Genetic analysis of human papillomavirus type 11 
isolates from patients with recurrent respiratory 
papillomatosis treated at Universitas Academic 
Hospital 
 
Corne Thuynsma 
 
July 2021  
 
Genetic analysis of human papillomavirus type 11 isolates 
from patients with recurrent respiratory papillomatosis 
treated at Universitas Academic Hospital 
 
by 
 
Corne Thuynsma 
2014035048 
 
Submitted in fulfilment of the requirements for the degree 
 
Magister Medical Scientiae (Medical Virology) 
 
in the Division of Virology 
in the Faculty of Health Sciences 
at the University of the Free State 
 
 
Supervisor: Prof. Felicity Jane Burt, Division of Virology, Faculty of Health Sciences, 
University of the Free State 
Co-Supervisor: Prof. Riaz Seedat, Department of Otorhinolaryngology, Faculty of the Health 
Sciences, University of the Free State 
 
2021 
Bloemfontein 
South Africa 
  
i 
 
Declaration  
 
“I, Corne Thuynsma, declare that the Master’s Degree research dissertation or interrelated, publishable 
manuscripts/published articles, or coursework Master’s Degree mini-dissertation that I herewith submit 
for the Master’s Degree qualification in Medical Virology at the University of the Free State is my 
independent work, and that I have not previously submitted it for a qualification at another institution 
of higher education.” 
 
 
 
 
Signature:       Date:       30 July 2021  
 
  
ii 
 
Acknowledgements  
First and foremost, I would like to give my special regards to Prof. Felicity Burt. She offered invaluable 
advice and constant support during my M.Med.Sc study. Her immense knowledge and experience have 
encouraged me in my academic research and daily life. I wish to show my gratitude to Prof Riaz Seedat 
for his insightful comments and suggestions on my dissertation. I would also like to thank Armand for 
his support on the technical part of my study. You all provided invaluable assistance during my research. 
My gratitude extends to the Poliomyelitis Research Foundation for the funding opportunity to undertake 
my studies at the Division of Virology, University of the Free State. 
I wish to acknowledge the support and great love of my family and friends. To my laboratory mates– 
Gerdus, Micah, and Nina, I treasure the time spent together in the laboratory and the office. Coffee 
breaks with them have made my study and life in the Bloemfontein wonderful. 
I want to express my gratitude to my family and loved ones for giving me all the wonderful opportunities 
that have made me who I am and helped me flourish. I am so lucky to have a family that fills my heart 
with strength, joy, and love. Without their tremendous encouragement, it would have been impossible 
for me to complete my studies. 
Scientific research is one of the most exciting and rewarding of occupations – Frederick Sanger 
  
iii 
 
Table of Contents 
List of figures viii 
List of tables ix 
List of abbreviations xi 
Abstract xv 
CHAPTER 1 - Literature review 1 
1.1. Background 1 
1.2. Discovery of human papillomavirus 2 
1.3. Human papillomavirus genome and proteins 4 
1.3.1. The early region 4 
1.3.2. The late region 8 
1.3.3. Upper regulatory region 8 
1.4. Classification and taxonomy of human papillomavirus 9 
1.5. Life cycle of human papillomavirus 10 
1.6. Transmission of human papillomavirus 12 
1.7. Epidemiology of human papillomavirus type 11 in South Africa 13 
1.8. Human papillomavirus pathogenicity 14 
1.9. Host immune response to human papillomavirus 15 
1.10. Recurrent respiratory papillomatosis 16 
1.10.1. Risk factors associated with the development of recurrent respiratory papillomatosis 17 
1.10.2. Diagnosis of recurrent respiratory papillomatosis 18 
1.10.3. Treatment of recurrent respiratory papillomatosis 18 
1.11. Prophylactic vaccines against human papillomavirus 19 
1.12. Detection of human papillomavirus infections 21 
1.12.1. Nucleic acid hybridisation assays 21 
1.12.2. Signal amplification assays 21 
1.12.3. Nucleic acid amplification assays 21 
1.12.4. Genotyping 22 
1.13. Phylogenetic analysis of human papillomavirus isolates 23 
1.13.1. Sequence evolution 23 
1.13.2. Multiple sequence alignment 24 
1.13.3. Phylogenetic trees 24 
1.13.4. Types of phylogenetic methods 24 
1.14. Problem statement 25 
iv 
 
