Chi a and the photo-oxidation of photosynthetic pigments (Abelovich and
Shilo 1972). In a recent publication it was reported that the quality of light (i.e. 16 urnol
photons.mi.s' in the red light spectrum) increase toxin production in a M. aeruginosa
strain (Kaebernick et al. 2000).
It was also found that the effect of light intensity affected the gasvacuole content and
thykaloid configuration. The gasvacuole content increased as light intensity increased to 6
000 lux, thereafter decreasing between 6 000 and 8 000 lux (Waaland et al. 1971),
suggesting that the vesicles could act as light shields in addition to their possible buoyancy
functions. The absence of gasvacuoles grown at low light intensities of 400 lux supported
this observation.
Buoyancy is regulated by a number of mechanisms, such as the form of stored
carbohydrates and turgor pressure regulation. Compositional changes in the diel
protein:carbohydrate ratios during buoyancy reversals suggest a complex relationship
between light and nutrients (N:P) (Villareal and Carpenter 2003). It, however, seems that
the regulation of gasvacuole synthesis is the most important. This almost unique feature of
cyanobacteria gives these organisms a significant advantage over other phytoplankton. In
turbulent waters cyanobacteria loose this advantage and often this characteristic is used to
control their blooms (Grobbelaar 2004).
12
2.2.2 Chemical factors
Nitrogen and phosphorus ratios
Much has been made of the relationship between prevailing ratios of nitrogen and
phosphorus, and the composition and density of phytoplankton assemblages that may
occur. While certain broad categories generally and accurately support prediction of which
algal division that may predominate, other biophysical features and attributes should not be
excluded from the equation. It is becoming increasingly apparent that, notwithstanding the
prevailing nitrogen and phosphorus ratio, the phytoplankton assemblage may be
significantly altered through biomanipulation, and without any changes whatsoever to the
ambient availability of nitrogen and phosphorus (Harding and Wright 1999). In 1986,
Carmichael demonstrated that the omission of nitrogen causes approximately tenfold
decrease in toxicity.
Iron and zinc
Certain metal ions such as Zn2+ and Fe2+ significantly influence toxin yield. Zn2+ is involved
in the hydrolysis of phosphate esters, the replication and transcription of nucleic acids, and
the hydration and dehydration of C02 (Sunda 1991). All cyanobacteria require Fe2+ for
important physiological functions such as photosynthesis, nitrogen assimilation, respiration
and chlorophyll synthesis (Boyer et al. 1987). It is not yet clear how Fe2+ deficiency
modulates microcystin production, but it has been noted that as cyanobacteria experiences
iron stress, they appear to compensate for some of the effects of iron loss by synthesizing
new polypeptides (Lukaé and Aegerter 1993).
13
2.3 The toxicology of microcystins in cyanobacteria
Cyanobacteria are capable of producing three kinds of toxins, the dermatotoxin, cyclic
peptide hepatotoxin, and the alkaloid neurotoxin. Serious illnesses such as hepatoenteritis,
a symptomatic pneumonia and dermatitis may result from consumption of, or contact with
water contaminated with toxin producing cyanobacteria (Hawkins et al. 1985; Turner et al.
1990, for review see Briand et al. 2003). The dermatoxins are mainly produced by marine
cyanobacteria, but the dermatotoxins Iyngbyatoxin A and aplysiatoxin are related to acute
dermatitis, poisoning and animal death, especially in Japan and Hawaii (Briand et al. 2003).
The neurotoxins include anatoxin-a, a depolarizing neuromuscular blocking agent;
anatoxin-a [s], an anti-cholinesterase; and saxitoxin and neosaxitoxin that inhibit nerve
conduction by blocking sodium channels (Carmicheal 1994, Briand et al. 2003).
Microcystins are a family of toxins produced by different species of freshwater
Cyanobacteria, namely Microcytis [order Chroococcales], Anabaena [order Nostocales],
and Oscillatoria [order Oscillatoriales]. Microcystins are monocyclic heptapeptides
composed of D-alanine at position 1, two variable L-amino acids at positions 2 and 4, y-
linked D-glutamic acid at position 6, and 3 unusual amino acids; ïs-Ilnkeo D-erythro-r.,-
methyl aspartic acid (MeAsp) at position 3; (2S, 3S, 8S, 9S)-3-amino-9-methoxy- 2, 6, 8
trimethyl-10-phenyldeca-4, 6-dienoic acid (Adda) at position 5 and N-methyl
dehydroalanine (MDha) at position 7. There are over 60 different microcystins that differ
primarily in the two L-amino acids at positions 2 and 4, and methylation/demethylation on
MeAsp and MDha. The unusual amino acid Adda is essential for the expression of
biological activity. Other microcystins are characterized largely by variations in the degree
of methylation; amino acid 3 has been found to be D-aspartic acid, replacing r.,-
methylaspartic acid and amino acid 7 to be dehydroalanine, replacing N-
14
methyldehydroalanine (An and Carmichael 1994; Trogen et al. 1996). The most common
microcystin, is microcystin-LR, where the variable L-amino acids are leucine (L) and
argenine (R). Its structure is shown in Figure 2.2 (An and Carmichael 1994).
Figure 2.2 Chemical structure of microcystin-LR (An and Carmichael 1994).
Some esters of glutamic acid have been observed for amino acid 6 replacing y-linked
glutamic acid itself and N-methylserine sometimes replaces amino acid 7. Variations in the
Adda subunit (amino acid 5) include O-acetyl-O-demethyl-Adda and (6Z)-Adda (Rinehart et
al. 1988).
The adda and D-glutamic acid portions of the mycrocystin-LR molecule play highly
important roles in the hepatoxicity of microcystins. Esterification of the free carboxyl group
of glutamic acid results essentially in inactive compounds. Some of the Adda subunits
assert little effect, especially the O-dimethyl-O-acetyl analogs. However, the Adda
molecules' overall shape seems to be critical since the (6Z0-Adda)(cis) isomer is inactive
(Rinehart et al. 1988).
15
2.3.1 Synthesis of Microcystins
As stated before Microcystis aeruginosa is an organism that produces a vast number of
peptides, some of which are highly toxic (Carrnichael 1986). The most commonly occurring
toxin is microcystin and to synthesize this complex peptide there obviously has to be
genetic material present in the organism. Different possible localities of this genetic material
have been investigated.
Chloroplast DNA
Shi et al. (1995) localised microcystins in a toxin-producing strain [pee 7820] and non-
toxin-producing strain [UTEX 2063] of Microcystis aeruginosa by using a polyclonal
antibody against microcystins in conjunction with immuno-gold labeling. In the non-toxin-
producing strain no specific labeling was found. In the toxin-producing strain specific
labeling occurred in the region of the nucleoid in the thylakoid, to a lesser extent in the cell
wall and sheath area. No specific labeling was found in cellular inclusions with storage
functions. The reasons for this could not be determined, but Shi et al. (1995) suggested
that microcystins are not compounds that the cell stores, but that they may be involved in
specific cell activities.
Plasmids
Vakeria et al. (1985) investigated genetic control of toxin production by plasmids commonly
found in some strains of Microcystis aeruginosa. Plasmid-curing agents were applied to
toxin-producing strains, but no significant decrease in toxicity was observed. Schwabe et al.
(1988) also supported this argument that toxin-producing strains do not contain plasmids.
Apart from the reports of Vakeria et al. (1985) evidence has been presented of a South
16
African strain [WR 70] that shows a decrease in toxicity after treatment with plasmid-curing
agents (Hauman 1981).
Thiotemplate Mechanism
Lipmann (1954) predicted a poly- or multienzymatic pathway of peptide synthesis and this
mechanism has been verified for various types of peptides (Laland and Zimmer 1973). The
first authors to propose the term thiotemplate mechanism and to distinguish this
mechanism from other mechanisms of non-ribosomal peptide synthesis were Laland and
Zimmer (1973). Many similarities are apparent when comparing ribosome-mediated
protein synthesis with the thiotemplate mechanism. The most notable similarities are [1] the
amino acids are activated through the formation of an amino acid adenylate, [2] the
activated amino acyl residue is transferred to a receptor molecule, and [3] the peptide chain
grows from the N-terminal end by insertion of the next amino acid at the activated C-
terminal.
2.3.2 Analysis of microcystins
There are five basic methods to analyze microcystins namely; those based on reactions
with a fluorescent probe; enzyme-linked immunosorbent assays [ELISA]; inhibition of
protein phosphatase and mass spectrometry (Dawson 1998); and by polymerase chain
reaction (PCR) (Baker et al. 2002, Pan et al. 2002). Shimizu and colleagues (1995, as cited
by Dawson 1998) targeted conjugated dienes using a synthesized fluorogenic reagent
called DMEQ- TAD. This reagent reacted with vitamin D metabolites and synthetic
analogues, and the fluorescent products could be quantified linearly down to fmol quantities
by HPLC. The reagent also reacted well with microcystin-LR, YR and RR at the conjugated
diene moiety (Add a). An and Carmichael (1994) used a direct competitive ELISA to
17
examine the specificity of the rabbit anti-microcystin-LR polyclonal antibodies. Cross
reactivity with some, but not all microcystin variants studied was observed and it became
clear that Adda and arginine are essential for expressing the antibodies specificity. The
inhibitor ICsD for microcystin-LR of the binding of microcystin-LR-horseradish peroxidase
conjugate to the antibodies was 3 ng/ml. McDermott et al. (1995) described an ELISA
potentially able to detect microcystins in water at a concentration as low as 100 pg/ml
water.
Microcystins are inhibitors of protein phosphatase (Honkanen et al. 1996). An and
Carmichael (1994) reported an ICsD of 6 ng/ml for microcystin-LR in their direct competitive
ELISA, whilst ELISA microcystin-LR/YR/RR detection limits of 0.10, 0.12, 0.14 and 0.20
ng/ml were reported by Yu et al. (2002). A screening method for microcytins in
cyanobacteria has been developed based on the formation of 3-methoxy-2-methyl-4-
phenyl butyric acid by ozonalysis (Harada et al. 1996). The acid was detected by electron
ionization-gas chromatography/mass spectrometry, using selected ion monitoring in a
procedure that detected nanogram levels of microcystin in only 30 min.
Baker et al. (2002) determined the potential of microcystin production by PCR amplification
of a gene involved in the microcystin biosynthetic pathway and the 16S rRNA gene of
Anabaena circinalis strains. Pan et al. (2002) used primers deduced from the mcy gene to
discriminate between toxic microcystin-producing and non-toxic strains. Cyanobacterial
cells enriched from cultures, field samples, and sediment samples could successfully be
used in the PCR assay.
18
2.3.3 Control and degradation of cyanobacterial blooms
Cousins et al. (1996) found in laboratory experiments with reservoir water using low levels
of microcystin-LR [10mg/L], that degradation of the toxin occurred in less than one week.
The toxin was stable for over 27 days in deionized water, and over 12 days in sterilized
reservoir water, indicating that in normal reservoir water instability is due to biodegradation.
Purified microcystins are also stable under irradiation by sunlight. However, significant
decomposition of toxins by isomerization of a double bond in the Adda-side chain, occurs
during sunlight irradiation in the presence of the pigments contained in cyanobacteria. The
half-life for the whole process was estimated to be about ten days. Microcystin-LR and RR
degraded much more rapidly when the toxins were exposed to UV light at wavelengths
around their absorption maxima [238-254nm] (Tsuji et al. 1995).
It was found by Lam et al. (1995) that most of the microcystin-LR present in cells remains
inside the cell until the cell is lysed. To control cyanobacteria blooms, cells are usually
lysed in the presence of chemicals (e.g. Regione A, NaOCl, KMn04, Simazine and CUS04)
that inhibit new cell wall synthesis, enzymatic reactions or photosynthesis (Kenefick et al.
1993, Lam et al. 1995). A sudden release of microcystins into the surrounding waterbody
can present a hazard to animals and humans using the water (Lam et al. 1995), as well as
when used as potable water source.
Chemical control
Verhoeven and Eloff (1979) reported that copper is an effective algicide in natural waters
for the control of cyanobacteria. Microcystis aeruginosa isolated from the Hartbeespoort
Dam [UV-006], as well as Microcystis aeruginosa Berkeley strain 7005 [UV-007] were used
to test the effects of copper on the ultrastracture of cells. Once cultures had been grown,
19
copper sulphate was added at different concentrations. It was found that toxicity of the
copper was depended on cell concentration. At cell concentrations of 1.8x1 0 cells/ml [148
Klett units], 0.3 and 0.4 ppm Cu2+ decreased growth rates temporarily, whereas 0.5 ppm
Cu2+ caused cell death. It was found that copper decreases the electron-density of the
nucleoplasm, as well as cause aggregation of the DNA fibrils. Thykaloids were present as
short membrane structures and membrane-bounded inclusions, while polyphosphate
bodies disappeared.
Hoeger et al. (2002) tested the effica.cy of ozonation coupled with various filtration steps to
remove toxic cyanobacteria from raw water. They found that ozone concentrations of at
least 1.5 mg/L were required to provide enough oxidation potential to destroy the toxin
present in 5 x 10-5 Microcystis aeruginosa cells/ml (total organic carbon (TOC), 1.56 mg/L).
High raw water with high cyanobacterial cell densities reduced the efficiency of the process,
resulting in cell lysis and the liberation of intracellular toxins.
Biological control
Microcystins can be biodegraded by complex natural populations of micro-organisms from
diverse ecosystems, such as sewage sludge (Lam et al. 1995), lake sediment, natural
waters (Jones and Orr 1994; Jones 1990) and biofilms (Saitou et al. 2002). Jones (1990)
demonstrated that microcystins extracted from Microcystis aeruginosa blooms were
biodegraded in natural water bodies within 2-3 weeks. This time was reduced to a few days
if the water body was previously exposed to microcystins.
Scott and Chutter (1981) suggest that viruses may be an important factor in controlling
cyanobacteria. The first virus that was capable of lysing a filamentous cyanobacteria
20
Plectonema sp. was isolated from an oxidation pond. It was assumed by the authors that
viruses were not important in controlling eukaryotic algae in large cultures. Thus on the
basis of there being no apparent evidence to the contrary (e.g. reviews by Lemke 1976;
Hoffman and Stanker 1976; Dodds 1979). Recently it was demonstrated that aqueous and
methanoIic extracts of cultured cyanobacteria of several genera, including Microcystis,
expressed antiviral activity against the influenza virus (Zainuddin et al. 2002).
A myxobacterium capable of lysing freshwater algae was first reported by Stewart and
Brown (1969, 1971). Scott and Chutter (1981) suggested that myxobacteria are a more
important biological agent than viruses in controlling algae populations, since they are less
host specific. Pioneering work was conducted by Canter (1950, 1951, 1957) on fungal
parasites of freshwater algae in the English Lake District. Up to 70 of the individuals in an
algae population could be infected by fungal parasites. A large proportion of fungal
parasites were found to be host-specific, suggesting that in some cases, they may prevent
cyanobacteria species from growing, while allowing environmental friendly species to
proliferate.
Certain Pyrrophyta and Chrysophyta are capable of phagotrophic nutrition. In some
instances, smaller algae such as Chlorella may be ingested. Cole and Wynne (1974) noted
that when the chrysophyte Ochromonas danica was mixed into a culture with Microcystis
aeruginosa, they declined 30-fold in 10 min, as a result of ingestion by Ochromonas.
Numerous reports exist in the literature documenting the success of using barley straw for
\ the control of cyanobacteria. Newman and Barret (1993) demonstrated that decomposing
barley straw effectively inhibits the growth rate of Microcystis aeruginosa to a sixth of that
21
achieved in control experiments. This inhibitory effect is presumably caused by the release
of a chemical during aerobic microbial decomposition of the straw. This chemical, or
chemicals, are so far unidentified, but there are several probabilities; firstly, antibiotics may
be produced by the fungal flora active in the decomposition of the barley straw; secondly,
during decomposition the release of modified cell wall components may have an effect on
cyanobacterial growth; and thirdly, certain phenolic and aromatic compounds produced
during cell wall biodegradation may also contribute to the declining of algal numbers. It
seems that the inhibitory effect is rather algistatic than algicidal; therefore, the presence of
decomposing barley straw can help prevent the development of cyanobacterial blooms.
Another report on the application of hay by a local municipality, to two small farm dams in
Linfield Park near Pietermaritzburg, South Africa, suggested that hay may be useful in
controlling cyanobacterial growth. The farm dams receive the bulk of their nutrient rich flow
from a small sewage works, which caused the development of cyanobacterial scums.
Reduction of algae populations in the upper of the two dams, closest to the sewage works,
was total, with zero algae being detected within a few weeks of application of small
quantities of hay in the water bodies (Harding and Plaxton 2001).
Water that had been treated with chlorine may have killed the algae, but the result will be
the release of the toxins into the water. Very high concentrations of chlorine could,
however, inactivate the microcystins. Conventional water treatment processes do not
completely remove microcystins from raw water, even when activated carbon is included in
the treatment (Lambert et al. 1996).
22
Blooms have been controlled with the treatment of lime without any significant increase in
microcystin concentration in the surrounding water (Kenefick et al. 1993). Chemical control
of Microcystis blooms appears to be the best solution, thus removing the source of the
microcystins. It has been found that microcystins persist in the dried crust of lakes formed
as water levels recede during dry seasons. Large quantities of microcystins leach from the
dry materials upon re-wetting within 48 hours (Jones et al. 1995; Brunberg and Blomqvist
2002). This could present a significant problem with coagulation and sedimentation
treatment as the water would not be suitable for consumption for up to three weeks before
biodegradation commences (Jones 1990).
2.3.4 Toxicity
There have been many reports of the intoxication of birds, fish and other animals by
cyanobacterial toxins (Vascanceles et al. 2001; Alonso-Andicoberry et al. 2002; Best et al.
2002; Romanowska-Duda et al. 2002; Krienitz et al. 2003). As stated before, blooms of
cyanobacteria usually follow enrichment by nutrients such as phosphates and nitrates in
the water. Most of these nutrients are derived from human wastes such as sewage and
detergents, industrial pollution, run-off of fertilizers from agricultural land, and the input of
animal or bird wastes from intensive farming (Bell and Codd 1994; Baker 2002). Illnesses
caused by cyanobacterial toxins to humans fall into three categories; gastroenteritis and
related diseases, allergic and irritation reaction, and liver diseases (Bell and Codd 1994).
Microcystins have also been implicated as tumour-promoting substances (An and
Carmichael 1994; Bell and Codd 1994; Rudolph-Bëhner et al. 1994; Trogen et al. 1996;
Zegura et al. 2003).
23
The LD50of microcystin-LR intraperitoneally (i.p) or intravenous (i.v.) in mice and rats is in
the range 36-122 jJg/kg, while the inhalation toxicity in mice is similar; LCT50=180
mg/min/m3 or LD50=43 jJg/kg (Stoner et al. 1991). Therefore microcystin-LR has
comparable toxicity to chemical organophosphate nerve agents. Symptoms associated with
microcystin intoxication are diarrhea, vomiting, piloerection, weakness and pallor (Bell and
Codd 1994). Microcystin targets the liver, causing cytoskeletal damage, necrosis and
pooling of blood in the liver, with a consequent large increase in liver weight. Membrane
blebbing and blistering of hepatocytes in vitro has been observed (Runnegar et al. 1991;
Romanowska-Duda et al. 2002). High chromatin condensation and apoptotic bodies were
observed in 90% of the cells of Sirode/a oligorrhizza and rat hepatocytes after a treatment
with microcystin-LR (MC-LR=500mug/dm) (Romanowska-Duda et al. 2002). Death
appears to be the result of haemorrhagic shock (Hermansky et al. 1990) and can occur
within a few hours after a high dose of microcystin-LR (Falconer et al. 1981; Bell and Codd
1994). The concentration of microcystin-LR in drinking water for humans as prescribed by
the world health organization (WHO) is 1 jJg\L (WHO 1998), however, Ueno et al. (1996)
proposed a value of 0.01 jJg/L, based on a possible correlation of primary liver cancer in
certain areas of China with the presence of microcystins in water of ponds, rivers and
shallow wells.
Mechanism of action of microcystins
It is known that microcystins mediate their toxicity by uptake into hepatocytes via a carrier-
mediated transport system, followed by the inhibition of serine protein phosphatases 1 and
2A. The protein phosphorylation imbalance causes disruption of the liver cytoskeleton,
which leads to massive hepatic haemorrhage that causes death (Honkanen et al. 1996;
Eriksson et al. 1990a, b; Romanowska-Duda et al. 2002). The entry of toxin into the
24
hepatocytes of the liver and other targeted tissues is accomplished by the broad specificity
anion transport bile acid carrier (Runnegar et al. 1991). In both cultured and in vitro
hepatocytes, a rise in the amount of phosphorylated protein as a consequence of
phosphatase inhibition was observed (Yoshizawa et al. 1990). The action of microcystin as
a phospatase inhibitor is not limited to mammalian cells, but also applies to plant
phosphatases (MacKintosh et al. 1990; Siegl et al. 1990). It is, therefore, likely that the
microcystins are general inhibitors of eukaryotic phosphatases of types 1 and 2A, limited
only by the ability of the toxins to enter cells.
Phosphatase inhibition
The National Cancer Center Research Institute, Tokyo did discover the potency of
microcystin-LR as an inhibitor of protein phosphatases types 1 and 2A (Yoshizawa et al.
1990; Matsushima et al. 1990) and this was also confirmed in other studies (MacKintosh et
al. 1990; Honkanen et al. 1996; Eriksson et al. 1990a, b). The toxin-phosphatase
interaction is extremely strong, and binding is essentially stoichiometric. Constant accurate
inhibition can, therefore, only be obtained by extrapolation of the phosphatase
concentration to zero. The value of kj for protein phosphatase types 1 and 2A has been
reported to be between 0.06-6 nM and 0.01-2 nM, respectively with microcystin-LR
showing up to a 40-fold higher affinity of microcystin-LR for protein phosphatase type 28.
This is at least 1 000 fold lower than that for phosphatase type 1, while no interaction of
microcystin-LR was observed with protein phosphatase type 2C or with a variety of other
phosphatase or protein kinases (MacKintosh et al. 1990; Honkanen et al. 1996; Suganuma
et al. 1992).
25
The correlation between inhibition of phosphatase activity and toxicity is indicated by the
results of Runnegar et al. (1993), who administered microcystin- YM or LR to mice and
observed that inhibition of liver protein phosphatase 1 and 2A activity preceded or
accompanied clinical changes due to microcystin intoxication in all cases. Inhibition of
protein phosphatases leads to phosphorylation of cytoskeletal protein and cytoskeletal
associated protein and consequent redistribution of these proteins. Ghosh et al. (1995)
showed that the collapse of cytoskeletal actin microfilaments occurs in rat hepatocytes prior
to the dislocation of the associated proteins, x-actinin and talin rather than being caused by
their dislocation.
Other effects of microcystins
Hermansky et al. (1991) observed a decrease in hepatic microsomal membrane fluidity,
when they administered mice with microcystin-LR. These changes involved an indirect and
secondary effect of the toxin, as no changes in membrane fluidity were observed when
microcystin was incubated with control mierosomes in vitro.
LeClaire et al. (1995) suggested a potential cardiogenic component in the pathogenesis of
shock, in addition to the effects on the liver. The authors observed a sustained, rapid
decline in cardiac output and stroke volume in rats intoxicated with microcystin-LR. The
acute hypotension was responsive to volume expansion with the whole blood, and the
acute drop in heart rate responded to both isoproterenol and dopamine. A peripheral
vasoconstriction appeared to occur in response to hypotension.
26
2.4 Identification, diversity and population structure
The current cyanobacterial taxonomy does not provide an unequivocal system for the
identification of toxigenic and bloom-forming genus Microcystis (Komárek 1991). The
ambiguities that exist in the cyanobacterial taxonomy are due to the expressed variability,
minor morphological and developmental characteristics used for identification, classification
of the genus or species level (Doers and Parker 1988; Rippka 1988). Depending on the
taxonomic parameters used for classification, which differs in their emphasis on the cell
size, shape, buoyancy, toxicity of the planktonic, freshwater cyanobacteria, different
generic assignments may be made (Rippka 1988; Rippka and Hardman 1992).
2.4.1 Molecular Tools for culture identification
rRNA and rDNA genes
The sequence signatures found in the 18S rDNA and 16S rRNA gene locus have been
shown to be suitable for differentiation of bacteria at inter- and intrageneric taxonomic
levels (Friedl and O'Kelly 2002; Lee and Bae 2002; Neiland et al. 1997; Fox et al. 1992;
Woese 1987). In a study by Neiland et al. (1997) the 16S rRNA gene was applied to
illustrate the evolutionary affiliations among Microcystis strains, other cyanobacteria, and
related plastids and bacteria. It was concluded from the study that Microcystis aeruginosa
was a monophyletic group, but the genus Microcystis was polyphyletic (Lee and Bae 2002;
Neiland et al. 1997) and contained two strains that clustered with unicellular cyanobacteria
belonging to the genus Synechococcus. The clustering of related Microcystis strains,
including strains involved in the production of the cyclic peptide toxin microcystin, was
consistent with cell morphology, gasvacuolation, and the low G+C contents of the
genomes. The authors also found that the Microcystis lineage to be distinct from the
lineage containing the unicellular genus Synechocystis and the filamentous, heterocyst-
27
forming genus Nostoc. It is interesting to note that Neiland et al. (1997) found no correlation
between the evolution of the 16S rRNA gene and the toxicity of Microcystis strains.
However, the major Microcystis taxonomic cluster exhibited a high incidence of toxic
representatives and these were delineated from the non-toxic groups.
Polymerase chain reaction-restriction fragment length polymorphisms
Restriction fragment length polymorphisims (RFLPs) represents a DNA-based marker
system that makes use of the detection of differences in the length of restriction fragments
generated by the complete digestion of genomic DNA with restriction endo-nucleases
(Sambrook et al. 1989). PCR-RFLPs is a modification of the above, as conventional
RFLPs proved to laborious and require Southern hybridization and probes to detect the
polymorphisms (Southern 1975). In the PCR-based system, a specific genomic sequence
is amplified via PCR utilising primers designed to amplify the specific genomic region of
interest. These fragments are then restricted with appropriate restriction enzymes.
Fragment length polymorph isms are generated when a particular recognition site of a
restriction enzyme is absent in one individual and present in another, resulting in differently
sized restriction fragment at a locus (see Figure 4.1, Chapter IV). The polymorphic
fragments are then visualized by resolving the DNA fragments using electrophoresis
(Venter and Botha 2000).
Amplified Fragment Length Polymorphisms
Amplified fragment length polymorph isms (AFLPs), developed by Zabeau and Vos (1993),
is a reproducible, multiplex assay with the ability to generate large numbers of polymorphic
genomic fragments. The technology involves the restriction digestion of genomic DNA,
28
adapter ligation, which is followed by peR rounds of pre-selective and selective
amplification of restricted fragments (Vos et al. 1995) (Figure 2.3).
Comparative studies indicate that AFLPs offer a high level of utility compared with other
maker systems (Powell et al, 1996, Venter and Botha 2000). However, AFLPs are
technically more demanding, require more DNA (0.2 to 1 ug per reaction), and are more
expensive than RAPDs. Because of their large genome coverage AFLP on average give
50-100 bands compared to 20 for RAPDs. Thus, AFLPs appear to be particularly useful for
fingerprinting and can be used to assay genetic diversity within species (Powell et al.
1996).
DNA isolation
•
Double stranded DNA
AFLPanalysis
Restriction digestion
Ligate adapters Preamplification
Anneal primers Selective amplification
Analysis by gel electrophoresis
Figure 2.3 A schematic representation illustrating the process to generate amplified
fragment length polymorphisms (AFLPs).
29
References
Alonso-Andicoberry C, Garcia-Villada L, Lopez-Rodas V & Costas E. 2002. Catastrophic
mortality of flamingos in a Spanish national park caused by cyanobacteria. Veterinary
Record 151: 706-707.
Abelovich A & Shilo M. 1972. Photo-oxidative death in blue-green algae. J. Bact. 111 682-
689.
An J & Carmichael WW. 1994. Use of a colorimetrie protein phosphatase inhibition assay
and enzyme linked immunosorbent assay for the study of microcystins and nodularins.
Toxicon 32: 1495-1507.
Baker LC. 2002. Cyanobacterial harmful algal blooms (CyanoHABs): Developing a public
health response. Lake and Reservoir Management 18: 20-31.
Baker JA, Entsch B, Neiland BA & McKay DB. 2002. Monitoring changing toxigenicity
bloom by molecular methods. Appl. Environ. Microbiol. 68: 6070-6076.
Bell SG & Codd GA. 1994. Cyanobacterial toxins and human health. Rev. Med. Microbiol.
5: 256-264.
Best JH, Pflugmacher S, Wiegand C, Eddy FB, Metcalf JS & Codd GA. 2002. Effects on
enteric bacterial and cyanobacterial lipopolysaccharides, and of microcystin-LR, on
glutathione S-transferase activities in zebra fish (Danio rerio). Aquatic Toxicology 60:
223-231.
Boyer GL, Gillam AH & Trick CG. 1987. Iron chelation and uptake. In: The cyanobacteria.
(Van Baaien C & Fay P, eds.). Elsevier Science: New York pp. 415-436.
Briand J-F, Jacquet S, Brenard C & Humbert J-F. 2003. Health hazards for terrestrial
vertebrates from toxic cyanobacteria in surface water ecosystems. (Review article).
Vet. Res. 34: 361-377.
30
Brunberg AK & Blomqvist P. 2002. Benthic overwintering of Microcystis colonies under
different environmental conditions. J. Plankton res. 24: 1247-1252.
Canter HM. 1950. Fungal parasites of the phytoplankton I. Ann. Bot. NS 14: 263-289.
Canter HM. 1951. Fungal parasites of the phytoplankton II. Ann. Bot. NS 15: 129-156.
Canter HM. 1954. Fungal parasites of the phytoplankton Ill. Trans. Brit. Mycol. Soc. 37:
111-133.
Carmichael WW. 1986. Algal toxins. In: Advances in Botanical Research 12. (Callow EA
Ed.) Academic Press: London pp.47-101.
Carmichael WW. 1994. The toxins of cyanobacteria. Sci. Am. 270: 64-70.
Cole GT & Wynne MJ. 1974. Endocystosis of Microcystis aeruginosa by Ochromas danica.
J. Phycol. 10: 397-410.
Cousins IT, Bealing DJ, James HA & Sutton A. 1996. Biodegradation of microcystin-LR by
indigenous mixed bacterial populations. Water Res. 30: 481-485.
Davidson FF. 1959. Poisoning of wild and domestic animals by a toxic water bloom of
Nostoe rivulare Kuetz. J. Am. Water Works ass. 51: 1277-1287.
Dawson RM. 1998. The toxicology of microcystins. Toxicon 36: 953-962.
Dodds JA. 1979. Viruses of marine algae. Experientia 35: 440-442.
Doers MP & Parker DL. 1988. Properties of Microcystis aeruginosa and M. flos-aquae
(Cyanophyta) in culture: taxonomic implications. J. Phycol. 24: 502-508.
31
Ericksson JE, Toivola D, Meriluoto JAO, Karaki H, Han Y & Hartshorne O. 1990a.
Hepatocyte deformation induced by cyanobacterial toxins reflects inhibition of protein
phosphatases. Biochem. Biophys. Res. Commun. 173: 1347-1353.
Ericksson JE, Gronberg L, Nygard S, Slotte JP & Meriluoto JAO. 1990b. Hepatocellular
uptake of 3H-dihydromicrocystin-LR, a cyclic peptide toxin. Biochem. Biophys. Acta
1025: 60-66.
Falconer IR, Jackson ARB, Langley J & Runnegar MT. 1981. Liver pathology in mice
poisoning by the blue-green alga Microcystis aeruginosa. Aust. J. BioI. Sci. 24: 179-187.
Fox GE, Wisotzkey JD & Jurtshuk Jr. P. 1992. How close is close: 16S identity. Int. J.
Syst. Bacteriol. 39: 166-170.
Friedl T & O'Kelly CJ. 2002. Phylogenetic relationships of green algae assigned to the
genus Planophila (Chlorophyta): evidence from 18S rRNA sequence data and
ultrastructure. European Journal of Phycology 37: 373-384.
Ghosh S, Khan SA, Wickstrom M & Beasley V. 1995. Effects of microcystin-LR on actin
and the actin-associated proteins a-actinin and talin in hepaticytes. Nat. toxins 3: 405-
414.
Grobbelaar JU. 2004. Dynamics of toxin production by cyanobacteria. WRC Report:
K5/1029/0/1 (in press).
Harada K-I, Murata H, Qiang Z, Suzuki M & Kondo F. 1996. Mass spectrometric screening
method for microcystins in cyanobacteria. Toxicon 34: 701-710.
Harding WR & Wright S. 1999. Initial findings regarding changes in phyto- and zooplankton
composition and abundance following the temporary drawdown and refilling of a
shallow, hypertrophic South African coastal lake. J. Lake and Reservoir Manage. 15:
47-53.
32
Harding WR & Plaxton B. 2001. Cyanobacteria in South Africa: A review. WRC Report
No: TT 153/01.
Hauman JH. 1981. Is a plasmid(s) involved in the toxicity of Microcystis aeruginosa? In:
The water environment: Algal toxins and health. (Carmichael WW ed.). Plenum
Press, New York. pp. 97-102.
Hawkins PR, Runnegar MTC, Jackson ARB & Falconer IR. 1985. Severe hepatoxicity
caused by the tropical cyanobacterium (blue-green alga) Cylindrospermopsis
reciborskii (Wolonszynzka) Seenaya and Subba Raju isolated from a domestic water
supply reservoir. Appl. Environ. Microbiol. 50: 1292-1295.
Hermansky SJ, Casey PJ & Stohs SJ. 1990. Cuclosporin A - a chemoprotectant against
microcystin-LR toxicity. Toxicol. Lett. 54: 279-285.
Hermansky SJ, Stohs SJ, Eldeen ZM, Roche VF & Mereish KA. 1991. Evaluation of
potential chemoprotectants against microcystin-LR hepatotoxicity in mice. J. Appl.
Toxicol. 11: 65-74.
Hoeger SJ, Dietriech DR & Hitzfeld BC. 2002. Effect of ozonation on the removal of
cyanobacterial toxins during drinking water treatment. Environmental Health
Perspectives 110: 1127-1132.
Hoffman LR & Stanker LH. 1976. Virus-like particles in the green alga Cylindrocapsa. Can.
J. Bot. 54: 2827-2841.
Honkanen RE, Chaplan FR, Patterson GML & Abercombie J. 1996. Development of a
protein phosphatase-based assay for the detection of phosphatase inhibitors in
crude whole cell/animal extracts. Toxicon 34: 307-308.
Jones GJ. 1990. Biodegradation and removal of cyanobacterial toxins in natural waters.
Proc. Sydney Water Board Blue-Green Algae Seminar, pp. 33-36, Sydney,
November 21 and 22.
33
Jones GJ, Falconer IR & Wilkens RM. 1995. Persistence of cyclic peptide toxins in dried
Microcystis aeruginosa crusts from Lake Mokaan, Australia. Environ. Tax. Water
Quality 10: 19-24.
Jones GJ & Orr PT. 1994. Release and degradation of microcystin following algaecide
treatment of a Microcystis aeruginosa bloom in a recreational lake, as determined by
HPLC and protein phosphatase inhibition assay. Water Res. 28: 871-876.
Kaebernick M, Neiland BA, Borner T & Dittmann E. 2000. Light and transcriptional
response of the microcystin biosynthesis gene cluster. Appl. Environ. BioI. 66: 3387-
3392.
Kenefick SL, Hrudey SE, Peterson HG & Prepas EE. 1993. Toxin release from Microcystis
aeruginosa after chemical treatment. Water Sci. Technol. 4: 433-440.
Komárek J. 1991. A review of water-bloom forming Microcystis species, with regard to
populations for Japan. Arch. Hydrobiol. Suppl. 43: 157-226.
Krienitz L, Ballot A, Kotut K, Wiegand C, Putz S, Metcalf JS, Codd GA & Pflugmacher S.
2003. Contribution of hot spring cyanobacteria to the mysterious deaths of Lesser
flamingos at Lake Bogaria, Kenya. FEMS Microbial. Ecol. 43: 141-148.
Laland SG & Zimmer T-L. 1973. The protein thiotemplate mechanism of synthesis for the
peptide antibiotics produced by Bacillus brevis. Essays Biochem. 9: 31-57
Lam AK-Y, Prepas EE, Spink D & Hrudey S. 1995. Chemical control of hepatotoxic
phytoplankton blooms: Implications for human health. Water Res. 29: 1845-1854.
Lambert TW, Holmes CFB & Hrudey SE. 1996. Adsorption of microcystin-LR by activated
carbon and removal in full scale water treatment. Water Res. 30: 1411-1422.
LeClaire RD, Parker GW & Franz DR. 1995. Hemodynamic and calorimetric changes
induced by microcystin-LR in the rat. J. Appl. Toxicol. 15: 303-311.
34
Lee WJ & Bae KS. 2002. Inferring the molecular polygeny of chroococcalian strains (Blue-
green algae/Cyanophyta) from the Geumgang River, based on partial sequences of
16S rRNA gene. J. Microbiol. 40: 335-339.
Lemke PA. 1976. Viruses of eukaryotic microorganisms. Ann. Rev. Microbiol. 30: 105-145.
Lipmann F. 1954. In: The mechanism of enzyme action. (McElroy WO & Glass B, eds.).
John Hopkins Unversity Press. p. 599.
l.ukaë M & Aegerter R. 1993. Influence of trace metals on growth and toxin production of
Microcystis aeruginosa. Toxicon 31: 293-305.
MacKintosh C, Beattie KA, Klumpp S, Chohen P & Codd GA. 1990. Cyanobacterial
microcystin-LR is a potent and specific inhibitor of phophatases 1 and 2A from both
mammals and higher plants. FEBS lett. 264: 187-192.
Matsushima R, Yoshizawa S, Watanabe MF, Harada K-I, Furusawa M, Carmichael WW &
Fujiki H. 1990. In vitro and in vivo effects of protein phophatase inhibitors, microcystins
and nodularin on mouse skin and fibroblasts. Biochem. Biophys. Res. Commun. 171:
867-874.
McDermott CM, Feola R & Plude J. 1995. Detection of cyanobacterial toxins
(microcystins) in water of northeastern Wisconsin by a immunoassay technique.
Toxicon 33: 1433-1442.
Negri AP, Jones GJ & Hindmarsh M. 1995. Sheep mortality associated with Paralytic
Shellfish Poisoning toxins from the cyanobacterium Anabaena circinalis. Toxicon 33:
1321-1329.
Neiland BA, Jocobs 0, Del Dot T, Blackall LL, Hawkins PR, Cox PT & Goodman AE. 1997.
rDNA sequences and evolutionary relationships among toxic and nontoxic
Cyanobacteria of the genus Microcystis. Int. J. Syst. Bacteriol. 47: 693-697.
35
Newman JR & Barret PRF. 1993. Control of Microcystis aeruginosa by decomposing
barley straw. Journal Aqua Plant Management 31: 203-206
Pan H, Song LR, Liu YO & Borner T. 2002. Detection of hepatotoxic Microcystis strains by
PCR with intact cells from both culture and environmental samples. Arch. Microbial.
178: 421-427.
Powell W, Morgante M, Andre C, Hanafey M, Vogel J, Tingey S & Rafalski A. 1996. The
comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm
analysis. Mol. Breed. 2: 225-238.
Rinehart KL, Harada K, Namikoshi M, Chen C, Harvis CA, Munro MHG, Blunt JW,
Mulligan PE, Beasley VR, Dahlem AM & Carmichael WW. 1988. Nodularin,
microcystin, and configuration of Adda. J. Am. Chemo Soc. 110: 8557-8558.
Rippka R. 1988. Recognition and identification of cyanobacteria. Methods Enzymol. 167:
28-67.
I Rippka R & Hardman M. 1992. Pasteur Culture Collection (PCC) of Cyanobacterial strains
in axenic culture, vol. 1. Catalogue of strains. Institut Pasteur, Paris, France.
Robarts RD & Zohary T. 1987. Temperature effects on photosynthetic capacity,
respiration, and growth rates of bloom-forming cyanobacteria. NZ J. Mar. and
Freshwater Res. 21: 391-399.
Rudolph-Bbhner S, Wu J-T & Moroder L. 1993. Identification and characterization of
Microcystin-L Y from Microcystis aeruginosa (Strain 298). BioI. Chemo 374: 635-640.
Romanowska-Duda Z, Mankiewicz J, Tarczynska M, Waiter Z & Zalewski M. 2002. The
effect of toxic cyanobacteria (blue-green algae) on water plants and animal cells. Polish
J. Environ. Studies 11: 561-566.
Runnegar MTC, Gerdes RG & Falconer IR. 1991. The uptake of the cyanobacterial
hepatoxin microcystin by isolated rat hepatocytes. Toxicon 29: 43-51.
36
Runnegar MTC, Kong S & Berndt N. 1993. Protein phosphatase inhibition and in vivo
hepatotoxicity of microcytins. Am. J. Physiol. 265 (2 Part 1), G224-G230.
Saitou T, Sugiura N, Itayama T, Inamori Y & Matsumura M. 2002. Degradation of
microcystin by biofilms in a practical treatment facility. Water Science and Technology
46: 237-244.
Sambrook J, Fritsch EF & Maniatis T. 1989. Molecular cloning: A laboratory manual, 2nd
Edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. pp. 6.2-6.30.
Schwa be W, Weihe A, Borner T, Henning M & Kohl JG. 1988. Plasmids in toxic and non-
toxic strains of the cyanobacterium Microcystis aeruginosa. Curr. Microbiol. 17: 133-
137.
Scott WE & Chutter FM. 1981. Introduction: Infection and predators. Wastewater for
Aquaculture. Proceedings of a Workshop on Biological Production Systems and Waste
Treatment, Bloemfontein, 12-13 March 1980. Grobbelaar JU, Soeder CJ & Toerien OF
(eds.). UOFS Publ., Series C. 3: 103-109.
Shi L, Carmichael WW & Miller I. 1995. Immuno-gold localization of hepatotoxins in
cyanobacterial cells. Arch. Microbiol. 163: 7-15.
Siegl G, MacKintosh C & Stitt M. 1990. Sucrose-phosphatase synthase is
dephosphorylated by protein phosphatase 2A in spinach leaves. FEBS Lett. 270: 198-
202.
Sivonnen K. 1990. Effects of light, temperature, nitrate, orthophosphate, and bacteria on
growth of and hepatotoxin production by Oscillatoria agardhii strains. Appl. Environ.
Microbiol. 56: 2658-2666.
Skulberg OM, Carmichael WW, Codd GA & Skulberg R. 1993. Taxonomy of toxic
Cyanophyceae (cyanobacteria). In: Falconer R (ed.). Algal toxins in seafood and
drinking water. Academic Press Ltd., London. p. 145-164.
37
Southern EM. 1975. Detection of specific sequences among DNA fragments separated by
gel electrophoresis. J. Mol. BioI. 98: 503-517.
Stewart JR & Brown RM. 1969. Cytophaga that kills or lyses algae. Sci. 164: 1523-1524.
Stewart JR & Brown RM. 1971. Algicidal non fruiting myxobacteria with high G + C ratios.
Arch. Microbiol. 80: 170-190.
Stoner RD, Adamsa WH, Slatkin ON & Siegelman HW. 1989. The effects of single L-amino
acid substitutions on the lethal potencies of the microcystins. Toxicon 27: 825-828.
Stotts RR, Namkioshi M, Haschek WM, Rinehart KL, Carmichael WW, Dahlem AM &
Beasley VR. 1993. Structural modifications imparting reduced toxicity in microcystins
from Microcystis spp. Toxicon 31: 783-789.
Suganuma M, Fujiki H, Okabe S, Nishiwaki S, Brautigan 0, Ingebritsen TS & Rosner MR.
1992. Structurally different members of the okadiac acid class selectively inhibit
protein serine/threonine but not tyrosine phosphatase activity. Toxicon 30: 873-878.
Sunda WGo 1991. Trace metal interactions with marine phytoplankton. BioI. Oceanogr. 6:
442-511.
Tsuji K, Watanuki T, Kondo F, Watanabe MF, Suzuki S, Nakazawa H, Suzuki M, Uchida H
& Harada K-1. 1995. Stability of microcystins from cyanobacteria. II. Effect of UV light
on decompisition and isomerization. Toxicon 33: 1619-1631.
Trogen G-B, Annila A, Eriksson J, Kontteli M, Meriluoto J, Sethson I, Zdunek J & Edlung U.
1996. Conformational studies of microcystin-LR using NMR spectroscopy and
molecular dynamics calculations. Biochem. 35: 3197-3205.
Turner PC, Gammie AJ, Hollinrake K & Codd GA. 1990. Pneumonia associated with
contact with cyanobacteria. Brit. Med. J. 300: 1440-1441.
38
Ueno Y, Nagata S, Tsutsumi T, Hasegawa A, Watanabe MF, Park H-D, Chen G-C, Chen G
& Yu S-Z. 1996. Detection of microcystins, a blue-green algal hepatotoxin, in drinking
water sampled in Haimen and Fusui, endemic areas of primary liver cancer in China, by
highly sensitive immunoassay. Carcinogenesis 17: 1317-1321.
Utkilen H & Gjolme N. 1992. Toxin production by Microcystis aeruginosa as a function of
light in continuous cultures and its ecological significance. Appl. Environ. Microbial. 58:
1321-1325.
Vakeria 0, Codd GA, Bell SG, Beattie KA & Priestley IM. 1985. Toxicity and
extrachromosomal DNA in strains of the cyanobacterium Microcystis aeruginosa.
FEMS Microbial. Lett. 29: 69-72.
Van der Westhuizen AJ and Eloff IN 1985. Effects of temperature and light on toxicity and
growth of the blue-green alga Microcystis aeruginosa (UV-006). Planta. 163 55-59.
Vascanceles V, Olivera S & Teles FO. 2001. Impact of a toxic and a non-toxic strain of
Microcystis aeruginosa on the crayfish Procambarus clarkii. Toxicon 39: 1461-1470.
Venter E & Botha A-M. 2000. Development of markers linked to Diuraphis noxia
resistance in wheat using a novel PCR-RFLP approach. Theor. Appl. Genet. 100: 965-
970.
Verhoeven RL & Eloff IN. 1979. Effect of lethal concentrations of copper on the
ultrastructure and growth of Microcystis. Proc. Electron Microsc. Soc. S. Afr. 9: 161-
162.
Villareal TA & Carpenter EJ. 2003. Bouyancy regulation and the potential for vertical
migration in the oceanic cyanobacterium Trichodesmium. Microbial Ecology 45: 1-10.