1.15. Aims and objectives 25 
CHAPTER 2- Phylogenetic analysis of human papillomavirus type 11 isolates 27 
2.1. Introduction 27 
2.2. Materials and methods 29 
2.2.1 Study samples 29 
2.2.2 Study setting and population 29 
2.2.3 Amplification of five human papillomavirus genomic regions 29 
2.2.4 Agarose gel electrophoresis 31 
2.2.5 Purification of PCR product 32 
2.2.6 Determination of DNA concentration 33 
2.2.7 Sequencing 33 
2.2.8 Data analysis 35 
Analysis of nucleotide variation 35 
Degree of divergence 35 
Analysis of amino acid variation 36 
Phylogenetic analysis 36 
2.2.9 Ethical considerations 36 
2.3. Results 37 
2.3.1 Patient data 37 
2.3.2 L1 ORF amplification and sequencing 37 
2.3.3 URR amplification and sequencing 40 
2.3.1 E5a/b ORF amplification and sequencing 42 
2.3.2 E2 ORF amplification and sequencing 44 
2.3.3 Analysis of amino acid variations 44 
Analysis of L1 ORF sequences 44 
Analysis of E5a/b ORF sequences 46 
2.3.4 Phylogenetic analysis 46 
Maximum Likelihood method 47 
Pairwise analysis of percentage divergence of nucleotides 49 
Analysis of E2 segment as representative of whole genome variation 51 
2.4. Discussion 55 
CHAPTER 3- Characterisation of novel human papillomavirus type 11 isolates 61 
3.1. Introduction 61 
3.2. Materials and methods 62 
v 
 
3.2.1. Study samples 62 
3.2.2. Full‐genome amplification and sequencing 63 
3.2.3. Agarose gel electrophoresis 65 
3.2.4. Purification of PCR product 65 
3.2.5. Determination of DNA concentration 65 
3.2.6. MiSeq library preparation and sequencing 65 
3.2.7. Next-generation sequencing data analysis 66 
Analysis of nucleotide and amino acid variation 66 
Percentage variation in coding regions 66 
Degree of divergence 66 
Maximum likelihood method 67 
3.3. Results 67 
3.3.1. Selection of isolates for whole genome sequencing 67 
3.3.2. Nucleotide and amino acid variances across the human papillomavirus type 11 genome 69 
3.3.3. Pairwise nucleotide difference between complete human papillomavirus type 11 genomes 72 
3.3.4. Maximum Likelihood method 73 
3.3.5. Genome heterogeneities with respect to the corresponding prototype 73 
3.4. Discussion 76 
Chapter 4 - Concluding remarks 78 
References 82 
Appendices I 
Appendix 1: Human papillomavirus type 11 positive patient sample information I 
Appendix 2: Human papillomavirus type 11 isolates retrieved from GenBank and accession 
numbers IV 
Appendix 3: Health Sciences Research Ethics Committee approval document VI 
Appendix 4: Design of E2 segment primers VII 
Appendix 5: Specificity of E2 segment primers VIII 
Appendix 6: 1x TAE preparation IX 
Appendix 7: Agarose gel preparation IX 
Appendix 8: GelRed stain preparation IX 
Appendix 9: Amino acid codon chart X 
vi 
 
Appendix 10: Pairwise analysis of percentage divergence of nucleotides using the human 
papillomavirus type 11 concatenated E5a/b-L1-URR data set XI 
Appendix 11: Pairwise analysis of percentage divergence of nucleotides using the 208bp 
human papillomavirus type 11 E2 segment data set XV 
Appendix 12: Pairwise analysis of percentage divergence of nucleotides using the human 
papillomavirus type 11 complete genomes XX 
 
  
vii 
 
List of figures 
Figure 1: Genome organisation of a low-risk human papillomavirus type 11 (HPV11). 5 
Figure 2: Schematic drawing of human papillomavirus type 11 (HPV11) replication initiation 
mechanisms. 7 
Figure 3: Human papillomavirus (HPV) replication in epithelial cells. 12 
Figure 4: Phylogenetic tree of human papillomavirus type 11 (HPV11) based on alignment of 96 
nucleotide sequences of HPV11 concatenated L1-URR. This analysis involves 68 isolates sequenced in 
this study and 28 sequences of geographically distinct isolates retrieved from GenBank. 48 
Figure 5: Phylogenetic tree of Human papillomavirus type 11 (HPV11) based on alignment of 95 
nucleotide sequences of HPV11 concatenated E5a/b-L1-URR. This analysis involves 67 isolates 
sequenced in this study and 28 sequences of geographically distinct isolates retrieved from GenBank.
 50 
Figure 6: Phylogenetic tree of Human papillomavirus type 11 (HPV11) based on 95 nucleotide 
sequence alignments of HPV11 E2 segment. This analysis involves 67 isolates sequenced in this study 
and 28 sequences of geographically distinct isolates retrieved from GenBank. 53 
Figure 7: Phylogenetic tree of Human papillomavirus type 11 (HPV11) based on 95 nucleotide 
sequence alignments of HPV11 E2 segment. This analysis involves 67 isolates sequenced in this study 
and 28 sequences of geographically distinct isolates retrieved from GenBank. 54 
Figure 8: Genome organisation of a low-risk human papillomavirus type 11 (HPV11). 64 
Figure 9: Phylogenetic tree of human papillomavirus type 11 (HPV11) based 32 nucleotide sequence 
alignments of HPV11 including four isolates sequenced in this study and 28 sequences of 
geographically distinct isolates retrieved from GenBank. 75 
 
  
viii 
 
List of tables 
Table 1: List of primers used for sequencing the L1, E5a/b, upper regulatory region (URR) and a 
segment of the E2 of human papillomavirus type 11 (HPV11) modified from Maver et al., 2011. 31 
Table 2: Polymerase chain reaction (PCR) components for amplifying human papillomavirus type 11 
(HPV11) L1 gene, E5a/b gene, and upper regulatory region (URR). 32 
Table 3: List of primers used for sequencing the L1 gene of human papillomavirus type 11 (HPV11) 
from Maver et al., 2011. 33 
Table 4: Sequencing reaction components for nucleotide determination of human papillomavirus type 
11 (HPV11) isolates. 34 
Table 5: Quantitative estimation of DNA concentration revealed by Nanodrop spectrophotometer of 
human papillomavirus type 11 (HPV11) genomic regions including late region L1, upper regulatory 
region (URR), early region E5a/b and a segment of early region E2. 38 
Table 6: Sequence comparison of nucleotide variances among 72 human papillomavirus type 11 
(HPV11) isolates L1 region against the HPV11 prototype with GenBank accession number M14119.1.
 39 
Table 7: Sequence comparison of nucleotide 68 among various human papillomavirus type 11 (HPV11) 
isolates upper regulatory region (URR) against the HPV11 prototype with GenBank accession number 
M14119.1. 41 
Table 8: Sequence comparison of nucleotide variances among 67 human papillomavirus type 11 
(HPV11) isolates E5a/b region against the HPV11 prototype with GenBank accession number 
M14119.1. 43 
Table 9: Sequence comparison of nucleotide variances among 67 human papillomavirus type 11 
(HPV11) isolates E2 segment against the HPV11 prototype with GenBank accession number 
M14119.1. 45 
Table 10: GenBank accession numbers of human papillomavirus type 11 (HPV11) isolates and the 
(sub)lineage representation. 47 
Table 11: List of primers used for sequencing full-length human papillomavirus type 11 (HPV11) 
genome in two overlapping fragments. 63 
ix 
 