Vas P, Hogers R, Bleeker M, Rijans M, Van de Lee T, Hornes M, Frijters A, Pot J, Peleman
J, Kuiper M & Zabeau M. 1995. AFLP: a new technique for DNA fingerprinting .
Nucliec Acids Res. 23: 4407-4414.
39
Waaland JR, Waaland SO & Branton 0 1971. Gas vacuoles. Light and shielding in blue-
green algae. J.Cell. BioI. 48 212-215.
Weier TE, Stocking RC, Barbour MG & Rost TL. 1982. Botany. Introduction to Plant
Biology. 6th Edition. John Wiley and Sons, New York. pp. 720.
Wicks RJ & Thiel PG. 1990. Environmental factors affecting the production of peptide
toxins in floating scums of the cyanobacterium Microcystis aeruginosa in a hypertrophic
African reservoir. Environ. Sci. Technol. 24: 1413-1418.
Woese CR. 1987. Bacterial evolution. Microbiol. Rev. 51: 221-271.
World Health Organization Guidelines for drinking water quality, 2 ed. Addendum to Vol. 1.
Recommendations. Geneva, World Health Organization, 1998. pp. 13-14.
Yokoyama A & Park HO. 2003. Depuration kinetics and persistence of the cyanobacterial
toxin microcystin-LR in the freshwater bivalve Unio douglasiae. Environ. Toxicol. 18:
61-67.
Yoshizawa S, Matsushima R, Watanabe M, Harada K-I, Ichihara A, Carmichal WW & Fujiki
H. 1990. Inhibition of protein phosphatases by microcystins and nodularin associated
with hepatoxicity. J. Cancer Res. Clin. Oncol. 116: 609-614.
Yu FY, Liu BH, Chou HN & Chu FS. 2002. Development of a sensitive ELISA for the
determination of microcystins in algae. J. Agri. Food Chemo 50: 4176-4182.
Zabeau M & Vas P. 1993. Selective restriction fragment amplification: a general method for
DNA fingerprinting. European patent application number 92402629.7. Publication
number 0 534 858 A1.
Zianuddin EN, Mundt S, Wegner U & Mentel R. 2002. Cyanobacteria a potential source of
antiviral substances against influenza virus. Med. Microbiol. Immunol. 191: 181-182.
40
Zegura B, Sedmak B & Filipic M. 2003. Microcystin-LR induces oxidative DNA damage in
human hepatoma cell line HepG2. Toxicon 41: 41-48.
41
Chapter III
Assessment of the genetic diversity of Microcystis aeruginosa strains
using Amplified fragment length polymorphisms (AFLPs)
Introduction
Cyanobacteria are the dominant phytoplankton group in eutrophic freshwater bodies.
Several of the common bloom-forming species are known to produce toxins. Microcystis
aeruginosa is the most common toxic cyanobacteruim, and the toxicity of the blooms
seems to be mainly associated with this species (Carmichael 1986). The toxins produced
by Microcystis species has been isolated and designated as microcystins, which are
composed of cyclic heptapeptides (Falconer et al. 1983; Hawkins et al. 1985; Turner et al.
1990).
Due to the toxicity of these species, previous studies focused mainly on toxin production,
although cyanobacterial classification has been problematic for a long time. Because of
morphological simplicity of most prokaryotes, their classification was previously based
largely on physiological properties, as expressed in pure laboratory cultures (Doers and
Parker 1988). While field studies relied mostly on morphological analyses of natural
populations, laboratory studies concentrated on culture characterisations. The principle of
morphological studies includes the use of characteristics observable and measurable under
a light microscope, such as shape of colony, presence of sheaths and envelopes, calor of
colonies, shape, differentiation and cell content, and the envelopes. Based on these
criteria, a taxonomic classification is then devised. At the level of taxonomic distinction
42
between genera, the traditional systems of cyanophytes placed a high value on cell division
patterns, colony formation and relationship to extracellular envelopes and sheaths. Cell
shapes and dimensional differences were used largely to distinguish between species
within each genus (Doers and Parker 1988). This method caused difficulties in their
classification by introducing organisms with different cell organizations but similar cell
arrangements to the same generic identity. The main problems met in applying
morphological criteria in cyanophyte classification arise from the considerable variability in
morphological features with environmental conditions (Komárek 1991).
AFLP markers have been used to scan genome-wide variations of strains, or closely
related species, that have been impossible to resolve with morphological features or other
molecular systematic characters. Therefore, AFLP has broad taxonomic applicability and
have been used effectively in a variety of taxa including bacteria (Huys et al. 1996). AFLP
analysis is based on selective amplification of DNA restriction fragments (Vos et al. 1995).
It is technically similar to restriction fragment length polymorphism analysis, except that
only a subset of the fragments are displayed and the number of fragments generated can
be controlled by primer extensions. The advantage of AFLP over other techniques is that
multiple bands are derived from all over the genome. This prevents over interpretation or
misinterpretation due to point mutations or single-locus recombination, which may affect
other genotypic characteristics. The main disadvantage of AFLP markers is that alleles are
not easily recognized (Majer et al. 1998). PCR has proven to be successful in detecting
genetic variation amongst plant-pathogenic fungi, as well as bacteria (Majer et al. 1996,
Janssen et al. 1996). The utility, repeatability and efficiency of the AFLP technique are
leading to broader application of this technique to the analysis of cyanobacteria populations
(Janssen et al. 1996).
43
In an attempt to overcome problems with the current cyanobacterial taxonomy, which is
based primarily on observed morphological characteristis, we have used amplified fragment
length polymorphism (AFLP), a PCR-based fingerprinting method, which reveals variation
around the whole genome by selectively amplifying a subset of restriction fragments for
comparison.
Material and Methods
Chemicals, Strains and Culture Conditions
Analytical reagent grade chemicals were purchased from various commercial sources and
were used without further purification. Unless otherwise stated, standard methods
described in Sambrook et al. (1989) were used. Microcystis aeruginosa strains used in the
study represented a wide variety of geographically unrelated strains (Table 3.1). Strains
PCC7806 and PCC7813 were obtained from the Pasteur Institute Culture Collection,
France; UV027 from the University of the Free State Culture Collection, South Africa;
CCAP1450/1 was obtained from the Culture Collection of Algae and Protozoa, Institute of
Freshwater Ecology, UK; NIES88, NIES89, NIES91, NIES99 from the National Institute for
Environmental Studies, Japan; and SAG1 from the Pflanzen Physiologisches Institut,
Universitat Gottingen, Germany. All these strains were received as axenic, maintained as
such and microscopically verified prior to further experiments. Unicellar stains UP01, UP03
and UP04 were collected by representatives of the Water Research Commission and
Tswhane Metro Council, respectively. Water samples were placed on ice in a darkened
cooler during transport to the laboratory. Holding time for samples was less than 48 h in all
cases. After the samples were vigorously spun with a vortex mixer to break the blooms, the
44
samples were diluted in sterilized, deionized and distilled water and placed in 100 ml of
liquid BG-11 medium in 200-ml flasks.
Unicellular and axenic strains were maintained at a temperature of approximately 24°C in
liquid BG-11 nutrient medium containing 17.65 mM NaN03, 0.18 mM K2HP04.3H20, 0.30
mM MgS04.7H20, 0.25 mM CaCI2.2H20, 0.03 mM citric acid, 0.03 mM ferric ammonium
citrate, 0.003 mM EDTA (ethylenediamine tetra-acetic acid, disodium magnesium), 0.19
distilled water. Cultures were grown under constant light of approximately 60 urnol
photons.rn+s" (PAR) at pH 8.0. The purity of cyanobacterial cultures was verified weekly
by the absence of bacterial growth on TYG agar and in TYG broth (5.0 g tryptone (Difco );
2.5 g yeast extract (Difco); glucose, 1.0 g per liter) after incubation of two weeks at 26°C.
Table 3.1 Different Microcystis aeruginosa strains used in the study and their origin.
PCC7806 Pasteur Culture Collection, France The Netherlands
PCC7813 Pasteur Culture Collection, France Scotland
UV027 University of the Free State Culture Collection ZA
NIES88 National Institute for Environmental Studies Japan
NIES89 National Institute for Environmental Studies Japan
NIES91 National Institute for Environmental Studies Japan
NIES99 National Institute for Environmental Studies Japan
NIES299 National Institute for Environmental Studies Japan
SAG1 Pflanzen Physiologisches Institut, Universitat Gottingen Germany
CCAP 1450/1 Institute of Freshwater Ecology UK
UP01 University of Pretoria Culture Collection Rietvlei Dam, ZA
UP03 University of Pretoria Culture Collection Rhoodeplaat Dam, ZA
UP04 University of Pretoria Culture Collection Hartbeestpoort Dam, ZA
45
The final proof of purity was verified by microscopic examination. Cultures of Microcystis
aeruginosa were harvested at the end of exponential growth phase (three weeks) by
centrifugation at 6 000 g for 10 min at room temperature. The cultures were then freeze-
dried and stored at -20 "C. The strains isolated from the blooms were identified following
the procedure as described by Komárek (1958).
DNA Extraction
Genomic DNA was extracted according to a modified method of Raeder and Broda (1985).
The extraction buffer consisted of 200 mM Tris-HCI (pH 8.00), 150 mM NaCl, 25 mM
EDTA, 0.5 % (w/v) SDS, 1 % (vlv) 2-mercaptoethanol, 1 % (w/v) Polyvinylpyrrolidone
(PVP). A volume of extraction buffer were added to each 1 gram of freeze-dried culture,
and homogenized in the presence of washed sand. The homogenate was placed at 60 "C
for 10 min. The homogenate was then centrifuged at 12 000 rpm for 15 min. The
supernatant was removed and equal volumes of chloroform:phenol (1:1) was added,
vortexed and centrifuged again at 12 000 rpm for 15 min. The upper layer was carefully
removed. The DNA in the aqueous layer was precipitated with two volumes of ice-cold
absolute ethanol and stored at -20 "C for at least 1 h. Following a centrifugation step (12
000 rpm, 15 min), the resulting pellet was washed with 70 % ethanol (this step was
repeated three times), and dried after removal of the liquid. The DNA was resuspended
in distilled water and stored at -80 "C.
DNA concentrations were determined by visualisation under UV light, on 1 % TAE (40 mM
Tris-acetate, 1 mM EDTA, pH 8.0) agarose gels containing ethidium bromide (Sambrook et
al., 1989), as well as through spectrophotometric measurements at absorbances of 260
and 280 nm, using a Beckman DU650 Spectrophotometer.
46
AFLP analysis
The AFLP procedure was carried out using the IRDye™ Fluorescent AFLP@ Kit (LI-COR
Biosciences, Lincoln, USA) following the manufacturer's instructions. Two combinations of
restriction endonucleases were used. For the combination EcoR1/Mse1, genomic DNA (75
ng) was incubated for 2 h at 37°C with 1.25 U of Mse1, 1.25 U of EcoR1, 1 U of T4 DNA
ligase, 40 pmol of Mse1 adapters and 10 pmol EcoR1 adapters. This reaction was done in
a volume of 50 IJl of restriction-ligase buffer containing 10 mM Tris-HCI (pH 7.4), 50 mM
NaCl, 1 mM dithriothreitol (DTT), 0.1 mM EDTA, 50 % (v/v) glycerol, 0.15 % (v/v) Triton X-
100 and 200 ng/IJl BSA. The reaction was terminated by heating at 70°C for 15 min, and
then placed on ice. For adaptor ligation, 25 IJl of the Adapter mix, containing Mse1
adaptors and EcoR1 adaptors, 0.4 mM ATP, 10 mM Tris-HCI (pH 7.5), 10 mM Mg-acetate,
and 50 mM K-acteate, and 1 U of T4 DNA ligase was added, and the reaction was
incubated at 37°C for 3 h. A 10-1J1aliqtuot of the adapter-ligated DNA was diluted (1:10)
with TE buffer (10 mM Tris-HCI pH 8.0, 1.0 mM EDTA) to serve as a template in the
preselective amplification PCR. The remaining portion was used to verify that the digestion
was complete.
The preselective PCR contained 2.5 IJl of adapter-ligated DNA (diluted 1:10), 2.5 U of Taq
DNA polymerase (Roche Molecular Biochemicais), 2.5 IJl of 10 x PCR reaction buffer
(Roche Molecular Biochemicais), 15 mM MgCI2, 500 mM KCI and 100 IJM of IRDye700™-
labeled EcoR1 or IRDye800™-labeled EcoR1 and Mse1 primers (containing dNTPs) with
every selective nucleotide, in a total volume of 25.5 IJl. The PCR program consisted of
twenty cycles of 30s at 94°C, 1 min at 56 °C, 1 min at 72°C, and soaked at 4°C. The
selective PCR contained 2 IJl of the diluted (1: 10) product of the preselective PCR, 0.5 U of
Taq DNA polymerase (Roche Molecular Biochemicais), 2 IJl of 10 x Taq DNA polymerase
47
buffer (Roche Molecular Biochemicais), KCI and MgCI2 as mentioned above, and 100 IJM
of IRDye700™-labeled EcoR1 or IRDye800™-labeled EcoR1 and Mse1 primers
(containing dNTPs) with every selective nucleotide, in a total volume of 11 IJl. Eight primer
pairs: EcoR1 +ACA/Mse1 +CCA, EcoR1 +ACAlMse1 +CCG, EcoR1 +ACA/Mse1 +CGG,
EcoR1 +ACA/Mse1 +CAC, EcoR1 +ACA/Mse1 +CAG, EcoR1 +ACA/Mse1 +CTC,
EcoR1 +ACA/Mse1 +CTG, and EcoR1 +ACAlMse1 +CCT, (LI-COR Bioseiences, Lincoln,
USA) were used for selective amplification. The first amplification cycle was carried out for
30s at 94°C, 30s at 65°C and 1 min at 72 °C. At each of the following 12 cycles, the
annealing temperature was reduced by 0.7 °C per cycle. The last 23 cycles of annealing
were carried out at 72°C for 1 min; and then soaked at 4°C. Each sample was diluted 1:1
with Blue Stop Solution (Li-COR Bioseiences, Lincoln, USA), denatured for 3 min at 94°C
and placed on ice. AFLPs were fractionated on a 6.5 % KBPLUS polyacrylamide gel in Tris-
acetate-EDTA buffer (pH 7.5) using all-COR 4200 Automated DNA sequencer according
to the manufacturers instructions.
Data analysis
AFLP fragments were manually scored as binary data with presence as "1" and absence as
"0". Cluster analysis was performed on the similarity matrix employing the Unweighted Pair
Group Method Using Arithmetic Means (UPGMA) algorithm (Sneath 1989) using the
software programme PAUP 4.0.
Results
Fast screening of AFLP primer combinations
After screening 20 primer combinations on a subset of strains using either IRDye700™-
labeled EcoR1 or IRDye800™-labeled EcoR1 primers, eight IRDye700™-labeled EcoR1
primer pairs were selected for analysis (Appendix A, Figure A1). The generated
48
fingerprints were evaluated for repeatability and overall clearness of the banding pattern.
The number of informative fragments was also taken into account (Figure 3.1).
Genetic diversity as defined by AFLP fingerprinting
A total of 909 bands were amplified from the eight primer combinations, of which 665 were
informative, 207 non-informative and 37 monomorphic (Appendix A, Tables A1 & A2), with
an average of 83.12 polymorphic bands per primer combination. The genetic relationship
among all the Microcystis aeruginosa strains based on the combination of data obtained
with the eight primer combinations is represented in the dendrogram (Figure 3.2).
bp
A B -200
-145
-100
-50
AA 1 2 3 4 5 6 7 8 9 10 11 12 13 AA 1 2 3 4 5 6 7 8 9 10 11 12 13 AA
Figure 3.1 AFLP banding patterns generated using primer combinations
EcoR1+ACAlMse1+CAC (A) and EcoR1+ACAlMse1+CAG (8). M = marker; 1 = NIES88;
2 = NIES89; 3 = NIES90; 4 = NIES99; 5 = NIES299; 6 = PC7806; 7 = CCAP1450/1; 8 =
SAG1; 9 = UV027; 10 = PC7813; 11 = UP01; 12 = UP03; 13 = UP04.
49
The dendrogram consists of two clusters. The smaller cluster contains NIES90 and
NIES299 in a grouping with NIES88 basal to this group. In the large cluster there are two
groupings. The NIES strains group together, including PCC7806. The UP01, UP03 and
UP04 strains fall into a group, and UV027, CCAP1450/1 and PCC7813 group together, with
SAG1 basal to the group.
,----NIES88
~---NIES89
-NIES99
r-
'------ PC7806
.-------- CCAP1450/1
'------ UV027
'----- PC7813
~----UP01
.-------
'-------- UP04
'--------- UP03
'------ SAG1
r-- NIES90
L____ NIES299
-- 0.05 changes
Figure 3.2 Combined cluster analysis derived from AFLP analysis of 13 Microcystis
aeruginosa strains using eight AFLP primer combinations.
Discussion
AFLP fragments have been used to unravel cryptic genetic variation for a wide range of
taxa, including plants (Mackill et al. 1996; Paul et al. 1997), fungi (Majer et al. 1996, 1998)
50
and bacteria (Huys et al. 1996), which have previously been impossible to resolve with
morphological characters.
In the present study, complex AFLP banding patterns were obtained. Janssen et al. (1996)
have showed that the choice of the restriction enzymes, and the length and composition of
the selective nucleotide will determine the complexity of the final AFLP print. Primer
selectivity is good for primers with one or two selective nucleotides in simple genomes such
as fungi, bacteria and some plants, and still acceptable with primers having three selective
nucleotides, but is lost with the addition of a fourth nucleotide (Vos et al. 1995). We used
the EcoR1 (E) + 3 and Mse1 (E) +3 at the 3'-end of the primers on 13 Microcystis strains,
and a total of 909 bands were amplified, constituting 73.2 % informative bands and 4.1 %
monomorphic bands. The banding patterns of the UP-strains were also more complex than
some of the other strains, which is quite expected, as these strains represent less cultured
strains (e.g. "wild-type"), as it has been in culture for less than a year, unlike UV027, that
has been in culture for decades.
In the dendrogram, the strains from Rietvlei (UP01) and Hartbeespoort Dams (UP04) group
together and are thus genetically closer to each other, than to the strain from the
Rhoodeplaat Dam (UP03). The Japanese strains (NIES88, NIES89, NIES90, NIES99,
NIES299) also group separate from the other strains, with NIES90 and NIES299,
genetically closest to each other. Interestingly, Microcystis aeruginosa strain PC7806 that
originate from The Netherlands, also group within this group. Microcystis aeruginosa
strains CCAP1450/1 (UK), UV027 (South Africa) and PC7813 group together, and are
genetically closer to the UP-strains, than any of the other strains.
UV-OP -UF~~l
Bi...OEi~fO~TE~t'J i
~IO~E~: lIB~R~ 51
Ir II 4--2.-0 I~
In view of the present study, AFLP analysis is useful for the identification of genetic
diversity and analysis of population structure within Microcystis aeruginosa. The use of the
AFLP fingerprinting method resulted in a high degree of discrimination and identification of
Microcystis aeruginosa strains, and was found useful and practical. AFLPs seem to
overcome the major pitfalls present in other PCR based methods, e.g. OAF or RAPD
analysis, and appear to be as reproducible, heritable and intraspecific as RFLPs (Law et al.
1998). Additionally, AFLPs offer the opportunity to compare diversity of hyper-versus
hypomethylated portions of the genome by comparing data from a restriction enzyme
combination that is methylation-sensitive with a methylation-insensitive combination.
Evidence indicates that DNA sequences are transcribed more readily when
hypomethylated (Cedar 1988). Methylation may prove useful in future studies on the
species.
Acknowledgements
The authors would like to express their sincere gratitude to Karin van Ginkei (Department of
Water Affairs and Forestry) and Leanne Coetzee (Tshwane Metro Council) for the
collection of the strains. Also, we thank the University of Pretoria for the provision of
infrastructure, and the National Foundation of Research, and the Water Research
Commission, South Africa for provision of funding.
References
Carmichael WW. 1986. Algal toxins. In: Advances in Botanical Research 12. (Callow EA
Ed.) Academic Press: London pp. 47-101.
Cedar H. 1988. DNA methylation and gene activity. Cell 53, pp. 3-4.
Doers MP & Parker DL. 1988. Properties of Microcystis aeruginosa and M. flos-aquae
(Cyanophyta) in culture: taxonomic implications. J. Phycol. 24: 502-508.
52
Falconer IR, Jackson ARB, Langley J & Runnegar MT. 1981. Liver pathology in mice
poisoning by the blue-green alga Microcystis aeruginosa. Aust. J. BioI. Sci. 24: 179-
187.
Hawkins PR, Runnegar MTC, Jackson ARB & Falconer IR. 1985. Severe hepatoxicity
caused by the tropical cyanobacterium (blue-green alga) Cylindrospermopsis
reciborskii (Wolonszynzka) Seenaya and Subba Raju isolated from a domestic water
supply reservoir. Appl. Environ. Microbiol. 50: 1292-1295.
Huys G, Coopman R, Janssen P & Kersters K. 1996. High resolution genotypc analysis of
the genus Aeromonas by AFLP fingerprinting. Int. J. Syst. Bacteriol. 46: 572-580.
Janssen P, Coopman R, Huys G, Swings J, Bleeker H, Vos P, Zabeau M & Kersters K.
1996. Evaluation of the DNA fingerprinting methods: AFLP as a new tool in bacterial
taxonomy. Microbiol. 142: 1881-1893
Komárek J. 1991. A review of water-bloom forming Microcystis species, with regard to
populations for Japan. Arch. Hydrobiol. Suppl. 43: 157-226.
Law JR, Donini PRMD, Koebner RMD, Reeves JC & Cooke RJ. 1998. DNA profiling and
plant variety registration. Euphytica 102, pp. 335-342.
Mackill DJ, Zhang Z, Redona EO & Colowit PM. 1996. Level of polymorphism and genetic
mapping of AFLP markers in rice. Genome 39: 969-977.
Majer 0, Lewis BG & Mithen R. 1998. Genetic variation among field isolates of
Pyrenopeziza brassicae. Plant Pathol. 47: 22-28.
Majer 0, Mithen R, Lewis BG, Vos P & Oliver RP. 1996. The use of AFLP fingerprinting for
the detection of genetic variation in fungi. Mycol. Res. 100: 1107-1111.
53
Paul S, Wachira FN, Powell W. & Waugh R. 1997. Diversity and genetic differentiation
among populations of Indian and Kenyan tea (Camellia sinensis (L.) O. Kuntze)
revealed by AFLP markers. Theor. Appl. Genet. 94: 255-263.
Reader U & Broda P. 1985. Rapid preparation of DNA from filamentous fungi. Lett. Appl.
Microbiol.1: 17-20.
Sambrook J, Fritsch EF & Maniatis T. 1989. Molecular cloning: A laboratory manual, 2nd
Edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. pp 6.1-6.30.
Sneath PHA. 1989. Analysis and interpretation of sequences data for bacterial systematics
- the view of a numerical taxonomist. System. Appl. Microbiol. 12: 15-31.
Turner PC, Gammie AJ, Hollinrake K & Codd GA. 1990. Pneumonia associated with
contact with cyanobacteria. Brit. Med. J. 300: 1440-1441.
Vos P, Hogers R, Bleeker M, Reijans M, Van de Lee T, Hornes M, Frijters A, Pot J,
Peleman J, Kuiper M, Zabaeu M. 1995. AFLP: a new technique for DNA
fingerprinting. Nucl. Acids Res. 23: 4405-4414.