Table 12: Polymerase chain reaction (PCR) components for amplifying human papillomavirus type 11 
full-length genome in two overlapping fragments (E1 to L1 genes; L1 to E1 genes). 64 
Table 13: Patient information. 68 
Table 14: Next-generation sequencing assembly report for four complete human papillomavirus type 
11 (HPV11) mapped to the A1 prototype M14119.1 using Geneious Prime software 
(https://www.geneious.com). 68 
Table 15: The lengths of the complete human papillomavirus type 11 (HPV11) consensus sequence, 
the CG content and the pairwise identity of four HPV11 isolates mapped to the A1 prototype M14119.1 
using Geneious Prime software (https://www.geneious.com). 68 
Table 16: Sequence comparison of nucleotide variances among four human papillomavirus type 11 
(HPV11) isolates against the HPV11 prototype with GenBank accession number M14119.1. 70 
Table 17: Comparison of amino acid variances among four human papillomavirus type 11 (HPV11) 
isolates against the HPV11 prototype with GenBank accession number M14119.1. 71 
Table 18: Estimates of evolutionary divergence between four human papillomavirus type 11 (HPV11) 
sequences using MEGA X software. 72 
Table 19: Genomic variations between human papillomavirus type 11 (HPV11) lineage B isolates 
VBD28/14 sequenced in this study and lineage B prototype LN833183.1 retrieved from GenBank. 73 
Table 20: Genomic variations between human papillomavirus type 11 (HPV11) sub-lineage A2 isolates 
sequenced in this study and sub-lineage A2 prototype LN833161.1 retrieved from GenBank. 74 
 
  
x 
 
List of abbreviations 
A Alanine 
AE Early polyA signal 
AIDS Acquired immunodeficiency syndrome 
ATP Adenosine triphosphate 
BLAST Basic Local Alignment Search Tool 
bp Base pair(s) 
CANSA Cancer Association of South Africa 
CD Cluster of differentiation  
CDK2 Cyclin-dependent kinase 2 
D Aspartic acid 
DBD Deoxyribonucleic acid binding domain 
DC Dendritic cells 
ddNTPs Dideoxynucleotides triphosphates 
DNA Deoxyribonucleic acid 
ds Double-stranded 
E Glutamic acid 
E2F E2 factor 
E6AP E6-associated protein 
EDTA Ethylenediaminetetraacetic acid 
F Phenylalanine 
FTR Formylmethanofuran-tetrahydromethanopterin formyltransferase 
xi 
 
G Glysine 
G1-phase Growth-1-phase 
G2-phase Growth-2-phase 
H  Hinge region 
hc2 Hybrid Capture®2 
HD Helicase domain 
HIV Human immunodeficiency virus 
HPV(s) Human papillomavirus(es) 
HR High-risk 
HSPGs Heparin sulphate proteoglycans 
I Isoleucine 
ICTV International Committee on Taxonomy of Viruses 
IgG Immunoglobulin-G 
K Lysine 
L Leucine 
LCR Long control region 
LR Low-risk 
MCHA Microplate colorimetric hybridisation assay 
MEGA Molecular Evolutionary Genetics Analysis 
MHC Major histocompatibility complex 
M-phase Mitosis-phase 
MUM1+ Multiple myeloma oncogene-1 
xii 
 
N Asparagine 
NCR Non-coding region  
NGS Next generation sequencing 
OBD Origin binding domain 
ORF(s) Open reading frame(s) 
P Proline 
p53  Tumour protein 53 
PCR Polymerase chain reaction 
pRB Retinoblastoma protein 
Q Glutamine 
R Arginine 
rcf Relative centrifugal force 
RFLP Restriction-fragment length polymorphism 
RNA Ribonucleic acid 
RRP Recurrent respiratory papillomatosis 
S Serine 
SIN Squamous intraepithelial neoplasia 
SNP(s) Single nucleotide polymorphism(s) 
S-phase Synthesis-phase 
STI Sexually transmitted infection 
T Threonine 
TAD Transactivation domain 
xiii 
 
TAE Tris-Acetic acid- ethylenediaminetetraacetic acid 
Tm Melting temperature 
UFS University of the Free State 
URR Upstream regulatory region 
V Volts 
VLP(s) Virus-like particle(s) 
WGS Whole genome sequencing 
 
  
xiv 
 
Abstract 
Human papillomavirus type 11 (HPV11) is a causative agent of recurrent respiratory papillomatosis 
(RRP), a common benign laryngeal neoplasm that presents mainly in children. The genome comprises 
three regions: the early region (E1, E2, E4, E5a/b, E6 and E7), the late region (L1 and L2), and the 
upper regulatory region (URR). A sequence-based classification system is primarily used to genotype 
HPV. The L1 is used for HPV type discrimination, and in combination with the URR, can be used to 
differentiate between various lineages. However, optimal sub-lineage classification requires whole 
genome sequencing (WGS). A recent study investigating the genomic diversity of globally circulating 
HPV11 isolates identified a novel lineage and two novel sub-lineages. It has been proposed that 
phylogenetic tree topologies using the sequences of concatenated E5a/b- L1-URR genes, a 208bp 
segment of the E2 gene, and the complete genome generates similar tree topologies. Also, there is 
currently no published data on the HPV11 intratypic variants circulating in the Free State region. Hence, 
this study investigated HPV11 intratypic variants circulating in patients with RRP at the Universitas 
Academic Hospital, and aimed to identify novel (sub)lineages through phylogenetic investigations.  
The study population included patients diagnosed with RRP caused by HPV11, and sequence data for 
geographically distinct HPV11 (sub)lineage representatives. The genetic variation of HPV11 isolated 
from patients with RRP was determined by sequencing the E5a/b, L1, URR and a segment of E2 genes. 
Four isolates of interest were selected for whole-genome sequencing and phylogenetically analysed to 
determine the presence of potentially novel isolates.  
Many nucleic heterogeneities and non-synonymous substitutions were identified in isolates 
characterised in this study. Phylogenetic analysis of the concatenated L1-URR and E5a/b-L1-URR 
resolved into lineages A and B; however, sub-lineage classification was unclear. Analysis of the 
complete genome determined the presence of a lineage B isolate and two isolates of interest. 
Comparative analysis of genetic variability determined that the concatenated E5a/b-L1-URR could not 
reliably classify isolates. A segment of the E2 gene could reliably distinguish between all lineages and 
sub-lineages, suggesting that this gene segment contains stable sub-lineage specific single nucleotide 
polymorphisms (SNPs) and may serve in sub-lineage identification. 
In conclusion this study provides the most comprehensive data on the genomic diversity of HPV11 in 
the Free State to date. Results obtained in the current study support WGS for HPV11 classification 
below lineage level as a standard, as it generates more information regarding genetic variants.  
xv 
 