54
APPENDIXA
1. Amplified fragment length polymorph isms
I II bp
-500
- -460
• ....
-400
- -364... -350
--
- ;;:
-
..
l
'*'
- .... --_- ... -145.,....
-~_-_- -- - - -100-
-50
1234 1234 12341234 !1..l..i_ 1234 12341234 1234 1234 1234 1234 1234 1234 1234 1234
ABC DE F G HAB eDE F G H
Figure A1. Primer screening with either IROye700™-labeled EcoR1 (I) or IROye800™-
labeled EcoR1 (II) primers. (1) NIES90, (2) NIES99, (3) PCC7806, and (4) UP01;
Primers Eco-ACA/Mse-CAC (A), Eco-ACA/Mse-CAG (8), Eco-ACA/Mse-CTC
(C), Eco-ACA/Mse-CTG (0), Eco-ACA/Mse-CCT (E), Eco-ACA/Mse-CCA (F),
Eco-ACA/Mse-CCG(G), and Eco-ACA/Mse-CGG (H).
55
Table A1. Datamatrix composed after analysis of AFLP fingerprints of 13 Microcystis
aeruginosa strains.
#NEXUS
Begin data;
Dimensions ntax=13 nchar=909;
Format datatype=dna;
matrix
dnaN
NIES88
0000000000000000000000000000000000000000011000000001000000000100000010001100000001000101
0001001000000001000001011000001101000000010000000000000000000000010100000000010000011000
1010000001000000111000000111111101011001100110000101001000000000000000010000100001010000
0100001000001000000100010110000100110011011011000000000000000000010010000010000110100010
1000001010000001001100100101000101000000001100101000001000000100010000100011100000001100
0100100000000110101101010001000011000110011111001111001000000000000000000000000001010000
0000000100000000000010000110000000011100000011111100001100100000000000000000000100011001
0000000000000000000100000000100010100010000000000000000000000000000010000001000000001100
0000000000100000000000000000000000000010110010000000000000000000000000000000000000000011
0010000000000000001000000000000000000110000000010000000000010000000100001010000100000000
00000000001000111100001000000
NIES89
0000000000000000000000000000100100000000000000000000000000000000000010001000000100000010
0000001000000110000000010110001001000000010000000000000000000000000000000000000001001000
0000000000000000000000000000000000000000000000000101000000010000010000000000010000010000
0100000000000110000000000010000000000001100000000000000000000000100000000000000000000000
0000000110000000000000000010111000101100000100101000001100001100000000000010000000000000
1110000001000100000000001001000100000001000100000000000000000000000000000000000001011000
0001010100111100000000000110010000011100000011111100001000100000000000000000000000000010
0011001010001010100000000010000010001000111000100001000000010100110010110001010010011000
0000000000000100000000100001010000000111000001000000010000000000100000100000010000010000
1000010000000000000000000000010000001010000000000000000000000000000000000000000000000010
00010000000000101100100000000
NIES90
0000000000000000000100010000000000000000010000000101000010000000000010001100000000000111
0001001000011011011001011000001101000001010000000000000100000000010100000000000000010000
1010000001000000101000000110011001111001100111000101001011000000000000000000000000010000
0100001000000000000000010111000100110011011011000000000000000000010000000010000110100010
1000000000000001001100000101000100000100001100101000001000000100010000100010000000000000
0100101000000000000101010001010011000010011111000110001100100000000001000000000100000000
0001000000000000000000000100010010000000000000000000000000000000000001100000000000000100
0000001000000000000000000000010000000010001000000000000000000100000000000001010000000100
0000011000000100000100100010000000000110000000000101100100001000100001000000111010000000
0000000000000000000000000000100000000010000000001000000000000000000000000000000000010000
11000000000000010100000000110
NIES99
0000000000000000000000000000000000000000000000000000000000000000000010000000000000000010
56
0000001000000010000000010000000000000000010000000000000000000000000000000010000000000000
0000000000000000000000000010100000000000010000000101000000000000000000000000010000010000
0100000000000000000100000000000000000011010001000000000000000000000000000000000010000000
0000000010000001000000000000000000000000000100101000001100000000000000000010000000000000
0100000000000000100100000000001010000000000000000000000000000000000000000000000000000000
0001000000000000000000000110000000000000000000000000000000100001000000000000000000000000
0000000000100100101000000000000000000000010000000000000000000000000000001001010000000000
0000000000000100000000000000010000000000000000000000000000010000000001000000110001000000
0000000010000000000000000000100000000010001000010000000000000000000100001000000000000000
00000000000000011100001000110
NIES299
0010000000000000000100000000000000000000000000000001000000000000000010001100010000000111
0001001000011001001001011000001101000000010000000000000100000000010100000000000000010000
1010000111000000101000000011001000011001100111000101000000000000000000000000000000010000
0100001000000000000100010110000100110011011011000000000000000000010000000010000110100010
1000000000000111001101000101000101100100001100101000001100000000000000100010000000001000
0100000000000000100101000000000011000010011111000110001000100000000000001000000000000000
0000001000000000000001001100000000010000000000000000100000000111000000001000000100000000
0000000000000000000110000000000000000001010000000000000000000000000000100001010000000000
0000011000000000000100000000010000000000000000000101000100000000000001010000111010001110
1000000000000011100001000010001001010010010100010001000001000000000000001000000010100000
00100000000000010100000011000
PC7806
0000000000000000000000000000000000000000000000000000000000000000000010000000000000000100
0010000100001000001100000000000000000000000000000010000000000000000000000000000000000000
0000000000000000000000000000000000000000000000000000000010100000000000000000000000000000
0010100010000000000000000000000000000000000001001000010100000000000000000000000000000100
0000000000000010000000000000000010000000000000000000100000011000000000000000000000000000
0100000100000000000000000000000010000000000000000000000001000000000000000000000000000001
0100000001010101000100000110010100001000011100000011111000000000100000000000000000000000
0000000011000000001010000100000010000010011000100100111000100001000000000010000001001010
0000000000000000000000000000000000010010000000000000000000000001010010000001110000010010
0000000000000010000000100000000000000001000100000000100000000000110000010001000000000000
00000000000000011100000000010
CCAP1450/1
0010001010000000000000110000101000010011000011000001010010101101000011111100001110000011
0001111100100000101001110000001001000011010010010000000000000010001010001010000000011000
1000100010000111001010011100000000100111111100001110100000000000001010000000100101101010
1010101000000000000000000000000000011010000000001110000000000000000000000100000000000000
0001100000100000000000000000000010000000000001000001010000011111100100000100000000110101
0110100000100001001000001010001100000001100100000100010000000000000001010001000000000000
0000000000000010000010001001101000010000000000000011001000100001110000000001100000000000
1000000100000000000010000000000001000010100010101001000000000010000000000010000000000000
0000000000000001000000000000100000000000000000000000000000000000000011100000101100000000
0000000000000000000010000000000000000100000000000000000000000000000000010000000000000000
00000000000000001110000001010
SAG 1
0000000000000000100000000000000000000000000000000000000000010100000100000000000101000110
0100011001000101000010110001001000001010000010010000000000000000000000011000000010000001
0000000001111100100000100011010001111001111000111001111000000000000000000010000010101000
57
0100000000000000000000000100100001101100000000000000000000000000000000000000000000000000
0000000000000000000000001000000000000000000100000001100000000010010000010000000000010000
0000001000000110100000010000011101001110100000101001010111001100010001000000110100000000
0001000000000100001000110000100000000010000000000100100010000000010000000110000000000000
0000010000000000001000000110100000100001100011110100000000001000000000001000000000000000
0000000000000000000000000010010000000000000000000000000000000000011100000111101001101000
0000000001000000010000100000000000100100100000010000000001100000000000000000101000000010
00000000000001100010111000000
UV027
0010001010000000000001000000000000001100010000000001000000001001000010000001000100000110
0100011001000111010011100001010011010111100100000111000000010100100010001100000100100101
1011000010000111001010001000001100000110110111001111111110000000000010000100100101101010
1010101000000000001000000001100000011000000011001000000000000000000010000100000000000000
0011100000100000000100000000011001001000110001001011110000000000100101000100110011111100
0010100000100001011000001100000100000001000010001110001000100000100000000000000000000000
0000010000000000010011011000000000000000001000000001000000000000000000000001100000000000
0000010000000100001110000000000001000010100010101101000000000010100000000010000000000000
0000000000000001000000000000100000000000000000000000000000000000000011100000111100000001
0100000000000000000000000000000000000100000000000000000000000000000000000000000000000000
0000000000000000110000000100
PC7813
0000000000010010000000000101100000000000000001100010000010010000000100000101110000000111
0001111000000111100001100001011110010111011010010001000000010100000000000101110100101101
1011100011000111001010111110100110001111110100001111110001000000000000000000000000101010
1001100000000000000000000001000000011000000010000101000000000000000001000000000000000000
0100000100000011000010000010000001000000000001000000010000000000000000000000000000011100
1110001110000110101000001100010011000001101000001010000001110001000000010000000000000000
0000010000000000000011001000000000000000000000000001000100000000000000000001100000000000
0000110000000100000010000000000000000011100000101101000000000000000000000010000000000000
0000000000000001000000000000100100000000000000000000000000000000000011100000101100001101
0001000000000000000010000000000000000100000000000010100000000000000000000000000101000000
01000000000000100100011010100
UP01
0011111100000100000010000000100001010001000111011111110100101001000101011101110001010100
1110011100111011111011010110101111001110000011001000110000001011000000000110111000010100
1101110011100010100001011111010111010111111110000111101010000101101010011111000010011010
1000011000110000001100110010010011011111111111010100000000000010010000000000001100001111
0100000011111001100000001011100010101111000111111111101000000100000001100100000000000011
0010001001101000000011100111100001010001100011111101010100010110010000000111111000001101
1111111110000010010000100110101111100111100100000111101011101111111001001101010101111011
1011101001110011000111110000101101101101110010100000001000001000000000000000000000001001
0000000100000100000100000000110011111110000000101000000000100011010010011001010010000000
0001000100100000001000000001010010010010010001111010110110101001110111110101010100010010
10010000011111000101001010100
UP03
0010001001111100100010011101101110101010110101001001101110111001111111011101110000110101
0101001011111111111000011011101111111100000001101100011111010100000001111110111111111011
1100111011100010110111111001111010111111011011111101100000001011100110010010001010011010
0010111111111111101010001110001111010111111001111000000000001101001101000100111110010001
0110001101100111000111101101111110011100111011100110001000000010001000000010000000000010
58
0010001000000000000000000101010000000010010100100101001000010110000000001000000000100000
0000011000000010001000100111001000000101001111000011010100000110000101110111100000110011
1000100000001010010101101111011100111111110010100100011110000000011100111110100001100010
0001100010111110111010101100010101111110111110000110010110000111101011011111011010000000
1001000000010000010000001001011001000010100001000101010000001000000001101000101001011111
00010101100111010101001110100
UP04
0110000000001110010000010100101001111101010010010101111110011001000111011110011101101110
1010001111111011111110011110011111011000000111001000010000110111111010000000101111001101
0001110011111010110001111011100110001101011000010111100110000101100110111011000111011010
0011011010110000011001010111000011010101100111111110000000001110000001111001001101101111
1001000000000011011111010001000111000000001010100011101111110001111101011000001110000011
0010011000101100101101100111010001001110100111111101010100010010001100110001111000101010
1001100100000010010001100101111101000111011111000010101011001110011001000101011011110011
1011100111100011010111100100101100101101111110101110001000110010000001000000000100010001
0110000001011111000001010100111011111110110000110000111010101111101101111001010010000001
0100011101001100001110110100000100010011000001101000101100101000001110111011010100010011
10001011100111010101101010000
,
end;
Table A2. Genetic distances obtained after analysis using UPGMA.
Distance measure = mean character difference
NIES88
NIES89 0.23102310
NIES90 0.149614960.23322332
NIES99 0.182618260.145214530.16501650
NIES299 0.157315730.249724970.11771177 0.16391639
PC7806 0.257425760.200220020.23762377 0.14301430 0.23872387
CCAP1450/1 0298129830.278327820.282728280.22992299 0.29262927 0.24312431
SAG1 0.279427950.272827300.272827300.20682068 0.28712872 0.24422443 0.28052804
UV027 0.298129830.293729360.28712872 0.24312431 0.290429060.256325630.184818480.28492850
PC7813 0.282728280.291529150.27612761 0.23212321 0.27502751 0.262926280.213421340.25852585
0.18921892
UP01 0.42904291 0.442244230.424642470.422442260.42794278 0.44004402 0.41694170 0.43784377
0.45654565 0.44334432
UP03 0.469746980.469746980.445544540.46534654 0.44444445 0.48514852 0.48404840 0.47414741
0.477447750.459845990.43674368
UP04 0.487348740.504950520.480748090.49394938 0.49284929 0.48734874 0.475247530.48074809
0.49504951 0.492849290.34873489 0.4466446
59
Chapter IV
PCR-RFLP identification system for Microcystis aeruginosa utilising the
mcyB gene sequence.
Introduction
The cyanobacterial division is worldwide immensely diverse with respect to form and
habitat. Previously known as algae, over 2 000 species of cyanobacteria are classified
using a few morphological characters like cell structure, photosynthetic pigment content
and isozyme variation (Kata et al. 1992). Members of the coccoid genus Microcystis are
toxigenic and are commonly presented in the mixed populations of cyanobacterial blooms.
The cyclic heptapeptide hepatotoxin, microcystin, exhibits variable expression between
strains of Microcystis, with over 60 isoforms possessing similar protein phosphatase
inhibition activity. Economic losses related to freshwater cyanobacterial biotoxins are the
result of contact with or consumption of water containing toxic cells, and these include the
costs incurred from death of domestic animals, allergic and gastrointestinal problems in
humans, and water treatment plants (Repavich et al. 1990).
Previously their taxonomy was based on the morphological characteristics of laboratory
cultures, which is often considerably altered from the original morphology of environmental
isolates. In an attempt to overcome analyses based on observed phenotypes, studies were
undertaken making use of evolutionarily conserved genes in isolated cultures and field
samples of the toxigenic and bloom-forming genus Microcystis (Komárek 1991). Several
methods for the assessment of microcystins are available (Chorus and Bartram 1999),
including HPLC, ELISA, or direct DNA testing to detect genetic sequences unique for the
multigene cluster required for toxin synthesis (Tillett et al. 2000 & 2001, Nishizawa et al.
2000, Bittencourt-Oliveira 2003).
The mcy gene cluster assembly consists of 10 bidirectionally arranged genes, that reside in
two operons (mcyA-C and mcyD-J) of Microcystis aeruginosa. The activities of these
chromosomal gene products are primarily peptide synthetases (mcyA-C, E, G), polyketide
synthases (mcyO, parts of E and G), and methylation (mcyJ), epimerization (mcyF),
60
dehydration (meyl), and localization (meyH), resulting in nonribosomal toxin synthesis.
Disruption of some of these genes (meyA, B, 0, or E) resulted in no detectable toxin
production (Nishiwaza et al. 2000). A N-metyltransferase (NMT) domain is usually
associated with the meyA and apparently with toxicity in strains. It was found that NMT-
postive strains contained an open reading frame (OFR) of unknown function (uma 1) at a
conserved distance from meyG. The results further suggested consistant linkage between
meyG and uma 1 in toxic and non-toxin strains. However, it was also found that uma 1 was
not cotranscribed with the meyABG cluster in non-toxic strains, suggesting that meyG was
also not transferred in non-toxic strains (Tillett et al. 2001).
The objective of this study was to determine the potential of using the meyB gene
sequence as means to differentiate taxonamicly between a wide variety of geographically
unrelated Mieroeystis strains.
Material and Methods
Chemicals
Reagent grade chemicals were purchased from various commercial sources and were
used without further purification. Unless otherwise stated, standard methods described in
Sambrook et al. (1989) were used.
Cyanobacterial strains, isolates, cultivation and lyophilization
Environmental samples
Waterblaam samples were collected from Rietvlei Dam, Gauteng, between September and
December 2002, from Roodeplaat Dam, Gauteng, in September 2002; and from the
Hartbeespoort Dam, North-West Province in January 2002 (Table 4.1). Within 24 h of
collection, a 1 ml aliquot of each sample was examined microscopically at a magnification
of 400x under phase contrast. The number of cells of each species was estimated, and a
ratio of the component species was derived. Microscopically, the Mieroeystis aeruginosa
61
(UP01, UP03, UP04) or M. wesenbergii (UP02) cells were the most abundant in the blooms
(Komárek et al. 1991; Steyn et al. 1975).
Axenic strains
Axenic Microcystis aeruginosa strains were obtained from the Culture Collections of the
Institute Pasteur (PCC; Paris, France), the University of the Free State (UV, South Africa),
the Algae and Protozoa, Institute of Freshwater Ecology (CCAP, United Kingdom), and the
Pflanzen Physiologisches Institut (SAG; Universitat Gottingen, Germany) (Table 4.1).
Table 4.1 Table of Microcystis aeruginosa strains used in the study describing the origin
of strains, as well as the reported toxicity.
SAG1 Pflanzen Physiologisches Institut, Universltat Gottingen, Germany Toxin-producing
PCC7813 Pasteur Culture Collection, France Toxin-producing
UV027 University of the Free State Culture Collection, South Africa Toxin-producing
CCAP1450/1 Institute of Freshwater Ecology, UK Toxin-producing
UP01 University of Pretoria Culture Collection, Rietvlei Dam, ZA Toxin-producing
UP02 University of Pretoria Culture Collection, Rietvlei Dam, ZA Unknown
Microcystis wesenbergii
UP03 University of Pretoria Culture Collection, Rhoodeplaat Dam, ZA Toxin-producing
UP04 University of Pretoria Culture Collection, Hartbeestpoort Dam, ZA Toxin-producing
Media and Culture
In the experiment liquid BG-11 culture medium was used and culture vessels were 200 ml
Erlenmeyer flasks that contained 100 ml of medium. Cultivation took place in an incubation
room with a temperatuur of 24°C under continuous illumination of approximately 60 urnol
photons.rni.s' at pH 8.0. The liquid BG-11 nutrient medium contained 17.65 mM NaN03,
0.03 mM ferric ammonium citrate, 0.003 mM EDTA (ethylenediamine tetra-acetic acid,
62
mM ZnS04.7H20, 1.61 mM Na2Mo04.2H20, 0.37 mM CuS04.5H20 and 0.17 mM
Co(N03)2.6H20 made up to 1 L distilled water. All cultures were routinely screened for
contamination by streaking samples on nutrient or yeast extract agar. Clonal cultures were
established by picking apparently bacteria-free single colonies after growth from
homogenized single cell suspensions. The strains isolated from the blooms were identified
by the procedure of Komárek (1958).
DNA Extraction
The Microcystis cells in natural bloom samples were concentrated by centrifugation,
washed, and subjected to a freeze-thaw treatment for PCR template preparation (Baker et
al. 2002). All PCRs on natural strains described in this study were carried out after this
treatment, by using approximately 1 000 cells per reaction. This method is simple and quick
and has been proven effective with fresh bloom material, when most cells are intact.
Genomic DNA was extracted according to a modified method of Raeder and Broda (1985).
The extraction buffer consisted of 200 mM Tris-HCI (pH 8.00), 150 mM NaCI, 25 mM
EDTA, 0.5 % (w/v) SOS, 1 % (v/v) 2-mercaptoethanol, 1 % (w/v) Polyvinylpyrrolidone
(PVP). Extraction buffer (700 1-11) was added to each 1 gram of freeze-dried culture, and
homogenized in the presence of washed sand. Homogenisation was either done in a Bio
101 FastPrep machine at setting 2 for one minute or by hand in an eppendorf tube until the
material was fully macerated. The homogenate was placed at 60°C for 10 min. The
homogenate was then centrifuged at 12 000 rpm for 15 min. The supernatant was
removed and equal volumes of chloroform-phenol (1:1) were added, vortexed and
centrifuged again at 12 000 rpm for 15 min. Phenol-chloroform purification were performed
until no interface was visible. The upper layer was carefully removed. The DNA in the
aqueous layer was precipitated with two volumes of ice-cold absolute ethanol and stored at
63
-20°C for at least 1 h. Following a centrifugation step (12 000 rpm, 15 min), the resulting
pellet was washed with 70 % ethanol (this step was repeated three times) to removed salts,
and air dried after removal of the liquid. The DNA was resuspended in sterile, double-
distilled water and stored at -80°C.
DNA was separated in 1 % (w/v) agarose gels dissolved in 1x TAE buffer (50x TAE buffer:
2 M Tris-acetate and 0.05 M EDTA, pH 8) at 5 V/cm for 60 min (Sambrook et al. 1989).
DNA fragments were visualised by the addition of ethidium bromide at 0.5 uq/rnl to the
melted gel. The DNA, with the chelated ethidium bromide, was viewed under UV light and
photographed (Sambrook et al. 1989). As standard protocol, DNA samples were loaded
with 6x loading buffer (15 % (w/v) ficoll and 0.25 % (w/v) bromophenol blue indicator dye).
Bromophenol blue migrates though agarose gels at approximately the same rate as linear
doublestranded DNA of 300 base pair in length (Sambrook et al. 1989).
Polymerase Chain Reaction (PCR)
The PCR reaction was optimized using the Taguchi method as described by Cobb and
Clarkson (1994). The reactions were performed in a total volume of 12.5 ~LIcontaining 1.5
~I of DNA template (approximately 250 ng), 10 mM Tris-HCI (pH 9), 50 mM KCI, 0.1 % (v/v)
Triton®X-100, 0.2 mM of each dATP, dTTP, dGTP and dCTP, 2 mM MgCI2, 2.5 U Taq
DNA Polymerase, all from Promega, and 0.8 pmol of any of two of the appropriate primers
(Roche Molecular Biochemicais) (Table 4.2).
The PCR-reactions were performed on a GeneAmp PCR System 2400 (PE Biosystems)
thermal cycler. The cycle consisted of an initial denaturation step of 5 minutes at 94°C.
Four subsequent 'touchdown' cycles of 5 cycles each, consisted of denaturation at 94°C
for 30 seconds, primer annealing at 45 °C, 42.5 °C, 40°C and 38.5 °C for 30 seconds, and
64
strand elongation at 72°C for 45 seconds. An additional 35 similar cycles were performed
with an annealing temperature of 45°C. To complete all strands, the reactions were
incubated at 72 °C for 7 minutes.
The products were analysed by agarase gel electrophoresis through horizontal slab gels of
1 % agarose (Techcamp Ltd.) dissolved in 1x TAE buffer (Tris-acetate-EDTA buffer (pH
7.5) containing 0.15 IJg/ml ethidium bromide (Sigma). The generated fragments were
separated at 85 mV for 1 h, visualized under UV-light and photographed.
PCR Cleanup
Fragments generated by the various PCR-reactions were isolated with the High Pure PCR
Product Purification Kit (Roche) for further experiments. The total volume of the PCR
reaction was adjusted to 100 ~I with 1x TE buffer (pH 8.0). Binding Buffer (3 M
guaninidine-thiocyanite, 10 mM Tris-HCI, 5 % EtOH (vlv), pH 6.6) up to a volume of 600 ul
was added, thoroughly mixed, applied to a High Pure Filter Tube (Roche) and then
centrifuged at 10 000 rpm for 1 minute. The flow-through was discarded, 500 ~d Wash
Buffer (20 mM NaCI, 2 mM Tris-HCI, pH 7.5, 80 % EtOH (v/v)) added and centrifuged as
above. The washing step was repeated with 200 ~I Wash Buffer and the flow-through
discarded. The tube was centrifuged for an additional 1 minute at 10 000 rpm to remove
residual ethanol. The High Pure Filter Tube was transferred to a clean centrifuge tube, 50
~I Elution Buffer (1 mM Tris-HCI, pH 8.5) added, and centrifuged as above.