CHAPTER 1 - Literature review 
1.1. Background 
The first papillomavirus was identified in the 1930s (Shope & Hurst, 1933). Since then, recombinant 
deoxyribonucleic acid (DNA) technology and molecular cloning have led to the discovery of multiple 
human papillomaviruses (HPVs) (Boshart et al., 1984; Dürst et al., 1983; Gissmann et al., 1982). 
Papillomaviruses target various host tissues and are responsible for forming benign hyperproliferation 
and malignancies in human and animal hosts. The association with different conditions such as cancer, 
skin warts and laryngeal papillomas has been well-studied (Cornall et al., 2013; Gaylis & Hayden., 
1991; zur Hausen et al., 1975). 
HPVs which target mucosal sites are broadly divided into high-risk (HR)-HPV types, probable HR-
HPV types and low-risk (LR)-HPV types based on oncogenic potential (zur Hausen, 2002). HPV6 and 
HPV11 are LR-HPV types responsible for genital wart formation and development of papillomas in the 
respiratory tract, commonly referred to as recurrent respiratory papillomatosis (RRP) (Kardani & 
Bolhassani, 2018b). This disease is characterised by recurrent papillomas forming in the respiratory 
tract, most commonly the larynx and may cause significant morbidity and possible mortality due to 
airway obstruction, especially in younger children (Seedat, 2020; Seedat et al., 2013; Swain et al., 
2020).  
HPVs form part of the Papillomaviridae family and are non-enveloped, double-stranded (ds) 
deoxynucleic acid (DNA) viruses containing a small genome of around 8000 base pairs (bp) (Crawford, 
1965; Klug & Finch, 1965). The virus genome comprises three regions, which include the early region 
(E1-E7 genes) and the late region (L1 and L2 genes) that encode proteins, and the upstream regulatory 
region (URR), also recognised as the long control region (LCR) (Kardani & Bolhassani, 2018a). 
A classification and nomenclature system for the Alphapapillomaviruses was established in 2011 by 
Burk and colleagues. Papillomavirus classification largely relies on phylogenetic analysis, genome 
organisation properties, virulence factors and the host tissue the virus affects. A DNA sequence-based 
classification system is primarily used to differentiate and genotype HPV (Burk et al., 2011). The L1 
open reading frame (ORF) is generally used for HPV type discrimination, and in combination with the 
URR, can be used to differentiate between various lineages. However, optimal sub-lineage 
classification requires sequencing additional gene segments (Burk et al., 2011). A novel HPV type 
identifies as having over 10% variance to any other HPV type. Nucleotide differences in the complete 
genome of 1% to 10% and 0.5% to 1% identify variant lineages and sub-lineages, respectively (Burk et 
al., 2011). 
1 
DNA sequencing methods, such as Sanger sequencing and next generation sequencing (NGS), are often 
used in phylogenetic studies to investigate HPVs inheritable traits within different organisms and to 
detect genomic mutations. By analysing the data acquired by sequencing, phylogenetic trees, which 
reflect the evolutionary history of organisms, can be constructed, and the information gathered can then 
be used for taxonomic classification and analyses (Burk et al., 2011; Kocjan et al., 2015; Sridhar et al., 
2015). Using phylogenetic analysis, HPV11 was previously divided into subgroups A1 and A2; 
however, recently a study on the genomic diversity of globally circulating HPV11 isolates uncovered 
two lineages (A and B) and four sub-lineages (A1, A2, A3 and A4) (Jelen et al., 2016), warranting 
investigation of further isolates for clarification of lineages currently circulating (Burk et al., 2011). 
Previous studies conducted on young adults (age 16 – 24 years) in South Africa determined that over 
two-thirds of the population are often infected with multiple HPV types, with approximately 1-5% of 
the HPV positive participants infected with HPV11 (Giuliano et al., 2015; Mbulawa et al., 2017, 2018). 
A study conducted in the Free State province of South Africa determined that RRP has a predominantly 
juvenile-onset (children age 14 and under) (~85%), with approximately 40% of cases being due to 
HPV11 (Seedat & Schall, 2018). However, most of these studies only target selected population groups 
and an accurate HPV11 prevalence, especially in the respiratory tract, is unknown and presumed to be 
much higher. 
To date, there is no cure for RRP, and patients often require multiple surgical procedures to remove the 
papillomas to prevent airway obstruction (Seedat, 2020). Fortunately, preventative measures are 
available. There are three vaccines used for protection against HPV: Cervarix®, Gardasil® and 
Gardasil-9®. Two of these vaccines, Gardasil® and Gardasil-9®, protect against HPV11 infection 
when administered prophylactically (Barra et al., 2019; Chabeda et al., 2018; Dadar et al., 2018). To 
combat infection with HPV, the National Department of Health has incorporated HPV vaccination with 
Cervarix® into the school health programs, targeting half a million girls (Delany-Moretlwe et al., 2018). 
However, Cervarix® does not confer protection against HPV11 infection (Barra et al., 2019; Chabeda 
et al., 2018; Dadar et al., 2018). 
Research on the HPV11 lineages and sub-lineages circulating within the community is urgently required 
to further study lineage correlation with disease severity, to guide vaccine development, to monitor the 
impact of the vaccination campaign on the circulating HPV types, to collect baseline data for future 
studies, and to identify novel HPV types if present. 
1.2. Discovery of human papillomavirus 
In the early 1930s, Rous and Shope identified the first papillomavirus from wart-like lesions in 
cottontail rabbits (Sylvilagus sp.), and further investigations led to the discovery of papillomavirus 
2 
malignant- and transmission capabilities (Rous & Beard, 1935; Shope & Hurst, 1933). Following this 
discovery, research into papillomaviruses intensified. In 1949, the first virus particles in a human 