65
Table 4.2 Primers used in the study describing sequence, orientation and melting
temperatures.
Tax 1P CGATTGTTACTGATACTCGCC Forward 57.9°C
Tax 3P GGAGAATCTTTCATGGCAGAC Forward 62.4°C
Tax 7P CCTCAGACAATCAACGGTTAG Forward 53.7°C
Tax 10P GCCTAATATAGAGCCATTGCC Forward 59.8°C
Tax 1M TAAGCGGGCAGTTCCTGC Reverse 58.2°C
Tax 2M CCAATCCCTATCTAACACAGTACCTCGG Reverse 65.1°C
Tax 3M CGTGGATAATAGTACGGGTTTC Reverse 58.4°C
Tax 4M CCAGTGGGTTAATTGAGTCAG Reverse 57.9°C
Fragments generated with primer pairs Tox 3P/2M, Tox 1P/1M, Tox 7P/3M and Tox
10P/4M from PCC7813 and UV027 were subsequently cloned into the pGem®T -Easy
vector (Promega), transformed into E. coli cells (JM 109; > 108 cfu/ul) and blue/white
screening was carried out in order to determine transformation efficiency. The cells were
resuspended in 100 ul LB-media (Luria Bertrani; 10 gil tryptone, 5 gil yeast extract, 5 gil
NaCI, 15 gil Difco agar, pH 7.0, Sambrook et al. 1989), plated out on LB/IPTG (0.5 mM
isopropylthio-j3-D-galactoside )/X-gal (80 ~lg/!-LI5-bromo-4-chloro-3-indolyl-j3-D-galactoside)
plates and incubated overnight at 37°C.
Single white colonies were used to inoculate 5 ml LB-media containing 2.5 mg ampicillin
and incubated at 37°C overnight with shaking. The cells were centrifuged at 10 000 rpm
for 2 minutes and the supernatant discarded. The pellet was resuspended in 300 !-LISTET
buffer (0.1 M NaCI, 10 mM Tris-HCI, 1 mM EDTA, 5 % (v/v) Triton X-1 00). Lysozyme (0.15
mg) was added and the cells incubated at room temperature for 5 minutes. To facilitate
lyses the cells were then incubated at 95°C for 1 minute and centrifuged at 14 000 rpm for
15 minutes at 4°C. The pellet was removed, 5 % (w/v) CTAB (N-cetyl-N-N-N-
66
trimethylammonium bromide) was added to the supernatant and centrifuged at 14 000 rpm
for 5 minutes.
The supernatant was discarded, the pellet resuspended in 300 ~d 1.2 M NaCI and 750 fll
cold absolute ethanol added. This mixture was then centrifuged at 14 000 rpm for 10
minutes at 4°C. The supernatant was discarded, 1 ml cold 70 % ethanol added and
centrifuged at 14 000 rpm for 2 minutes at 4°C. The supernatant was removed, the pellet
vacuum-dried in a SpeedVac Concentrator SVC 100H (Savant) and resuspended in 30 -
50 ul ddH20.
The inserts were verified by restriction analysis with approximately 1 fl9 plasmid DNA, 5 U
EcoRI, 50 mM Tris-HCI, 10 mM MgAc2, 10 mM MgCI2, 66 mM KAc, 100 mM NaCI and 0.5
mM DOT at pH 7.5 all from Roche. The entire reaction was loaded onto a 1 % TAE
agarose gel (Techcomp Ltd.) containing 0.15 mg ethidium bromide (Sigma), separated at
85 mV and visualized under UV-light.
Sequencing
Sequencing of the fragments were performed using the ABI Prism® Big Dye® Terminator
Cycle Sequencing Ready Reaction Kit (PE Biosystems). Sequencing reactions were
performed according to the manufacturers' instructions and contained 200 - 500 ng
plasmid template and 3.2 - 5 pmol of the appropriate primer. Reactions were cycled on a
GeneAmp PCR System 2400 (PE Biosystems) thermal cycler and the products precipitated
with NaOAc and EtOH according to the manufacturers' instructions. Samples were dried in
57
a SpeedVac Concentrator SVC 100H (Savant) and resuspended in formamide and 25 mM
EDTA buffer.
Approximately 30 - 50 % of each reaction were loaded onto a 4 % acrylamide gel,
separated at 1.6 kV for 7 h at 51°C and data collected on an ABI Prism 377 DNA
Sequencer (PE Biosystems). The data were analysed using Sequencing Analysis V 3.3.
Sequences were reverse-complemented and compared by using Sequence Navigator V
1.0.1 and assembled using AutoAssembler V 1.4.0 and DNAssist V 1.02. Analyzed
sequences were used to search the Genbank Database (http://www.ncbi.nlm.nih.gov/).
Composition of the genetic map
The obtained sequences (Appendix B, Figure B1) were utilized and imported into the
Webcutter 2.0 software programme (http://www.firstmarket/com/cgi-bin/cutter) to obtained
potential nucleotide restriction sites that can be used to differentiate between the strains
(Table 4.3; Appendix B, Figure B2).
PCR of mcyB fragments for restriction analyses.
Amplification reactions were carried out on a Perkin Elmer GeneAmp® PCR system 9700
(PE Applied Biosystems) using touchdown PCR reactions in 50 ul, The reactions consist of
50 ng/J-l1DNA template, 50 mM MgCI2, 2 mM dNTPs, 10 pmol forward primer (Tox 1P, Tox
3P, Tox 7P or Tox 10P, respectively), 10 pmol reverse primer (Tox 1M, Tox 2M, Tox 3M or
Tox 4M, respectively), 1 U Promega DNA Taq polymerase enzyme and 10x PCR buffer (10
mM Tris-HCI pH 9.0, 50 mM KCI, 0.1 % (v/v) Triton®X-100 - magnesium free). The PCR
cycles were as follows: five cycles of 30s at 94°C, 30s at 65°C and 45s at 72°C; five cycles
of 30s at 94°C, 30s at 65°C and 45s at 72°C; five cycles of 30s at 94°C, 30s at 62.5 °C and
68
45s at 72°C; five cycles of 30s at 94°C, 30s at 60°C and 45s at 72°C; twenty cycles of 30s
at 94°C, 30s at 58°C and 45s at 72°C, and a final elongation step of 7 min at 72 °C.
Isolation of genomic DNA
Sequencing of mcyB+gene with Tax primer sets
Analysis of mcyB gene sequence using Webcu!ter 2.0 software to find suitable restriction sites
DNA template containing mc+yB gene sequence
peR cycle 1
peR cycle 2
peR cycle 3
.-
25-35 peR cycles produce sufficient template for peR-RFLP analysis
Restriction of peR product with restriction enzymes
.-
Analysis of restricted product using gel electrophoresis
Figure 4.1 Representation to demonstrate the process involved in the regeneration of
PCR-RFLP polymorphic fragments using the mcyB gene sequence.
Restriction of peR fragments.
The obtained cloned fragments were restricted with approximately 1 ~lg plasmid DNA,
restriction enzyme (5 U EcoRI, Buffer H; 5 U A/ui, Buffer A; 5 U Rsal, Buffer L; 5 U Sau3AI,
69
Buffer A), 10x Buffer (as recommended by the supplier, Buffer H, Buffer L or Buffer A) at
37°C for 1-3 h until completion of the reaction. The entire reaction was loaded onto a 2 %
TAE agarose gel (Techcomp Ltd.) containing 0.15 mg ethidium bromide (Sigma), separated
at 85 mV and visualized under UV-light (Herolab UVT-28 M), or separated on 7.5 % non-
denaturing polyarcylamide gels (3.75 % (v/v) FMC® Long Ranger Gel solution, 1x TBE
buffer (45 mM Tris-borate, 1 mM EDTA, pH 8.0), 1 % (w/v) APS, 0.004 % (v/v) TEMED) in
1x TBE buffer at 26.6 V/cm for 1-1.5h. After separation the resulting products were
detected by staining with (1:10 000) Sybr®Greenl Nucleic Acid Gel Stain (Roche). The
resulting products were visualized by using UV illumination. Marker III (lambda DNA
restricted with EcoRI and Hindiii) was included as the molecular size marker in all
electrophoresis profiles.
Results
Using the primer pairs Tox 3P/2M, Tox 1P/1M, Tox 7P/3M and Tox 10P/4M, the mcyB
gene from PCC7813 and UV027 were sequenced, resulting in fragments of 2174 and 2170
base pairs in size, respectively (Appendix B, Figure B1). The obtained sequences were
analyzed using nucleotide BLASTN annotation of the Basic Local Alignment Search Tool
(BLAST; Altschul et al. 1990) at http://www.ncbi.nlm.nih.gov/BLAST. The sequence
alignment indicated high homology to other published sequences in GenBank (AY034601
for PCC7813 and AY034602 for UV027; e-value = 0.0). Upon analysis of the sequences it
was obvious that there are several base differences between the sequences of the two
strains, which led us to investigate the potential of using differences in restriction sites, and
thus insertions/deletions (indeis) in nucleotide sequence to discriminate between the
strains.
70
The sequences were submitted to the Webcutter 2.0 software programme
(http://www.firstmarketlcom/cgi-bin/cutter) to obtain all the available restriction sites present
in the strains (Appendix B, Figure B2.a and B2.b). A vast number of restriction sites were
identified with differences, for example Aeil (6; 26, 550, 800, 928, 1459, 1947 bp) in
PCC7813 vs Aeil (5; 26, 799, 927, 1458 bp) in UV027. Unique restriction sites have also
been identified, e.g. Mval (1 fragment, 276 bp) and Ee01301 (1, 1101 bp) in UV027; and
Aoel (1, 652 bp), Bse21 I (1, 652 bp) and BspHI (1, 873 bp) in PCC7813, to name a few
(Table 4.3, Appendix B).
Table 4.3 List of unique restriction enzyme sites obtained after analysis of the meyB gene
sequences from strains PCC7813 and UV027.
PCC7813
AciI 6 26 550 800 928 1459 1947 ccgc
AclWl 1 1661 ggatc
AcsI 6 367 427 998 1158 1781 1859 r/aatty
AfaI 2 791 1649 gt/ac
AluI 5 1444 1531 1642 1737 2064 ag/ct
Alw261 2 938 2036 gtctc
AlwI 1 1661 ggatc
AocI 1 652 cc/tnagg
AsnI 2 914 1836 at/taat
AspLEl 3 296 392 759 gcg/c
AspS91 4 414 1558 1696 1960 g/gncc
AsuI 4 414 1558 1696 1960 g/gncc
AvaIl 2 414 1558 g/gwcc
BbvI 6 396 619 931 1277 1448 1945 gcagc
BfaI 5 787 1103 1238 1597 1920 c/tag
Bme181 2 414 1558 g/gwcc
BpmI 2 141 672 ctggag
BsaJl 5 274 1057 1391 1515 1634 c/cnngg
BselI 3 673 1696 2039 actgg
Bse21I 1 652 cc/tnagg
BseDl 5 274 1057 1391 1515 1634 c/cnngg
BseNl 3 673 1696 2039 actgg
BsmAl 2 938 2036 gtctc
BsmFl 1 555 gggac
Bsp143l 1 1656 /gatc
BspHl 1 873 t/catga
BspMl 3 516 748 1979 acctgc
BsrDl 1 925 gcaatg
BsrI 3 673 1696 2039 actgg
71
BsrSI 3 673 1696 2039 aetgg
BssT11 1 274 e/ewwgg
Bst71I 6 396 619 931 1277 1448 1945 geage
BstF51 4 75 463 1153 1272 ggatg
BstX21 1 1656 r/gatey
BstXI 1 33 eeannnnn/ntgg
BstYI 1 1656 r/gatey
Bsu361 1 652 ee/tnagg
BsuRI 3 796 1698 1961 gg/ee
CfoI 3 296 392 759 geg/e
Cfr131 4 414 1558 1696 1960 g/gnec
CviJI 16 693 727 796 1027 1241 1444 1531 rg/ey
1633 1642 1698 1737 1747 1788
1843 1961 2064
CvnI 1 652 ee/tnagg
DpnI 1 1658 ga/tc
DpnII 1 1656 /gate
Ee0471 2 414 1558 g/gwee
Ee0571 1 688 etgaag
Ee0811 1 652 ee/tnagg
EeoT14 I 1 274 e/ewwgg
ErhI 1 274 e/ewwgg
FokI 4 75 463 1153 1272 ggatg
GsuI 2 141 672 etggag
HaeIII 3 796 1698 1961 gg/ee
HgaI 5 196 355 553 1885 1942 gaege
HgiEI 2 414 1558 g/gwee
HhaI 3 296 392 759 geg/e
Hin61 3 294 390 757 g/ege
HinPlI 3 294 390 757 g/ege
HineII 1 355 gty/rae
HindII 1 355 gty/rae
HinfI 17 37 100 210 402 639 665 807 832 g/ante
932 946 1123 1218 1452 1665 1772
1927 1982
HphI 2 548 2059 ggtga
HspAI 3 294 390 757 g/ege
Kz091 1 1656 /gate
MaeI 5 787 1103 1238 1597 1920 e/tag
MaeIII 9 193 338 575 852 968 1211 1305 /gtnae
1326 1702
MboI 1 1656 /gate
MboII 4 541 814 1484 1686 gaaga
MflI 1 1656 r/gatey
Mnll 10 52 142 244 435 511 657 874 1168 eete
1396 1438
MSpR91 3 1058 1516 1635 ee/ngg
MwoI 4 252 802 1639 1929 gennnnn/nnge
NdeII 1 1656 /gate
Pall 3 796 1698 1961 gg/ee
PleI 8 41 214 643 669 836 936 1776 1986 gagte
Real 1 873 t/eatga
Sau3AI 1 1656 /gate
Sau961 4 414 1558 1696 1960 g/gnee
SerFI 3 1058 1516 1635 ee/ngg
SfaNI 3 76 391 1878 geate
SinI 2 414 1558 g/gwee
Sse91 20 128 146 248 367 427 976 998 1095 /aatt
1158 1173 1333 1426 1489 1781
1837 1859 1864 1891 1909 2041
Styl 1 274 e/ewwgg
72
Tsp5091 20 128 146 248 367 427 976 998 1095 /aatt
1158 1173 1333 1426 1489 1781
1837 1859 1864 1891 1909 2041
TspEI 20 128 146 248 367 427 976 998 1095 /aatt
1158 1173 1333 1426 1489 1781
1837 1859 1864 1891 1909 2041
XhaII 1 1656 r/gatey
UV027
AeiI 5 26 550 799 927 1458 eege
AelWI 2 1315 1660 ggate
AfeI 2 1590 1677 age/get
AluI 4 1443 1530 1641 1800 ag/et
Alw261 1 937 gtete
AlwI 2 1315 1660 ggate
Aar51HI 2 1590 1677 age/get
AsnI 2 673 913 at/taat
AspLEI 5 296 392 758 1591 1678 geg/e
AspS91 2 414 1759 g/gnee
AsuI 2 414 1759 g/gnee
AvaIl 1 414 g/gwee
AvrII 1 1101 e/etagg
BbsI 1 1484 gaagae
BbvI 5 396 586 619 930 1447 geage
BfaI 7 786 1102 1201 1237 1560 1596 e/tag
2049
BglII 1 740 a/gatet
BlnI 1 1101 e/etagg
Bme181 1 414 g/gwee
BpmI 1 141 etggag
BsaJI 6 274 1056 1101 1314 1514 1633 e/enngg
BsaMI 1 1977 gaatge
Bsel1 1 1759 aetgg
BseDI 6 274 1056 1101 1314 1514 1633 e/enngg
BseNI 1 1759 aetgg
BsmAI 1 937 gtete
BsmI 1 1977 gaatge
Bsp1431 4 740 1310 1655 1967 /gate
BspMI 1 516 aeetge
BsrDI 1 924 geaatg
BsrI 1 1759 aetgg
BsrSI 1 1759 aetgg
BssTlI 1 1101 e/ewwgg
Bst2UI 1 276 ee/wgg
Bst71I 5 396 586 619 930 1447 geage
BstF51 5 75 463 1152 1271 1707 ggatg
BstH21 2 1592 1679 rgege/y
BstNI 1 276 ee/wgg
BstOI 1 276 ee/wgg
BstX21 2 740 1655 r/gatey
BstXI 2 33 657 eeannnnn/ntgg
BstYI 2 740 1655 r/gatey
BsuRI 2 795 1761 gg/ee
CfaI 5 296 392 758 1591 1678 geg/e
Cfr131 2 414 1759 g/gnee
CviJI 14 693 726 795 1026 1240 1395 1443 rg/ey
1530 1632 1641 1761 1800 1851
2058
DpnI 4 742 1312 1657 1969 ga/te
73
DpnII 4 740 1310 1655 1967 /gate
Eeo321 1 1688 gat/ate
Eeo471 1 414 g/gwee
Eeo47II1 2 1590 1677 age/get
Eeo571 2 688 1968 etgaag
EeoRII 1 274 /eewgg
EeoRV 1 1688 gat/ate
EeoT141 1 1101 e/ewwgg
ErhI 1 1101 e/ewwgg
FauNDI 1 1934 ea/tatg
FokI 5 75 463 1152 1271 1707 ggatg
GsuI 1 141 etggag
HaeII 2 1592 1679 rgege/y
HaeIII 2 795 1761 gg/ee
HgaI 3 196 355 553 gaege
HgiEI 1 414 g/gwee
HhaI 5 296 392 758 1591 1678 geg/e
Hin61 5 294 390 756 1589 1676 g/ege
HinPlI 5 294 390 756 1589 1676 g/ege
HineII 2 355 1720 gty/rae
HindII 2 355 1720 gty/rae
HinfI 16 37 100 210 402 639 665 806 831 g/ante
931 945 1122 1217 1451 1698 1728
1835
HpaI 1 1720 gtt/aae
HspAI 5 294 390 756 1589 1676 g/ege
Kzo91 4 740 1310 1655 1967 /gate
MaeI 7 786 1102 1201 1237 1560 1596 e/tag
2049
MaeIII 10 193 338 575 851 967 1210 1304 /gtnae
1325 1765 2117
MboI 4 740 1310 1655 1967 /gate
MboII 6 541 813 1438 1483 1749 1969 gaaga
MflI 2 740 1655 r/gatey
Mnll 12 52 142 435 511 657 1167 1317 eete
1395 1694 1915 1963 2143
MsII 1 649 eaynn/nnrtg
MspR91 4 276 1057 1515 1634 ee/ngg
Mva12691 1 1977 gaatge
MwoI 3 252 801 1638 gennnnn/nnge
NdeI 1 1934 ea/tatg
NdeII 4 740 1310 1655 1967 /gate
Pall 2 795 1761 gg/ee
PIel 7 41 214 643 669 835 935 1839 gagte
Sau3AI 4 740 1310 1655 1967 /gate
Sau961 2 414 1759 g/gnee
SerFI 4 276 1057 1515 1634 ee/ngg
SfaNI 1 76 geate
SinI 1 414 g/gwee
Sse91 19 128 146 248 367 427 670 975 997 /aatt
1094 1157 1172 1300 1332 1425
1488 1844 1915 1981 2101
SspI 3 1904 1955 2146 aat/att
Styl 1 1101 e/ewwgg
Tsp5091 19 128 146 248 367 427 670 975 997 /aatt
1094 1157 1172 1300 1332 1425
1488 1844 1915 1981 2101
TspEI 19 128 146 248 367 427 670 975 997 /aatt
1094 1157 1172 1300 1332 1425
1488 1844 1915 1981 2101
XbaI 1 1559 t/etaga
74
I XhoII 2 740 1655 r/gatcy
PCR fragments were then amplified to verify differences using available restriction
enzymes (Figure 4.2).
~ 1860 bp
M 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
Figure 4.2 PCR fragments obtained after amplification of Microcysfis aeruginosa strains
with primer pair Tax 10P!Tox 4M. M = Marker III (lambda DNA restricted with
EcoRI and Hindiii), 1 = PCC7813 (0.2 J.l1 DNA); 2 = SAG1 (0.2 J.l1 DNA); 3 =
CCAP1450/1 (0.2 J.l1 DNA), 4 = UV027 (0.2 J.l1 DNA), 5 = PCC7813 (0.4 J.l1 DNA);
6 = PCC7813 (0.5 J.l1 DNA); 7 = SAG1 (1 J.l1 DNA), 8 = SAG1 (0.8 J.l1 DNA); 9 =
water control; 10 = UP01 (0.2 J.l1 DNA); 11 = UP03 (0.2 J.l1 DNA); 12 = UP03 (1 ul
DNA); 13 = UP04 (1 J.l1 DNA); 14 = UP02 (0.2 J.l1); 15 = UP02 (0.2 J.l1); 16 = UP02
(1 J.l1); 17 = UP02 (1 J.l1); 18 = water control.
PCR amplification with primer pair Tox3P!Tox 2M resulted in a fragment with approximate
size of 1850 bp in all the M. aeruginosa strains, but not in M. wesenbergii (Figure 4.2).
These fragments were then restricted with EcoRI, Rsal, Sau3AI, and A/uI.
75
Bp
-1500
-300
2 3 4 5 6 7 8
RsaI EcaRI
bp
-1900
-1600
-1300
2 3 4 5 6 7 8 M
Sau3AI A/uI
Figure 4.3 Polymorhic loci obtained after digestion of the mcyB fragments with different
restriction enzymes (Rsal, EcoRI, Sau3AI, Alul). The mcyB gene fragments
were obtained after amplification with primer pair Tox 3PITox 2M. 1 & 5 =
PCC7813; 2 & 6 = SAG1; 3 & 7 = CCAP1450/1; 4 & 8 = UV027; M = 100 bp
ladder.
Restriction with EcoRI and Alul resulted in one fragment in all the strains, while Rsal gave
two fragments (Table 4.4, Figure 4.3). Restriction with Sau3AI gave four bands in strain
PCC7813, but five in strains SAG1, CCAP1450/1, and UV027, respectively (Table 4.4,
Figure 4.3).
76
Table 4.4 Number of indels observed after restriction of the mcyB gene with selected
enzymes of Microcystis aeruginosa strains.
Micro cys tis Rsal EEc@ll'{l Sau3AI A/ui
strains
PCC7813 2 1 4 1a
SAG1 2 1 5 1b
CCAP1450/1 2 1 5 1
UV027 2 1 5 1
UP01 2 1 5 1
UP02 x* x x x
UP03 2 1 5 1
UP04 2 1 5 1
*= no mcyB fragment present for endo-nuclease restriction; a = 5 indels expected; b = 4 indels expected.
Discussion
Ambiguities exist in the cyanobacterial taxonomy and these are due to variability in
expression, minimal morphological and developmental characteristics that could be used
for identification, making the classification to the genus or species level difficult (Doers and
Parker 1988, Rippka 1988). Cyanobaterial identification depends largely on the taxonomic
parameters that are applied. These parameters can differ in emphasis relating to cell size,
shape, buoyancy and toxicity (Rippka and Herdman 1992). Among botanical taxonomists,
there is a suspicion that too many species have been described over the years as many
descriptions are based on a single character difference (e.g. such as the presence or
absence of sheath or slight deviation in cell dimensions or cell forms) (Anagnostidis and
Komárek 1990). The problem of the species morphological variability has prompted Drouet
(1968) to revise the taxonomy profoundly. His basic idea was that there existed ecophenes,
where organisms sharing the same genotype but expressing distinct morphologies under
the influence of environmental factors. He drastically reduced the number of species down
to 62. Later, DNA-DNA hybridizations showed that taxa placed by Drouet (1968) in the
same species were genotypically different (Stam and Venema 1975). Komárek and
77
Anagnostidis (1989) stated that the features of more than 50 % of the strains in collections
do not correspond to the diagnoses of the taxa to which they are assigned. Thus there is a
real need for further characterization of the numerous cyanobacterial cultures available
worldwide.
Pan et al. (2002) and do Carrno Bittencourt-Olivera (2003) proposed to use a peR-based
method utilising the mcyB gene to confirm the presence or absence of biotoxin producing
organisms in raw water. They aimed at improving water management strategies, working
on the premesis that the detection of the genus will alert water purification facilities to scale-
up on purification procedures. When peR-based methods are used for diagnostic
purposes, only small amounts of DNA are required for the analysis (Venter and Botha
2000). Here we used peR based technology and the meyB gene sequence not only to
confirm the presence of Mieroeystis aeruginosa, but also to identify specific species and
strains of Mieroeystis, by making use of the uniqueness of genomic DNA with regard to
their specific restriction endo-nuclease restriction sites.
In the present study, the gene sequence of meyB was confirmed and the sequence
homology was verified through alignment with published sequences using the BLASTN
algoritm (Althschul et al. 1997) in GenBank. The meyB gene proved useful to discern
between M. aeruginosa and M. wesenbergii. The mey gene cluster present in M.
aeruginosa had been shown to be responsible for toxin production, as disruption of some of
the genes within the cluster, including meyB, resulted in no detectable toxin production
(Nishiwaza et al. 2000). The absence of the mcyB fragment in the M. wesenbergii sample
may be indicative of non-toxicity. The unique restriction sites were obtained using
Webcutter 2.0 software programme to obtain unique restriction sites. More than 70
differences in the restriction sites were obtained between the two strains, namely pee7813
78
and UV027, clearly indicating the potential of using peR-RFLPs as a low-cost and effective
way of identifiying Microcystis aeruginosa strains.
From the results obtained in the present study, it is evident that peR-based technology
(e.g. peR amplifying the mcy gene cluster or peR-PFLP thereof) has great potential for
fast screening and detection of Microcystis toxic strains in waterbodies. This will potentially
ease current water purification management strategies through early detection prior to
occurrence of undesireable 'blooms', as well as proven genetic information that can be
used in attempts to reconstruct the evolution of organisms and improve their taxonomy.
Most DNA tests have relied on Southern blots of cyanobacterial samples (Meifsner et al.
1996, Dittman et al. 1997, Nishizawa et al. 1999, 2000) or degenerate peR amplification of
rRNA (Neiland et al. 1999). In the work presented here, the amplification of the mcyB gene
by peR from DNA isolated from axenic cultures and field samples has proven to be a
sensitive means to differentiate taxonomicaly between a wide variety of geographically
unrelated Microcystis aeruginosa axenic and environmental strains, as well as the detection
of toxic strains.
References
Altschul SF, Madden TL, Schafter AA, Zhang J, Zhang Z, Miller W & Lipman DJ. 1997.
Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs. Nucleic Acids Res. 25: 3389-3402.
Anagnostidis K & Komárek J. 1990. Modern approach to the classification system of
cyanophytes 5-Stigonematales. Arch Hydrobiol Suppl 86, Algological Studies 59: 1-73
Baker JA, Entsch B, Neiland BA & McKay DB. 2002. Monitoring changing toxigenicity
bloom by molecular methods. Appl. Environ. Microbiol. 68: 6070-6076.
79
Chorus I & Bartram J. 1999. Toxic cyanobacteria in water. A guide to the Public Health
Consequences, Monitoring and Management. EF and Spon CO., London, pp 416.
Cobb BD & Clarkson JM. 1994. A simple procedure for optimising the polymerase chain
reaction (PCR) using modified Taguchi methods. Nucliec Acids Research 22: 3801-
3805.
Dittman E, Neiland BA, Erhard M, von Doren H & Borner. 1997. Insertional mutagenesis of
a peptide synthetase gene that is responsible for hepatotoxin production in the
cyanobacterium Microcystis aeruginosa PCC7806. Mol. Microbiol. 26: 779-787.
Doers MP & Parker DL. 1988. Properties of Microcystis aeruginosa and M. flos-aquae
(Cyanophyta) in culture: taxonomic implications. J. Phycol. 24: 502-508.
Do Carmo Bittencourt-Oliveira M. 2003. Detection of potential microcystin-producing
cyanobacteria in Brazilian reservoirs with a mcyB molecular marker. Harmful Algae 2:
51-60.
Drouet F. 1968. Revision of the classification of the Oscillatoriaceae, Monograph Acad
Natur. Sci. Philadelphia. Fulton Press, Lancaster, Pennsylvania. pp. 363-373.
Kato T, Watanabe MF & Watanabe M. 1991. Allozyme divergence in Microcystis
(Cyanophyceae) and its taxonomic inference. Arch. Hydrobiol. Suppl. Bd. 6: 129-140.
Komárek J. 1958. Die taxonomische Revision der Planktisch Blaualgen der
Tschechoslowakei. In J. Komárek and H. Ettl (ed.), Algologische Studien.
Tschechoslowakishen Akademie der Wissenschaften, Prague. pp. 10-206.
Komárek J. 1991. A review of water-bloom forming Microcystis species, with regard to
populations in Japan. Arch. Hydrobiol. Suppl. Bd. 64: 115-127.
Komárek J & Anagnostidis K. 1989. Modern approach to the classification system of
cyanophytes. 4-Nostocales. Arch Hydrobiol, Suppl 823, Algological Studies 56: 247-
345.
80
Mei~ner K, Dittman E & Borner T. 1996. Toxic and non-toxic strains of the
cyanobacterium Microcystis aeruginosa contain sequences homologous to peptide
synthetases genes. FEMS Microbiol. Lett. 135: 295-303.
Neiland BA, Dittmann E, Roumiainen L, Bass R.A., Schaub V, Sivinen K & Borner T.
1999. Nonribosomal peptide synthesis and toxigenicity of cyanobacteria. J. Bacteriol.
181: 4089-4097.
Nishizawa T, Asayama M, Fujii K, Harada K & Shirai M. 1999. Genetic analysis of the
peptide synthetase gene for a cyclic heptapeptide microcystin in Microcystis spp. J.
Biochem. 126: 520-529.
Nishizawa T, Ucda A, Asayama M, Fujii K, Harada K, Ochi K & Shirai M. 2000. Polyketide
synthase gene coupled to the peptide synthetase module involved in the biosynthesis
of the cyclic heptapeptide microcystin. J. Biochem. 127: 779-789.
Pan H, Song LR, Liu YD & Borner T. 2002. Detection of hepatotoxic Microcystis strains by
PCR with intact cells from both culture and environmental samples. Arch. Microbiol.
178: 421-427.
Raeder U & 8roda P. 1985. Rapid preparation of DNA from filamentous fungi. Letters of
Applied Microbiology 1: 17-20.
Repavich WM, Sonzogni WC, Standridge JH, Wedepohl RE & Meisner LF. 1990.
Cyanobacteria (blue-green algae) in Wisconsin waters: acute and chronic toxicity.
Water Res. 24: 225-231.
Rippka R. 1988. Recognition and identification of cyanobacteria. Methods Enzymol. 167:
28-67.
Rippka R & Herdman M. 1992. Pasteur Culture Collection (PCC) of Cyanobacterial strains
in axenic culture, vol. 1. Catalogue of strains. Institut Pasteur, Paris, France.
81
Sambraak J, Fritsch EF & Maniatis T. 1989. Molecular cloning: A laboratory manual, 2nd
Edition. Cold Spring Harbor, NY: Cold Spring Harbar Laboratory Press. pp. 6.1-6.30.
Stam WT & Venema G. 1975. The use of DNA-DNA hybridization for determination of the
relationship between some blue-green algae. Acta Bot Neerl 26: 327-342.
Steyn DJ, Scott WE, Toerien OF & Visser JH. 1975. The eutrophication levels of same
South African impoundments. 1. Rietvlei Dam. Water SA 2: 45-52.
Tillett 0, Parker DL & Neiland BT. 2001. Detection by a probe for mycrocystin synthetase A
gene (mcyA) of the cyanobacterial genus Microcystis: Comparison of toxicities with 16S
rRNA and phytocyanin operon (phytocyanin intergenie spaeer) phylogenies. Appl.
Environ. Microbial. 67: 2810-2818.
Venter E & Botha A-M. 2000. Development of markers linked to Oiuraphis noxia resistance
in wheat using a novel PCR-RFLP approach. Theor. Appl. Genet. 100: 965-970.
82
Appendix 8
PCC7813 ATGGCAGACACAAAAAATCAACCCGCCAAAAATGTGGAGTCTATTTATCCTCTTTCCCCCATGC64
UV027 ATGGCAGACACAAAAAATCAACCCGCCAAAAATGTGGAGTCTATTTATCCTCTTTCCCCCATGC64
mcyB ATGGCAGACACAAAAAATCAACCCGCCAAAAATGTGGAGTCTATTTATCCTCTTTCCCCCATGC64
dnaN ATGGCAGACACAAAAAATCAACCCGCCAAAAATGTGGAGTCTATTTATCCTCTTTCCCCCATGC64
PCC7813 65 AGGAAGGGATGCTCTTTCATAGTCTTTATACTCCTGATTCAGGGATTTATTGTAGTCAAACTCT128
UV027 65 AGGAAGGGATGCTCTTTCATAGTCTTTATACTCCTGATTCAGGGATTTATTGTAGTCAAACTCT128
mcyB 65 AGGAAGGGATGCTCTTTCATAGTCTTTATACTCCTGATTCAGGGATTTATTGTAGTCAAACTCT128
dnaN 65 AGGAAGGGATGCTCTTTCATAGTCTTTATACTCCTGATTCAGGTATTTATTGTAGTCAAACTCT128
PCC7813 129 AATTACTCTGGAGGGAGAAATTAACCTTGCAGTTTTTAGGCAAGCGTGGGAAAAAGTTGTAGAG192
UV027 129 AATTACTCTGGAGGGAGAAATTAACCTTGCAGTTTTTAGGCAAGCGTGGGAAAAGGTTGTAGAG192
mcyB 129 AATTACTCTGGAGGGAGAAATTAACCTTACAGTTTTTAGGCAAGCGTGGGAAAAGGTTGTAGAG192
dnaN 129 AATTACTCTGGAGGGAGAAATTAACCTTACAGTTTTTAGGCAAGCGTGGGAAAAAGTTGTAGAG.192
PCC7813 193 CGTCACTCGGTATTAAGGACTCTATTTCTTTGGGAAAAACGGGAAAAACCTCTGCAAATTGTGC256
UV027 193 CGTCACTCGGTATTAAGGACTCTATTTCTTTGGGAAAAACGGGAAAAAACCTTGCAAATTGTGC256
mcyB 193 CGTCACTCGGTATTAAGGACTCTATTTCTTTGGGAAAAACGGGAAAAACCTCTGCAAATTGTGC256
dnaN 193 CGTCACTCGGTATTAAGGACTCTATTTCTTTGGGAAAAACGGGAAAAACCTCTGCAAATTGTGC256
PCC7813 257 GAAAAAAGGTTGATTTGCCTTGGGATTATCAGGATTGGCGCAATCTTTCCCCCACAGAACAACA320
UV027 257 GAAAAAAGGTTGATTTGCCCTGGGATTATCAGGATTGGCGCAATCTTTCCCCCACAGAACAACA320
mcyB 257 GAAAAAAGGTTGATTTGCCCTGGGATTATCAGGATTGGCGCAATCTTTCCCCCACAGAACAACA320
dnaN 257 GAAAAAAGGTTGATTTGCCCTGGGATTATCAGGATTGGCGCAATCTTTCCCCCACAGAACAACA320
PCC7813 321 ACAGCGTTTAGATTTATTGTTACAAACAGAGCGTCAACAAGGGTTTGAATTCAAAGTTGCTCCT384
UV027 321 ACAGCGTTTAGATTTATTGTTACAAACAGAGCGTCAACAAGGGTTTGAATTCAAAGTTGCTCCT384
mcyB 321 ACAGCGTTTAGATTTATTGTTAGAAACAGAGCGTCAACAAGGGTTTGAACTCAAAGTTGCTCCT384
dnaN 321 ACAGCGTTTAGATTTATTGTTACAAACAGAGCGTCAACAAGGGTTTGAATTCAAAGTTGCTCCT384
PCC7813 385 TTGATGCGCTGCTTGATGATTCAACTATCGGACCAAACTTATAAATTCCTCTGCAATCATCATC448
UV027 385 TTAATGCGCTGCTTGATGATTCAACTATCGGACCAAACTTATAAATTCCTCTGCAATCATCATC448
mcyB 385 TTAATGCGTTGCTTGATGATTCAACTATCGGACCAAACTTATAAATTCCTCTGCAATCATCATC448
dnaN 385 TTAATGCGCTGCTTGATGATTCAACTATCAGACCAAACTTATAAATTCCTCTGCAATCATCATC448
•
PCC7813 449 ATATTATTCTGGATGGTTGGAGTATGCCTA TTATTTATCAAGAAGTTTT AGGGTTTTATGAGGC 512
UV027 449 ATATTATTCTGGATGGTTGGAGT ATGCCTA TTATTTATCAAGAAGTTTT AGGGTTTT ATGAGGC 512
mcyB 449 ATATTATTCTGGATGGTTGGAGTATGCCTA TTATTTATCAAGAAGTTTTAGGGTTTT ATGAGGC 512
dnaN 449 ATATTATTCTGGATGGTTGGAGTATGCCTATTATTTATCAAGAAGTTTTAGGGTTTTATGAGGC 512
PCC7813 513 AGGTATTCAAGGGAAAAGTTATCATCTTCCTTCACCGCGTCCCTATCAAGATTATATTGTTTGG576
UV027 513 AGGTA TTCAAGGGAAAAGTT ATCATCTTCCTTTGCCGCGTCCTT ATCAAGA TTATATTGTTTGG 576
mcyB 513 AGGTA TTCAAGGGAAAAGTT ATCATCTTCCTTTGCCGCGTCCTT ATCAAGA TTATATTGTTTGG 576
dnaN 513 AGGTA TTCAAGGGAAAAGTCATCATCTTCCTTCACCGCGTCCTT ATCAAGA TTATATTGTTTGG 576
PCC7813 577 TTACAGGAGCAAAACCCATCTATTGCTGAGAGTTTTTGGCAGCGAACTCTTGAAGGGTTTATGA640
UV027 577 TTACAGCAGCAAAACCCATCTATTGCTGAGAGTTTTTGGCAGCGAACTCTTGAAGGGTTTATGA640
mcyB 577 TTACAGGAGCAAAACCCATCTATTGCTGAGAGTTTTTGGCAGCGAACTCTTGAAGGGTTTATGA640
dnaN 577 TTACAGGAGCAAAACCCATCTGTTGCTGAGAGTTATTGGCAGCGAACTCTTGAAGGGTTTATGA640
PCC7813 641 CTCCCACCCCCCTGAGGGTGGACAGACTCCAGTTAATGAAATCTGAAGGTAAGCCAACTTATAA704
UV027 641 CTCCCACCCCCATGAGGGTGGACAGACTCCAATTAATGAAATCTGAAGGTAAGCCGACTTATAA704
mcyB 641 CTCCCACCCCCCTGAGGGTGGACAGACTCCAGTTAATGAAATCTGAAGGTAAGCCAACTTATAA704
dnaN 641 CTCCCACCCCCCTGAGGGTGGACAGACTCCAGTTAATGAAATCTGAAGGTAAGCCGACTTATAA704
PCC7813 705 AGAGTATAACTGTCATTTATCGGCTTCTCACTCCAAAGACCTGCAATCTTTGGCGCAAAAGCAT768
UV027 705 AGAGCATAACTGTCATTTATCGGCTTCTCACTCCAAAGATCTGCAATCTTTGGCGCAAAAGCAT768
mcyB 705 AGAGTATAACTGTCATTTATCGGCTTCTCACTCCAAAGACCTGCAATCTTTGGCGCAAAAGCAT768
dnaN 705 AGAGTATAACTGTCATTTATCGGCTTCTCTCTCCAAAGACCTGCAATCTTTGGCGCAAAAGCAT768
•
PCC7813 769 AATCTGACCTTATCTACTCTAGTACAGGCCGCTTGGGCGATTCTTCTCAGTCGCTATAGTGGGG832
UV027 769 AATCTGACCTTATCTACTCTAGTACAGGCCGCTTGGGCGATTCTTCTCAGTCGCTATAGTGGGG832
mcyB 769 AATCTGACCTTATCTACTCTAGTACAGGCCGCTTGGGCGATTCTTCTCAGTCGCTATAGTGGGG832
dnaN 769 AATCTGACCTTATCTACTCTAGTACAGGCCGCTTGGGCGATTCTTCTCAGTCGCTATAGTGGGG832
PCC7813 833 AGTCAGAAGTTTT ATTTGGGGTT ACGGTTTCTGGTCGCCCTCATGA TTTATCAGGGGTAGAACA 896
UV027 833 AGTCAGAAGGTTTATTTGGGGTTACGGTTTCTGGTCGCCCCCATGATTTATCGGGGGTAGAACA896
mcyB 833 AGTCAGAAGTTTT ATTTGGGGTT ACGGTTTCTGGTCGCCCCCATGA TTTATCAGGGGTAGAACA 896
dnaN 833 AATCAGAAGTTTTA TTTGGGGTT ACGGTTTCTGGTCGCCCCCAT.GATTT ATCA.GGGGTAGAACG .896
83
PCC7813 897 TAGGGT AGGA TTATTTATTAATACA TTGCCGCTGCGAGTCTCCATCAGAGAATCAGATTT ATTG 960
UV027 897 TAGGGTAGGATTATTTATTAATACATTGCCGCTGCGAGTCTCCATCAGAGAATCAGATTTATTG960
meyB 897 TAGGGTAGGATTATTTATTAATACATTGCCGCTGCGAGTCTCCATCAGAGAATCAGATTTATTG960
dnaN 897 TAGGGTAGGATTATTTATTAATACATTGCCGCTGCGAGTCTCCATCAGAGAATCAGATTTATTG960
PCC7813 961 CTATCTTGGTTACAGGAATTACAGCAAAAGCAAGCAGAAATTCAGGATTATGCTTATGTTTCTC1024
UV027 961 CTATCTTGGTTACAGGAATTACAGCAAAGGCAAGCAGAAATTCAGGATTATGCTTATGTTTCTC1024
meyB 961 CTATCTTGGTTACAGGAATTACAGCAAAAGCAAGCAGAAATTCAGGATTATGCTTATGTTTCTC1024
dnaN 961 CTATCTTGGTTACAGGAATTACAGCAAAAGCAAGCAGAAATTCAGGATTATGCTTATGTTTCTC1024
PCC7813 1025 TGGCTGAAATACAGAGATTAAGTGATATTCCACCGGGGGTTCCCCTGTTTGAGAGTTTGGTCGT1088
UV027 1025 TGGCTGAAATACAGAGATTAAGTGATATTCCACCGGGGGTTCCCCTGTTTGAGAGTTTGGTCGT1088
meyB 1025 TGGCTGAAATACAGAGATTAAGTGATATTCCACCGGGGATTCCCCTGTTTGAGAGTTTGGTCGT1088