papilloma extract were identified using electron microscopy (Strauss et al., 1949), and 16 years later, 
in 1965, the human wart virus's genome was determined to be circular, dsDNA with a protein capsid 
comprised of 72 pentameric capsomers (Crawford, 1965; Klug & Finch, 1965).  
Until the 1970s, it was believed that there was only a single type of HPV that caused the formation of 
warts in various tissue sites. However, within the decade, recombinant DNA technology and molecular 
cloning techniques led to the discovery of a plurality of HPV types, such as HPV6, HPV11, HPV16 and 
HPV18, with different tropisms for mucosal or cutaneous squamous surfaces (Boshart et al., 1984; 
Dürst et al., 1983; Gissmann et al., 1982). In the wake of these studies, the involvement of HPV in 
malignant cell transformation was hypothesised and would later prove to be a major focus area in HPV 
research (Gissmann et al., 1977; Gissmann & zur Hausen, 1976; zur Hausen et al., 1975). 
In 1982, molecular cloning of papillomavirus genomic DNA extracted from a respiratory papilloma led 
to the discovery of HPV11 (Gissmann et al., 1982). Further investigations eventually revealed that 
HPV11 was also responsible for genital wart development (Gissmann et al., 1983). The first complete 
nucleotide sequences of ten HPV11 isolates were determined and characterised in 1986 in Slovenia, 
and approximately a decade later, the URR sequences of 40 HPV11 isolates were determined, providing 
further insight into the genetic code of HPV11 types and intratypic variants (Dartmann et al., 1986; 
Heinzel et al., 1995). Only again in 2009, was the complete sequence of HPV11 obtained from a cervical 
swab of a patient with an unspecified genital disease (Wu et al., 2009).  
The first extensive sequencing study to obtain complete genome sequences of HPV11 isolates was 
performed in 2011 in Slovenia (Maver et al., 2011). Phylogenetic analysis revealed sequences 
corresponding to the prototypic- and non-prototypic variant group based on specific nucleotide 
signatures and several novel HPV types and potentially significant mutations (Maver et al., 2011). The 
prototypic variant group and the non-prototypic variant group were renamed A1 and A2, respectively, 
when a new system for the classification and nomenclature was described for HPV variants (Burk et 
al., 2011). More recently, a study investigating the genomic diversity of globally circulating HPV11 
isolates revealed two lineages (A and B) and four sub-lineages (A1 - A4) (Jelen et al., 2016). It has been 
established that HPV has a slow evolutionary rate, and genomic variation is predominantly a 
consequence of genetic drift (Bernard, 1994; van Doorslaer, 2013). Therefore, discovering any new 
HPV lineages or sub-lineages requires additional investigation into the evolutionary rate and the genetic 
relationship of HPV11 variants to further characterise these variants. 
3 
1.3. Human papillomavirus genome and proteins 
HPVs are non-enveloped, dsDNA viruses with a small genome of around 8000bp (Kardani & 
Bolhassani, 2018a). Many proteins necessary for viral infection, cellular gene expression, and immune 
evasion are encoded by the HPV ORFs. The genome comprises three regions, including the early ORF, 
late ORF, and the URR (Figure 1). The early region is approximately 4000bp, and codes for non-
structural proteins, whereas the late region is approximately 3000bp, and codes for structural proteins 
(Kardani & Bolhassani, 2018a). The URR is approximately 1000bp and contains elements involved in 
regulating viral replication and gene expression (Harari et al., 2014; Kardani & Bolhassani, 2018a; 
Ribeiro et al., 2018). 
Throughout evolution, papillomaviruses have gained and lost protein coding genes; however, all 
papillomaviruses encode for a minimum of five proteins, including E1, E2, E4, L1 and L2, and contain 
a URR (Kardani & Bolhassani, 2018a). Therefore, a virus containing only the basic set of core genes 
(E1, E2, L1, L2 and URR) should theoretically be able to infect a cell and replicate. It is thus 
hypothesised that ancestral papillomaviruses comprise the essential genes and no additional adaptive 
proteins. All papillomaviruses contain at least one adaptive protein, such as E5, E6 or E7, which plays 
a role in immune evasion and cellular growth (Kardani & Bolhassani, 2018a, 2018b). Moreover, genes 
that encode adaptive proteins such as E5, E6 and E7, have been associated with malignant 
transformation, although not all papillomaviruses encode for all these adaptive proteins, and not all 
papillomaviruses have an association with malignant transformation (Egawa et al., 2015; van Doorslaer, 
2013). 
1.3.1. The early region 
The early region comprises several ORFs that encode non-structural proteins, which play a regulatory 
function immediately following infection. These ORFs can be divided into the regulatory genes (E1, 
E2 and E4), which play a crucial role in virion synthesis, and three oncoproteins (E5, E6 and E7). The 
ORFs in the early region are expressed within the deeper, less differentiated layers of the infected tissue, 
such as the basal layer (Harari et al., 2014; Kardani & Bolhassani, 2018a). 
The E1 and E2 genes, play pivotal roles during replication and amplification of the viral circular dsDNA 
genome and are essential for virus survival. E1 is separated into three functional regions: The N-
terminal regulatory region, which stimulates cyclin-dependent kinase 2 (CDK2) phosphorylation, the 
central origin-binding domain (OBD), which binds E1 and E2 protein forming a complex (E1-E2), and 
the C-terminal helicase domain (HD) which acts as adenosine triphosphate (ATP)-dependent helicase 
(Graham & Faizo, 2017; Kardani & Bolhassani, 2018a). Functions of this protein include optimising 
viral reproduction in vivo, recognising the origin of replication, and assembling into a double hexameric 
4 
complex that unwinds DNA duplexes upstream of the DNA replication fork. E2 contains a DNA-
binding domain and a protein-binding domain (Graham & Faizo, 2017; Kardani & Bolhassani, 2018a; 
Wallace & Galloway, 2014).  
 