dnaN 1025 TGGCTGAAATACAGAGATTAAGTGATATTCCACCGGGGGTTCCCCTGTTTGAGAGTTTGGTCGT1088
PCC7813 1089 TTTTGAGAATTATCCTAGAGAAGCGTTATCGAGAGATTCTCGTCAATCCTTAAGGGTTAAGGAT1152
UV027 1089 TTTTGAGAATTATCCTAGGGAAGCGTTATCGAGAGATTCTCGTCAATCCTTAAGGGTTAAGGAT1152
meyB 1089 TTTTGAGAATTATCCTAGAGAAGCGTTATCGAGAGATTCTCGTCAATCCTTAAGGGTTAAGGAT1152
dnaN 1089 TTTTGAGAATTATCCTAGGGAAGCGTTATCGCGAGATTCTCGTCAATCCTTAAGGGTTAAGGAT1152
PCC7813 1153 GTGGAGAATTTTGAGGAAACTAATTATCCTTTGACGGTGGTTGCTATTCCTAAACAGGAGTTAC1216
UV027 1153 GTGGAGAATTTTGAGGAAACTAATTATCCTTTGACGGTGGTTGCTATTCCTAGACAAGAGTTAC1216
meyB 1153 GTGGAGAATTTTGAGGAAACTAATTATCCTTTGACGGTGGTTGCTATTCCTAGACAAGAGTTAC1216
dnaN 1153 GTGGAGAATTTTGAGGAAACTAATTATCCTTTAACGGTGGTTGCTATTCCTAGACAAGAGTTAC1216
PCC7813 1217 TGATTCAGTTAGTCTATGATACTAGCCGTTTTACTCAGGATACGATTGAACGGATGGCAGCACA1280
UV027 1217 TGATTCAGATAATCTATGATACTAGCCGTTTTACTCAGGATACGATTGAACGGATGGCAGGACA1280
meyB 1217 TGATTCAGTTAGTCTATGATACTAGCCGTTTTACTCAGGATACGATTGAACGGATGGCAGCACA1280
dnaN 1217 TGATTCAGTTAATCTATGATACTAGCCGTTTTACTCAGGATACGATTGAACGGATGGCAGGACA1280
*
PCC7813 1281 TTTACAGACTATTTTAACAGGGATTGTTACTGATACTCGGCAACGGGTAACACAATTACCTATA1344
UV027 1281 TTTACAGACTATTTTAACAGGAATTGTTACTGATCCTCGGCAACGGGTAACACAATTACCTATA1344
meyB 1281 TTTACAGACTATTTTAACAGGGATTGTTACTGATACTCGGCAACGGGTAACACAATTACCTATA1344
dnaN 1281 TTTACAGACTATTTTAACAGGAATTGTTACTGATCCTCGGCAACGGGTAACACAATTACCTATA1344
* *
PCC7813 1345 TTGACAACACAAGAGCAACATCAGTTATTAGTAGAGTGGAACAATACCGAGGCAGATTATCCTT1408
UV027 1345 TTGACAACACAAGAGCAACATCAGTTATTAGTAGAGTGGAACAATAGGGAGGCTGATTATCCTT1408
meyB 1345 TTGACAACACAAGAGCAACATCAGTTATTAGTAGAGTGGAACAATACCGAGGCAGATTATCCTT1408
dnaN 1345 TTGACAACCCAAGAGCAACATCAGTTATTAGTAGAGTGGAACAATAGGGAGGCTGATTATCCTT1408
*
PCC7813 1409 TAGATAAGTCTTTACATCAATTATTTGAGGAACAAGCTGCACAGAATCCGCAGGGAATAGTGGT1472
UV027 1409 TAGATAAGTCTTTACATCAATTATTTGAAGAACAAGCTGCACAGAATCCGCAGGGAATAGTGGT1472
meyB 1409 TAGATAAGTCTTTACATCAATTATTTGAGGAACAAGTTGCACAGAATCCGCAGGGAATAGCGGT1472
dnaN 1409 TAGATAAGTCTTTACATCAATTATTTGAAGAACAAGCTGCACAGAATCCGCAGGGAATAGCGGT1472
PCC7813 1473 TATTTTTGAAGACCAAAAATTAACCTATCAACAGTTAAATAACCGGGGCAATCAGTTAGCTCAC1536
UV027 1473 TATTTTTGAAGACCAAAAATTAACCTATCAACAGTTAAATAACCGGGGCAATCAGTTAGCTCAC1536
meyB 1473 TATTTTTGAAGGACAAAAATTAACCTATCAACAGTTAAATAACCGGGGCAATCAGTTAGCTCAC1536
dnaN 1473 TATTTTTGAAGACCAAAAATTAACCTATCAACAGTTAAATAACCGGGGCAATCAGTTAGCTCAC1536
PCC7813 1537 TGTTTACGAGATAAGGGTGTAGGTCCAGAAAGTTTGGTCGGGATTTTTATGGAGCGTTCCCTAG1600
UV027 1537 TGTTTACGAGATAAGGGTGTAGGTCTAGAAAGTTTGGTCGGGATTTTTATGGAGCGCTCCCTAG1600
meyB 1537 TGTTTACGAGATAAGGGTGTAGGTCCAGAAAGTTTGGTCGGGATTTTTATGGAGCGTTCCCTAG1600
dnaN 1537 TGTTTACGAGATAAGGGTGTAGGTCCAGAAAGTTTGGTCGGGATTTTTATGGAGCGCTCCCTAG1600
PCC7813 1601 AGATGGTCATCGGTTTATTAGGGATATTAAAAGCCGGGGGAGCTTATGTACCTTTAGATCCGGA1664
UV027 1601 AGATGGTCATCGGTTTATTAGGGATATTAAAAGCCGGGGGAGCTTATGTACCTTTAGATCCGGA1664
meyB 1601 AGATGGTCATCGGTTTATTAGGGATATTAAAAGCCGGGGGAGCTTATGTACCTTTAGATCCGGA1664
dnaN 1601 AGATGGTCATCGGTTTATTAGGGATATTAAAAGCCGGGGGAGCTTATGTACCTTTAGATCCGGA1664
PCC7813 1665 TTATCCTACCGAGCGCTTGGGGGATATCCTCTCAGATTCGGGGGTTTCTTTGGTGTTAACTCAG1728
UV027 1665 TTATCCTACCGAGCGCTTGGGGGATATCCTCTCAGATTCGGATGTTTCTTTGGTGTTAACTCAG1728
meyB 1665 TTATCCTACCGAGCGCTTGGGGGATATCCTCTCAGATTCGGGTGTTTCTTTGGTGTTAACTCAG1728
dnaN 1665 TTATCCCACCGAGCGCTTGGGGGATATCCTCTCAGATTCGGGGGTTTCTTTGGTGTTAACTCAG1728
PCC7813 1729 GAATCTTTAGGGGATTTTCTTCCCCAAACTGGGGCCGAGTTACTGTGTTTAGATAGGGATTGGG1792
UV027 1729 GAATCTTTAGGGGATTTTCTTCCCCAAACTGGGGCCGAGTTACTGTGTTTAGATAGGGATTGGG1792
meyB 1729 GAATCTTTAGGGGA TTTTCTTCCCCAAACTGGGGCCGAGTT ACTGTGTTTAGATAGGGA TTGGG 1792
dnaN 1729 GAATCTTTAGGGGATTTTCTTCCCCAAACTGGTGCCGAATCACTGTGTTTAGATAGGGATTGGG1792
PCC7813 1793 AAAAGATAGCTACCTATAGCCCAGAAAATCCCTTCAATCTAACGACTCCTGAGAATTTAGCCTA1856
UV027 1793 AAAAGATAGCTACCTATAGTCCAGAAAATCCCTTCAATCTAACGACTCCTGAGAATTTAGCCTA1856
meyB 1793 AAAAGATAGCTACCTATAGTCCAGAAAATCCCTTCAATCTAACGACTCCTGAGAATTTAGCCTA1856
84
dnaN 1793 AAAAGATAGCTACCTATAGCCCAGAAAATCACTTCAATCTAACGACTCCTGAGAATTTAGCCTA1856
PCC7813 1857 TGTTATTTATACATCAGGTTCAACGGGAAAACCCAAAGGAGTATTAATTAGCCATCGGGGGTTT1920
UV027 1857 TGTTATTTATACATCAGGTTCAACGGGAAAACCCAAAGGCGTGATGAATATTCATAGAGGAATT1920
meyB 1857 TGTTATTTATACATCAGGTTCAACGGGAAAACCCAAAGGAGTATTAATTAGCCATCGGGGGTTA1920
dnaN 1857 TGTT ATTTATACATCAGGTTCAACGGGAAAACCCAAAGGGGTA TTAATTAGCCATCGGGGGTT A 1920
PCC7813 1921 ATGAATTTAATTTGTTGGCATCAAGACGCTTTTGAAATTACGCCTTTAGACAAAATTACTCAAC1984
UV027 1921 TGTAATACTCTGACATATGCTATTGGTCATTATAATATTACCTCTGAAGATCGCATTCTCCAAA1984
meyB 1921 ATGAATTTAATTTGTTGGCATCAAGACGCTTTTGAAATTACGCCTTTAGACAAAATTACTCAAC1984
dnaN 1921 ATGAATTTAATTTGTTGGCATCAAGACGCTTTTGAAATTACGCCTTTAGACAAAATTACTCAAC1984
**** *** ••••••••••••• * • • • **** •
PCC7813 1985 TAGCAAGAATCGCTTTTGACGCTGCGGTTTGGGAGTTATGGCCCTGTTTAACAGCAGGTGCGAG2048
UV027 1985 TTACTTCCTTGAGTTTTGATGTTTCAGTTTGGGAAGTTTTCTCGTCTTT AAT ATCTGGTGCTTC 2048
meyB 1985 TAGCAAGAAGTGCTTTTGACGCTGCGGTTTGGGAGTTATGGCCCTGTTTAACAGCAGGTGCGAG2048
dnaN 1985 TAGCAAGAATCGCTTTTGACGCTGCGGTTTGGGAGTTATGGCCCTGTTTAACAGCAGGTGCGAG2048
• ••••• •• *
PCC7813 2049 TCTTGTCTTAGTTAAACCTGAAATCATGCAATCTCCCCCAGACTTGCGAGACTGGTTAATTGCC2112
UV027 2049 TCTAGTCGTGGCTAAACCTGACGGGTATAAA-------GATATAGATTATTTAATAGATTTAATTGTG 2109
meyB 2049 TCTTGTCTTAGTTAAACCTGAAATCATGCAATCTCCCCCGGACTTGCGAGACTGGTTAATTGCC2112
dnaN 2049 TCTTGTCTTAGTTAAACCTGAAATCATGCAATCTCCCCCAGACTTGCGAGACTGGTTAATTGCC2112
* * • * *.*.* * * •• ** •••••••••••••• * ****
PCC7813 2113 CAAGAAATCACCGTCAGCTTTTTACCAACTCCCCTAGTTGAGAAGATTTTATCTTTAAAATG2174
UV027 2113 CAAGAA--CAA-GT AACTTGTTTCACTTGTGTTCCCTCAA TATTGCGAGTTTTTCTGCAACATC 2170
meyB 2113 TTTTT ACCAA------------------------------------CTC--CCCTAGTTGAGAAGATTTTATC2T1T7T4AAAATG
dnaN 2113 CAAGAAATCACCGTCAGCTTTTTACCAACTC-CCCTAGTTGAGAAGA TTTTATCTTTAGAATG 2174
Figure 81. Sequence alignment of the mcyB genes from Microcystis aeruginosa strains
PC7813 and UV027 to published sequences on GenBank
(http://www.ncbi.nlm.nih.gov/BLAST, Altschul et al. 1990). * = differences in
sequence; - = gaps.
85
(a) PCC7813
PCC7813
2078 base pairs
Graphic map
Bsl!
Hsp92II
AciI BstXI PIel Mnl! Bsc41
atggcagacacaaaaaatcaacccgccaaaaatgtggagtctatttatcctctttcccccatgcaggaagggatg base pairs
taccgtctgtgttttttagttgggcggtttttacacctcagataaataggagaaagggggtacgtccttccctac 1 to 75
FauI HinfI NlaIII
BsiYI
BsiYI MseI
SfaNI EcoNI Tsp5091 MnlI TrulI
BstF51 TfiI Sse91 GsuI Sse91
ctctttcatagtctttatactcctgattcagggatttattgtagtcaaactctaattactctggagggagaaatt base pairs
gagaaagtatcagaaatatgaggactaagtccctaaataacatcagtttgagattaatgagacctccctctttaa 76 to 150
FokI HinfI TspEI BpmI TspEI
Bsc41 Tsp5
BsI1 Tru91
HgaI Tru91
CacSI MaeIII TrulI PIel
aaccttgcagtttttaggcaagcgtgggaaaaagttgtagagcgtcactcggtattaaggactctatttctttgg base pairs
ttggaacgtcaaaaatccgttcgcaccctttttcaacatctcgcagtgagccataattcctgagataaagaaacc 151 to 225
Tsp451 MseI HinfI
091
BseDI AspLEI
TspEI BssTlI Hin61
MnlI MwoI Eco1301 HinPlI
gaaaaacgggaaaaacctctgcaaattgtgcgaaaaaaggttgatttgccttgggattatcaggattggcgcaat base pairs
ctttttgccctttttggagacgtttaacacgcttttttccaactaaacggaaccctaatagtcctaaccgcgtta 226 to 300
Sse91 Styl EcoT141 HspAI
Tsp5091 ErhI CfoI
BsaJI HhaI
ApOI
HincII TspEI
MaeIII Hind!! EeaRI
etttcecccacagaacaacaacagcgtttagatttattgttacaaacagagcgtcaacaagggtttgaatteaaa base pairs
gaaagggggtgtcttgttgttgtcgcaaatctaaataacaatgtttgtctcgcagttgttcccaaacttaagttt 301 to 375
HgaI Sse91
AcsI
Tsp5091
CfoI Bst7l1 SinI AvaIl Tsp5091
Hin61 ItaI HinfI Sau961 AcsI
HinPlI Fsp4HI BmelSI HgiEI Sse91 MnlI
gttgctcctttgatgcgctgcttgatgattcaactatcggaccaaacttataaattcctctgcaatcatcatcat base pairs
caacgaggaaactacgcgacgaactactaagttgatagcctggtttgaatatttaaggagacgttagtagtagta 376 to 450
HspAI HhaI TfiI Eco471 TspEI
SfaNI BsoFI AsuI AspS91 ApoI
AspLEI BbvI Cfr131
BstF51 MnlI BspMI
attattctggatggttggagtatgcctattatttatcaagaagttttagggttttatgaggcaggtattcaaggg base pairs
taataagacctaccaacctcatacggataataaatagttcttcaaaatcccaaaatactccgtccataagttccc 451 to 525
FokI
MvnI
ThaI HgaI
MboII HphI AciI Mae!!I
aaaagttatcatcttccttcaccgcgtccctatcaagattatattgtttggttacaggagcaaaacccatctatt base pairs
ttttcaatagtagaaggaagtggcgcagggatagttctaatataacaaaccaatgtcctcgttttgggtagataa 526 to 600
Ace!! BsmFI
BstUI
86
Bsh12361
BbvI BstDEI MseI
BsoFI Bsu361 MnlI BpmI
DdeI ItaI HinfI AoeI Eeo811 HinfI GsuI
getgagagtttttggeagegaaetettgaagggtttatgaeteeeaeeeeeetgagggtggaeagaeteeagtta base pairs
egaeteteaaaaaeegtegettgagaaetteeeaaataetgagggtggggggaeteeeaeetgtetgaggteaat 601 to 675
BstDEI Fsp4HI PleI DdeI Bse211 PleI BsrI
Bst711 CvnI BsiYI TrulI
Bse41 BslI Tru91
BsrSI
BselI
BseNI Eeo571 CviJI BspMI
atgaaatetgaaggtaageeaaettataaagagtataaetgteatttateggetteteaeteeaaagaeetgeaa base pairs
taetttagaetteeatteggttgaatattteteatattgaeagtaaatageegaagagtgaggtttetggaegtt 676 to 750
CviJI
ASpLEI RsaI ItaI BglI
Hin61 Csp61 BsuRI MwoI BstDEI
HinPII BfaI HaeIII TfiI MboII BstSFI
tetttggegeaaaageataatetgaeettatetaetetagtaeaggeegettgggegattetteteagtegetat base pairs
agaaaeegegttttegtattagaetggaatagatgagateatgteeggegaaeeegetaagaagagteagegata 751 to 825
HspAI MaeI CviJI AeiI HinfI DdeI SfeI
CfoI AfaI Pall BsoFI
HhaI Fsp4HI
Hsp92I1
MnlI
HinfI MaeIII BspHI
agtggggagteagaagttttatttggggttaeggtttetggtegeeeteatgatttateaggggtagaaeatagg base pairs
teaeeeeteagtetteaaaataaaeeeeaatgeeaaagaeeagegggagtaetaaatagteeeeatettgtatee 826 to 900
PleI Real
NlaIII
MseI NspBII
TrulI BsoFI Bst711 Alw261
VspI AsnI ItaI AeiI PleI Tfi! Mae!I!
gtaggattatttattaataeattgeegetgegagteteeateagagaateagatttattgetatettggttaeag base pairs
eateetaataaataattatgtaaeggegaegeteagaggtagtetettagtetaaataaegatagaaeeaatgte 901 to 975
PshB! Fsp4H! HinfI BsmA! Hinf!
AseI BsrDI BbvI
Tru91 MspA11
Tsp5091
TSp509! AesI Tru91
Sse91 Cae8! Sse9! CviJ! Trul!
gaattaeageaaaageaageagaaatteaggattatgettatgtttetetggetgaaataeagagattaagtgat base pairs
ettaatgtegttttegttegtetttaagteetaataegaataeaaagagaeegaetttatgtetetaatteaeta 976 to 1050
TspEI TspEI Mse!
Apo!
BsaJI Nla!V
BsiSI MspR91 Tsp509! Hinf!
MspI SerFI Sse91 BfaI TthHB8!
atteeaeegggggtteeeetgtttgagagtttggtegtttttgagaattateetagagaagegttategagagat base pairs
taaggtggeeeeeaaggggaeaaaeteteaaaeeageaaaaaetettaataggatetettegeaatageteteta 1051 to 1125
Hap!I Nei! TspEI Mae! TaqI Tfi!
BseD! BenI
HpaII PspN41
Bst98! MseI Apo!
MspCI Tru91 TspEI Tsp5091
BspT! Mse! BstF51 MnlI Sse91
tetegteaateettaagggttaaggatgtggagaattttgaggaaaetaattateetttgaeggtggttgetatt base pairs
agageagttaggaatteeeaatteetaeaeetettaaaaeteetttgattaataggaaaetgeeaeeaaegataa 1126 to 1200
BfrI TrulI FokI Sse9! TspEI
Vha464! Trul! Aes!
AflII Tru9! Tsp509!
87
BsoFI
CviJI ItaI
MaeIII TfiI BfaI DdeI BstF51
cctaaacaggagttactgattcagttagtctatgatactagccgttttactcaggatacgattgaacggatggca base pairs
ggatttgtcctcaatgactaagtcaatcagatactatgatcggcaaaatgagtcctatgctaacttgcctaccgt 1201 to 1275
HinfI MaeI BstDEI FokI
Fsp4HI
Tru91 Tsp5091
Tru11 MaeIII MaeIII Sse91
gcacatttacagactattttaacagggattgttactgatactcggcaacgggtaacacaattacctatattgaca base pairs
cgtgtaaatgtctgataaaattgtccctaacaatgactatgagccgttgcccattgtgttaatggatataactgt 1276 to 1350
Bst711 MseI TspEI
BbvI
MnlI
BseDI
acacaagagcaacatcagttattagtagagtggaacaataccgaggcagattatcctttagataagtctttacat base pairs
tgtgttctcgttgtagtcaataatcatctcaccttgttatggctccgtctaataggaaatctattcagaaatgta 1351 to 1425
BsaJI
BsoFI BpiI MseI
TSp5091 ItaI TfiI BpuAI Tru11
Sse91 MnlI AluI BbvI AciI MboII TspEI
caattatttgaggaacaagctgcacagaatccgcagggaatagtggttatttttgaagaccaaaaattaacctat base pairs
gttaataaactccttgttcgacgtgtcttaggcgtcccttatcaccaataaaaacttctggtttttaattggata 1426 to 1500
TspEI CviJI BsgI Bbv16I1 Tru91
Fsp4HI HinfI BbsI Tsp5091
Bst711 Sse91
BsaJI SinI AvaIl
Tru91 BsiSI MspR91 Sau961
Tru11 MspI ScrFI AluI TspRI Bme181 HgiEI
caacagttaaataaccggggcaatcagttagctcactgtttacgagataagggtgtaggtccagaaagtttggtc base pairs
gttgtcaatttattggccccgttagtcaatcgagtgacaaatgctctattcccacatccaggtctttcaaaccag 1501 to 1575
MseI HapII NciI CviJI Eco471
BseDI BcnI AsuI AspS91
HpaII Cfr131
Bsh13651 BseDI BcnI Rsa I
Bsc41 BsaBI Tru91 HapII NciI Csp61
BfaI BsiYI Tru11 CviJI HpaII AluI
gggatttttatggagcgttccctagagatggtcatcggtttattagggatattaaaagccgggggagcttatgta base pairs
ccctaaaaatacctcgcaagggatctctaccagtagccaaataatccctataattttcggccccctcgaatacat 1576 to 1650
MaeI BslI Bse81 MseI MspI ScrFI CviJI
BsrBRI BsiSI MspR91 AfaI
MamI BsaJI MwoI
XhoII MflI BseAI Kpn21 TfiI AsuI Bse11 BsuRI
MboI NdeII Bsp131 HapII HinfI BslI BsrI BsrSI Pall
Kzo91 DpnII BsiMI MspI AlwI MboII BsiYI BseNI HaeIII
cctttagatccggagaatctttaggggattttcttccccaaactggggccgagttactgtgtttagatagggatt base pairs
ggaaatctaggcctcttagaaatcccctaaaagaaggggtttgaccccggctcaatgacacaaatctatccctaa 1651 to 1725
BstX21 BstYI BspEI HpaII Bsc41 AspS91 CviJI
Bsp1431 MroI AccIII AclWI Sau961 NlaIV MaeIII
Sau3AI DpnI BsaWI BsiSI Cfr131 PspN41
AcsI
SfcI DdeI Tsp5091
AluI BstSFI HinfI Sse91 CviJI
gggaaaagatagctacctatagcccagaaaatcccttcaatctaacgactcctgagaatttagcctatgttattt base pairs
cccttttctatcgatggatatcgggtcttttagggaagttagattgctgaggactcttaaatcggatacaataaa 1726 to 1800
CviJI CviJI PleI TspEI
BstDEI
ApoI
88
Mse! TspE! Tsp509! Tsp509!
Trul! CviJ! Acs! Mse!
Vsp! Asn! Sse9! Sse9!
atacatcaggttcaacgggaaaacccaaaggagtattaattagccatcgggggtttatgaatttaatttgttggc base pairs
tatgtagtccaagttgcccttttgggtttcctcataattaatcggtagcccccaaatacttaaattaaacaaccg 1801 to 1875
PshB! Tsp509! TspE! TspE!
Ase! Sse9! Apo! Tru9!
Tru9! Trul!
Bst7l!
Tsp509! Tsp509I Mwo! Fsp4H!
SfaN! Hga! Sse9! Sse9! Bfal Tfi! Ita! AciI
atcaagacgcttttgaaattacgcctttagacaaaattactcaactagcaagaatcgcttttgacgctgcggttt base pairs
tagttctgcgaaaactttaatgcggaaatctgttttaatgagttgatcgttcttagcgaaaactgcgacgccaaa 1876 to 1950
TspE! TspEl Mae! Hinf! Hga!
BsoFl
Bbv!
Hae!!! Tru9!
Cfr13! Trul! Msel
Sau96l Pal! BspM! Ple! Ddel Trul! Nla!!!
gggagttatggccctgtttaacagcaggtgcgagtcttgtcttagttaaacctgaaatcatgcaatctcccccag base pairs
ccctcaataccgggacaaattgtcgtccacgctcagaacagaatcaatttggactttagtacgttagagggggtc 1951 to 2025
Asu! BsuR! Hinf! BstDE! Hsp92!!
AspS9! Mse! Tru9l
CviJ!
Bsel! TspE!
Bsr! Tru9!
BsmA! Trul! Hph! Alul
acttgcgagactggttaattgccaagaaatcaccgtcagctttttaccaactc base pairs
tgaacgctctgaccaattaacggttctttagtggcagtcgaaaaatggttgag 2026 to 2078
Alw26! Mse! CviJ!
BseN! Sse9!
BsrS! Tsp509l
(b) UV027
UV027
2169 base pairs
Graphic map
Bsl!
HSp92!!
Aci! BstX! Ple! Mnl! Bsc4l
atggcagacacaaaaaatcaacccgccaaaaatgtggagtctatttatcctctttcccccatgcaggaagggatg base pairs
taccgtctgtgttttttagttgggcggtttttacacctcagataaataggagaaagggggtacgtccttccctac 1 to 75
Fau! Hinfl Nla!ll
Bsiy!
BsiYl Msel
SfaN! EcoN! TSp509l Mnl! Trull
BstF5! Tfil Sse9l Gsu! Sse9l
ctctttcatagtctttatactcctgattcagggatttattgtagtcaaactctaattactctggagggagaaatt base pairs
gagaaagtatcagaaatatgaggactaagtccctaaataacatcagtttgagattaatgagacctccctctttaa 76 to 150
Fok! Hinf! TspEI BpmI TspE!
Bsc4! Tsp5
BsII Tru9!
Hgal Tru9!
Cac8! Mae!!! Trul! Plel
aaccttgcagtttttaggcaagcgtgggaaaaggttgtagagcgtcactcggtattaaggactctatttctttgg base pairs
ttggaacgtcaaaaatccgttcgcacccttttccaacatctcgcagtgagccataattcctgagataaagaaacc 151 to 225
Tsp45! Msel Hinf!09!
89
MvaI AspLEI
Tsp509I BsaJI Bst2UI Hin61
Sse91 EcoRIl BstOI HinPlI
gaaaaacgggaaaaaaccttgcaaattgtgcgaaaaaaggttgatttgccctgggattatcaggattggcgcaat base pairs
ctttttgcccttttttggaacgtttaacacgcttttttccaactaaacgggaccctaatagtcctaacegcgtta 226 to 300
TspEI BseOI MspR91 HspAI
MwoI ScrFI CfoI
BstNI HhaI
ApOI
HincIl TspEI
MaeIII HindIl EeoRI
ctttcccccacagaacaaeaacagcgtttagatttattgttacaaacagagcgtcaacaagggtttgaattcaaa base pairs
gaaagggggtgtcttgttgttgtcgcaaatetaaataacaatgtttgtctcgcagttgttcccaaacttaagttt 301 to 375
HgaI Sse91
AcsI
Tsp509I
Hin61 Fsp4HI SinI AvaIl Tsp5091
Tru91 AspLEI TfiI Sau961 AcsI
TrulI CfoI BsoFI Bme181 HgiEI Sse91 MnlI
gttgctcctttaatgcgctgcttgatgattcaactatcggaccaaacttataaattcctctgcaatcatcatcat base pairs
caaegaggaaattacgcgacgaactactaagttgatagcctggtttgaatatttaaggagacgttagtagtagta 376 to 450
MseI HinP1I Bst7l1 Eco471 TspEI
HspAI ItaI HinfI AsuI AspS91 ApoI
HhaI BbvI Cfr131
BstF51 MnlI BspMI
attattctggatggttggagtatgeetattatttatcaagaagttttagggttttatgaggcaggtatteaaggg base pairs
taataagacctaccaacctcatacggataataaatagttcttcaaaatcccaaaatactccgtccataagttecc 451 to 525
FokI
ThaI HgaI BbvI
BsoFI Bsh12361 BsoFI
MboIIItal MvnI MaeIII ItaI
aaaagttatcatctteetttgccgegtccttatcaagattatattgtttggttacagcagcaaaacccatctatt base pairs
ttttcaatagtagaaggaaacggcgcaggaatagttctaatataacaaaccaatgtcgtcgttttgggtagataa 526 to 600
Fsp4HI AciI Fsp4HI
AccII Bst7l1
BstUI
BbvI Hsp92I1 Tsp5091
BsoFI BsiYI Sse91
Ode I ItaI HinfI MslI NlaIII HinfI vspI
getgagagtttttggcagcgaactcttgaagggtttatgactcccacccccatgagggtggacagactccaatta base pairs
cgactctcaaaaaccgtcgcttgagaacttcccaaatactgagggtgggggtactcccacetgtctgaggttaat 601 to 675
BstOEI Fsp4HI PleI Bsc41 BstXI PleI TrulI
Bst7l1 BslI TspEI
MnlI PshBI
AsnI Bsp1431 OpnI
AseI BglIl OpnII
Tru91 Eeo571 CviJI Kzo91 NdeIl
atgaaatctgaaggtaagccgacttataagagcataactgtcatttatcggcttctcactccaaagatctgcaat base pairs
tactttagacttccattcggetgaatattetegtattgacagtaaatagccgaagagtgaggtttctagacgtta 676 to 750
CviJI BstX21 BstYI
MseI MboI Sau3AI
XhoIl MflI
ASpLEI RsaI ItaI BglI
Hin61 Csp61 BsuRI MwoI BstOEI
HinP1I BfaI HaeIII TfiI MboIl BstSFI
ctttggcgcaaaagcataatctgaccttatctactctagtacaggccgcttgggcgattcttctcagtcgctata base pairs
gaaaccgcgttttcgtattagactggaatagatgagatcatgtccggcgaacccgctaagaagagtcagcgatat 751 to 825
HspAI MaeI CviJI AciI HinfI Ode I SfcI
CfoI AfaI Pall BsoFI
HhaI Fsp4HI
90
HinfI MaeIII NlaIII
gtggggagteagaaggtttatttggggttaeggtttetggtcgcccccatgatttatcgggggtagaacataggg base pairs
caeeeeteagtcttccaaataaaccecaatgccaaagaceagcgggggtaetaaatagcccccatettgtatccc 826 to 900
PleI Hsp92I1
MseI NspBII
Tru11 BsoFI Bst711 Alw261
vspI AsnI ItaI AeiI PleI TfiI MaeIII
taggattatttattaataeattgccgetgegagtctccatcagagaatcagatttattgctatcttggttacagg base pairs
atcctaataaataattatgtaaeggcgaegctcagaggtagtctcttagtctaaataacgatagaaccaatgtce 901 to 975
PshBI Fsp4HI HinfI BsmAI HinfI
AseI BsrDI BbvI
Tru91 MspA11
TSp5091
TSp5091 AcsI Tru91
Sse91 Cae81 Sse91 CviJI Tru11
aattacageaaaggcaageagaaattcaggattatgcttatgtttctctggctgaaatacagagattaagtgata base pairs
ttaatgtcgtttecgttcgtctttaagtcctaatacgaatacaaagagaccgactttatgtctctaattcactat 976 to 1050
TspEI TspEI MseI
ApoI
BsaJI NlaIV BssT11 MaeI
BsiSI MspR91 Tsp5091 ErhI EeoT141 HinfI
MspI SerFI Sse91 Eco1301 TthHB81
ttccaeegggggttcccctgtttgagagtttggtegtttttgagaattatcctagggaagcgttatcgagagatt base pairs
aaggtggeeeceaaggggacaaaetcteaaaccagcaaaaaetettaataggatcccttegcaatagctctctaa 1051 to 1125
HapII Neil TspEI BlnI BseDI TaqI TfiI
BseDI Ben I Styl BsaJI
HpaII PspN41 AvrII BfaI
Bst981 MseI ApoI
MspCI Tru91 TspEI Tsp5091
BspTI MseI BstF51 MnlI Sse91
ctegteaatecttaagggttaaggatgtggagaattttgaggaaactaattatcctttgacggtggttgctattc base pairs
gagcagttaggaattcccaattcctacacctcttaaaactcctttgattaataggaaactgccaccaacgataag 1126 to 1200
BfrI Tru11 FokI Sse91 TspEI
Vha4641 Tru11 AcsI
AflII Tru91 Tsp5091
CviJI
BfaI MaeIII TfiI BfaI DdeI BstF51
ctagaeaagagttactgattcagataatctatgatactagccgttttactcaggatacgattgaacggatggcag base pairs
gatctgttctcaatgactaagtctattagatactatgatcggcaaaatgagtcctatgctaacttgcctaccgtc 1201 to 1275
MaeI HinfI MaeI BstDEI FokI
Sau3AI AlwI
Tru91 Tsp5091 Bsp1431 MnlI Tsp5091
Tru11 Sse91 Kzo91 BseDI MaeIII Sse91
gaeatttacagaetattttaacaggaattgttactgatcctcggcaacgggtaaeacaattacetatattgacaa base pairs
etgtaaatgtctgataaaattgtecttaacaatgaetaggagccgttgceeattgtgttaatggatataactgtt 1276 to 1350
MseI TspEI MboI DpnI TspEI
MaeIII DpnII AclWI
NdeII BsaJI
MnlI
cacaagageaaeatcagttattagtagagtggaacaatagggaggctgattatcctttagataagtctttacatc base pairs
gtgttctcgttgtagtcaataatcatcteaccttgttatccctccgactaataggaaatctattcagaaatgtag 1351 to 1425
CviJI
BsoFI BpiI MseI
Tsp5091 CviJI TfiI BpuAI TrulI
Sse91 MboII ItaI BsgI AciI MboII TspEI
aattatttgaagaacaagctgcacagaatccgcagggaatagtggttatttttgaagaccaaaaattaacctatc base pairs
ttaataaaettcttgttcgacgtgtcttaggcgtcccttatcaccaataaaaacttctggtttttaattggatag 1426 to 1500
TspEI AluI BbvI Bbv16I1 Tru91
Fsp4HI HinfI BbsI Tsp5091
Bst711 Sse91
91
BsaJI
Tru91 BsiSI MspR91 MaeI
TrulI MspI SerF I AluI TspRI XbaI
aaeagttaaataaeeggggeaateagttageteaetgtttaegagataagggtgtaggtetagaaagtttggteg base pairs
ttgteaatttattggeeeegttagteaategagtgaeaaatgetetatteeeaeateeagatettteaaaeeage 1501 to 1575
MseI HapII Neil CviJI BfaI
BseOI BenI
HpaII
AfeI HhaI MaeI Bsh13651 BseOI Ben I RsaI
Hin61 AspLEI Bse41 MamI Tru91 HapII Neil Csp61
HinP11 BstH21 BsiYI BsaBI Tru11 CviJI HpaII AluI
ggatttttatggagegeteeetagagatggteateggtttattagggatattaaaageegggggagettatgtae base pairs
eetaaaaataeetegegagggatetetaeeagtageeaaataateeetataatttteggeeeeetegaataeatg 1576 to 1650
HspAI CfoI BfaI BsrBRI MseI MspI SerFI CviJI
Aor51HI HaeII BsII BsisI MspR91 AfaI
Eeo47II1 Bsp143I1 Bse81 BsaJI MwoI
XhoII MflI BseAI Kpn21 HinP11 AspLEI BstOEI HpaI
MboI NdeII Bsp131 HapII HspAI CfoI Bsp143I1 Tru91
Kzo91 OpnII BsiMI MspI AlwI Eeo47II1 Eeo321 HinfI BstF51 TrulI
etttagateeggattateetaeegagegettgggggatateeteteagatteggatgtttetttggtgttaaete base pairs
gaaatetaggeetaataggatggetegegaaeeeeetataggagagtetaageetaeaaagaaaeeaeaattgag 1651 to 1725
BstX21 BstYI BspEI HpaII Aor51HI Hae110del FokI MseI OdeI
Bsp1431 MroI AceIII AelWI AfeI BstH21 MnlI HindII
Sau3AI OpnI BsaWI BsiSI Hin61 HhaI EeoRV TfiI HineII
AsuI Bse11 BsuRI
TfiI BsII BsrI BsrSI Pall
BstOEI MboII BsiYI BseNI HaeIII
aggaatetttaggggattttetteeeeaaaetggggeegagttaetgtgtttagatagggattgggaaaagatag base pairs
teettagaaateeeetaaaagaaggggtttgaeeeeggeteaatgaeaeaaatetateeetaaeeettttetate 1726 to 1800
Bse41 AspS91 CviJI
HinfI Sau961 NlaIV MaeIII
Cfr131 PspN41
AesI
SfeI OdeI Tsp5091
AluI BstSFI HinfI Sse91 CviJI
etaeetatagteeagaaaateeetteaatetaaegaeteetgagaatttageetatgttatttataeateaggtt base pairs
gatggatateaggtettttagggaagttagattgetgaggaetettaaateggataeaataaatatgtagteeaa 1801 to 1875
CviJI PIel TspEI
BstOEI
ApoI
ApOI
MnlI
SSpI Sse91 FauNOI
eaaegggaaaaeeeaaaggegtgatgaatatteatagaggaatttgtaataetetgaeatatgetattggteatt base pairs
gttgeeettttgggttteegeaetaettataagtateteettaaaeattatgagaetgtataegataaeeagtaa 1876 to 1950
TspEI NdeI
AesI
Tsp5091
Sau3AI Mva12691
MboI Eeo571 TspEI
SspI MnlI OpnII BsaMI
ataatattaeetetgaagategeatteteeaaattaetteettgagttttgatgttteagtttgggaagttttet base pairs
tattataatggagaettetagegtaagaggtttaatgaaggaaeteaaaaetaeaaagteaaaeeetteaaaaga 1951 to 2025
Kzo91 MboII Sse91
Bsp1431 BsmI
NdeII OpnI Tsp5091
Tru91 Tru91
TrulI BfaI CviJI Tru11
egtetttaatatetggtgettetetagtegtggetaaaeetgaegggtataaagatatagattatttaatagatt base pairs
geagaaattatagaeeaegaagagateageaeegatttggaetgeeeatatttetatatetaataaattatetaa 2026 to 2100
MseI MaeI MseI
92
TSpEI
Tru9I
Tru1I MaeIII MnlI
taattgtgcaagaacaagtaacttgtttcacttgtgttccctcaatattgcgagtttttctgcaacatc base pairs
attaacacgttcttgttcattgaacaaagtgaacacaagggagttataacgctcaaaaagacgttgtag 2101 to 2169
MseI SspI
Sse9I
Tsp509I
Figure 82. Differences in restriction sites in the sequences from Microcystis aeruginosa
strains PCC7813 (A) and UV027 (8) obtained after analysis using the software
programme Webcutter 2.0 (http://www.firstmarketlcom/cgi-bin/cutter).
93
SUMMARY
There are 150 cyanobacterial genera and approximately 2 000 species known in the world.
More than 40 of these have toxin producing strains. Cyanobacteria, commonly known as
blue-green algae, are often present in small numbers together with a diverse assemblage
of other photosynthetic algae that naturally occur in surface water worldwide. However,
under conditions of warm temperatures, minimal water movement and elevated
concentrations of phosphorus in a water body, cyanobacteria may frequently become
dominant and form thick scums of floating algal cells. These dense aggregations of floating
cells, termed 'blooms', presents a number of water quality problems; most often offensive
odours and tastes, and sometimes biotoxins that can be divided into alkaloid neurotoxins
and cyclic peptide hepatotoxins, commonly from the genus Microcystis and released in
waterbodies. The neurotoxins act chiefly at neuromuscular junctions and cause rapid death
because of respiratory paralysis. The hepatotoxins act on the hepatocyte cytoskeleton and
cause intrahepatic haemorrhage and centrilobular necrosis. Clinically the hepatotoxin most
often causes peracute or acute death, or subacute poisoning with signs such as icterus and
hepatogenous photosensitivity.
Currently cyanobacterial taxonomy does not provide an unequivocal system for the
identification of toxigenic and bloom-forming genus Microcystis. The ambiguities that exist
in the cyanobacterial taxonomy are due to the expressed variability, minor morphological
and developmental characteristics that are used for identification. In this study
geographically unrelated axenic strains of Microcystis aeruginosa were obtained from the
Pasteur Institute, France (PCC); the National Institute for Environmental Studies, Japan
(NIES); the Institute of Freshwater Ecology, UK (CCAP); the Pflanzen Physiologisches
94
Institut, Universitat Gottingen, Germany (SAG) and the University of the Free State, South
Africa (UV) culture collections. Nonaxenic strains were collected from Hartbeespoort,
Rietvlei and Roodeplaat Dams in South Africa. After screening 20 primer combinations on
a subset of strains eight IRDye700™-labeled EcoR1 primer pairs were selected for
amplified fragment length polymorphism (AFLP) analysis to determine the genetic
relationship of these geographically unrelated strains. A total of 909 bands were amplified
from the eight primer combinations, of which 665 were informative, 207 non-informative
and 37 monomorphic, with an average of 83.12 polymorphic bands per primer combination.
The genetic relationship among all the Microcystis aeruginosa strains based on the
combination of data obtained with the eight primer combinations was analysed employing
the Unweighted Pair Group Method using Arithmetic Means (UPGMA) algorithm and
presented as a dendrogram. In the dendrogram, the strains from Rietvlei (UP01) and
Hartbeespoort Dams (UP04) grouped together and were thus genetically closer to each
other, than to the strain from the Rhoodeplaat Dam (UP03). The Japanese strains (NIES88,
NIES89, NIES90, NIES99, NIES299) also grouped separate from the other strains, with
NIES90 and NIES299, genetically closest to each other. Interestingly, Microcystis
aeruginosa strain PC7806 that originated from The Netherlands, also grouped within this
group. Microcystis aeruginosa strains CCAP1450/1 (UK), UV027 (South Africa) and
PC7813 grouped together, and are genetically closer to the UP-strains, than any of the
other strains. In the present study, AFLP analysis proved useful for the identification of
genetic diversity and analysis of population structure within Microcystis aeruginosa.
In order to link the identification of strains with toxicity, the utility of the mcyB gene
sequence for identification of strains was tested. Based on conserved motifs present in
known sequences of mcyB four primer pairs were designed. Using the primer pairs Tax
3P/2M, Tax 1P/1M, Tax 7P/3M and Tax 10P/4M, the mcyB gene from PCC7813 and
95
UV027 were sequenced, resulting in fragments of 2174 and 2170 base pairs in size,
respectively. The obtained sequences were analyzed using nucleotide BLASTN annotation
of the Basic Local Alignment Search Tool (BLAST). The sequence alignment indicated
high homology to other published sequences in GenBank (AY034601 for pee7813 and
AY034602 for UV027; e-value = 0.0). Upon further analysis of the sequences it was
obvious that there are several base differences between the sequences of the two strains,
which led us to investigate the potential of using differences in restriction sites, and thus
insertions/deletions (indeis) in nucleotide sequence to discriminate between the other M.
aeruginosa strains, as well as using the mcyB gene to discern between M. aeruginosa and
M. wesenbergii in raw water samples. A vast number of restriction sites were identified
with differences followed by restriction digest of the specific polymerase chain reaction
(peR) mcyB gene fragment. This work demonstrates that peR assays provide a useful
indicator of toxicity as well as the identification of taxonomical characteristics between
laboratory cultures and environmental isolates.
A number of questions arise from the present study and future research therfor
needs to address the following issues:
• Are there more than one Microeystis aeruginosa strain / "population" present at a
given time in a specific water reservoir? Do these populations change through the
season? What role does the individual populations play in a cyanobacterial bloom?
Thus, the dynamics and structure of populations need to be clarified.
• Which mey gene in the cluster is mostly responsible for toxin production? Does the
expression of the genes correlate with gene structure/sequence? What role does
the environment play in determining the level of expression, and thus toxin
production?
96
OPSOMMING
Daar is tans 150 sianobakteriëe genera en ongeveer 2 000 spesies in die wêreld bekend,
waarvan 40 toksiene produseer. Sianobakteriëe staan algemeen bekend as blou-groen
alge en kom in klein hoeveelhede saam met ander fotosinterende algspesies in
oppervlakwaters reg oor die wêreld voor. Wanneer omgewingstoestande ideal vir
sianobakteriëe is, bv. warm temperature, minimum waterbeweging en hoë konsentrasies
I voedingstowwe kan dit lei tot die dominansie van die spesie in eutrofiese waterliggame. As
gevolg van die hoë konsentrasie van groeperende selle ontstaan In sianobaktriese opbloei,
wat waterkwaliteit en waterbestuur bemoeilik deurdat dit slegte smake en reuke aan die
water gee. In sommige gevalle kan die ontbindende sianobakterie-selle biologiese toksiene
in die vorm van neurotoksiene en hepatotoksiene in die water vrystel. Hierdie toksiene
word algemeen met die genus Microcystis geassosieer.
Die huidiglike sianobakteriële taksonomie voldoen nie aan die behoeftes vir die
klassifikasies van die genera Microcystis nie, aangesien dit gefundeer is op ontwikkeling en
morfologiese eienskappe soos selgrootte, vorm, dryfbaarheid deur gasvakuole en
toksisiteit. Geografiese onverwante suiwer enkel laboratorium kultuurstamme van
Microcystis aeruginosa is bekom vanaf die Pasteur Instituut, Frankryk (PCC), die National
Institute for Environmental Studies, Japan (NIES); die Institute for Freshwater Ecology,
Verenigde Koninkryk (CCAP); die Pflanzen Physiologisches Institut, Universitat Gottingen,
Duitsland (SAG) en die Universiteit van die Vrystaat, Suid-Afrika (UV) kultuurversamelinge.
Natuurlike sianobakteriese monsters is versamel in die Rietvlei-, Hartbeespoort- en
Roodeplaatdamme. Na die sifting van 20 inleier-kombinasies op In kleiner groep stamme is
agt IRDye700™-gemerkte EcoR1 inleier-pare gekies vir geamplifiseerde fragment lengte
polimorfisme (AFLP)-analise om die genetiese verwantskap tussen die geografies
97
onverwante stamme te bepaal. 'n Totaal van 909 bande is geamplifiseer deur die agt inleier
kombinasies, waarvan 665 beduidende inligting bevat het, 207 onbeduidend en 37
monomorfies was, met 'n gemiddeld van 83.12 polimorfiese bande per inleier-kombinasie.
Die genetiese verwantskap tussen al die Microcystis aeruginosa-stamme gebasseer op die
kombinasie van inligting is geanaliseer deur gebruik te maak van die "Unweighted Pair
Group Method using Arithmetic Means (UPGMA)"-algoritme en is voorgestel in 'n
dendrogram. In die dendrogram, het die drie stamme afkomstig van Rietvlei- (UP01) en
Hartbeespoortdamme (UP04) saam gegroepeer, en is dus geneties nader aan mekaar as
aan die stam afkomstig van die Rhoodeplaatdam (UP03). Die Japanese stamme (NIES88,
NIES89, NIES90, NIES99, NIES299) het apart van die ander stamme gegroepeer, met
NIES90 en NIES299, geneties die naaste aan mekaar. Interessant, is dat Microcystis
aeruginosa stam PC7806 wat van Nederland afkomstig IS, ook in die groep gegroepeer is.
Microcystis aeruginosa-stamme CCAP1450/1 (VK), UV027 (Suid-Afrika) en PC7813 het
saamgroepeer, en is geneties die naaste verwant aan die UP-stamme. Uit die huidige
studie het dit geblyk dat AFLP-analise bruikbaar is in die identifikasie van die genetiese
diversiteit en analiese van die populasiestruktuur van Microcystis aeruginosa.
Om die identifikasie van die stamme met toksisiteit in verband te bring is die bruikbaarheid
van die mcyB-geen se basisvolgorde vir die identifikasie van stamme getoets. Gebasseer
op die gekonserveerde motiewe teenwoordig in bekende basisvolgordes van mcyB is vier
inleier-pare ontwerp. Deur gebruik te maak van inleier- pare Tox 3P/2M, Tox 1P/1M, Tox
7P/3M en Tox 10P/4M, is die basisvolgordes van die mcyB-gene vanaf PCC7813 en
UV027 bepaal en fragmentlengtes van 2174 en 2170 basispare in lengte is respektiewelik
verkry. Die bepaalde basisvolgordes is geanaliseer deur middel van die nukleotied
BLASTN-annotasie van die Basic Local Alignment Search Tool (BLAST). Die
basisvolgorde afparing het groot ooreenkomste met ander gepubliseerde basisvolgordes in
98
GenBank (AY034601 vir PCC7813 en AY034602 vir UV027; e-waarde = 0.0) vertoon. Na
verdere analiese van die basisvolgordes het dit geblyk dat daar verskeie nukleotied
verskille tussen die twee stamme se basisvolgordes teenwoordig is. Dit het daartoe
aanleiding gegee dat die potensiaal vir die gebruik van die basisvolgorde van meyB-geen
om tussen die ander M. aeruginosa stamme, so wel as tussen M. aeruginosa en M.
wesenbergii te onderskei, ondersoek is. Polimerase kettingreaksie (PKR)-analise met
verskeie inleier-pare het getoon dat meyB-geen in M. aeruginosa teenwoordig en
waarskynlik in die M. wesenbergii-isolaat afwesig is. 'n Groot aantal beperkingsnypunt-
verskille is geïdentifiseer, met verskille na beperkingsnyding van die spesifieke meyB-geen-
PKR-fragment. Die studie demonstreer dat PKR-metodes 'n bruikbare indikator van
toksisiteit, sowel as 'n identifikasie-karakter tussen laboratorium en natuurlike stamme kan
voorsien.
'n Aantal vrae het uit die studie na vore gekom, en die vrae behoort in toekomstige
navorsing aangespreuk te word. Die vrae sluit die volgende in:
• Is daar meer as een Mieroeystis aeruginosa-stam I "populasie" op 'n bepaalde
tyd in 'n water opgaardam teenwoordig? Verander hierdie populasies gedurende
die seisoen? Watter bydrae maak die individuele populasies tot opbloeie? Met
ander woorde vrae oor die dinamieka en struktuur van populasies moet
beantwoord word.
• Watter een van die mey gene in die geenkompleks is meestal vir
toksienproduksie verantwoordelik? Bestaan daar enige verband tussen
geenuiting en geenstruktuur/basisvolgorde? Het omgewingsfaktore enige
bepalende rol in die vlakke van geenuiting, and dus toksienproduksie?
. UV .. UfS -,
BlOErlrlFO~.gTE~N l
~,:!~TE~.:_I~~RYJ 99