M14119.1 
Human 
papillomavirus 
type 11 (HPV11) 
complete 
genome  
7933bp 
 
Figure 1: Genome organisation of a low-risk human papillomavirus type 11 (HPV11).  
E1-E7 early genes, L1-L2 late genes, URR Upper regulatory region, AE early polyA signal, and P97 and P742 promotors are 
indicated. The figure is drawn based on the HPV11 prototype A1 with a 2bp insertion at genomic position 7717-7718 (GenBank 
accession number M14119.1) (Maver et al., 2011). 
 
The E2 protein is a multifunctional protein encoded by all papillomaviruses expressed during early and 
intermediate viral life cycle stages. The E2 has several primary functions essential for the viral life 
cycle, such as regulating expression levels for viral gene products in the early stages of the HPV life 
cycle, recruiting the E1 helicase protein to the viral origin of replication for replication initiation, and 
delivering the replicated viral genome to daughter cells during the division of the parent cell. 
Additionally, the E2 plays a role in transcription as a transcription factor and ensures low viral 
concentrations in the early stages of the HPV life cycle. Mutation or integration of the viral genome can 
result in the inactivation of the E2 protein, leading to over-expression of E6 and E7 genes (Graham & 
Faizo, 2017; Kardani & Bolhassani, 2018a; Wallace & Galloway, 2014).  
5 
Replication is initiated when E2 recruits E1 to the viral origin (Figure 2). The recruitment step involves 
a crucial protein-protein interaction between the transactivation domain (TAD) of the E2 protein and 
the HD of E1. Then, additional E1 molecules are recruited, and the E2 protein promotes assembly into 
a replication-competent double hexameric helicase. ATP likewise promotes the oligomerisation of E1 
and is further required to power E1 helicase activity. Lastly, E1 interacts with host cell replication 
factors to promote bidirectional replication of the viral genome (Graham & Faizo, 2017; Kardani & 
Bolhassani, 2018a; Wallace & Galloway, 2014) (Figure 2). 
The HPV E4 ORF is located within the E2 ORF and is the first gene expressed in the later stage of 
infection. E4 does not possess an initiation codon and uses the E2 initiation codon. The E4 protein plays 
a role in virion release by restructuring the epithelial cell's cytokeratin and may play a part in genome 
amplification and the enhancement of virion synthesis. The E4 protein displays various effects on cell 
behaviour, such as suppressing the host cell's DNA synthesis to promote apoptosis in terminally 
differentiated cells by interacting with the host mitochondria (Graham & Faizo, 2017; Kardani & 
Bolhassani, 2018a). In addition to this, it has also been reported to have a potential role in HPV 
screening (Yajid et al., 2017). 
The E5 protein is a transmembrane hydrophobic protein expressed late in infection made up of 
approximately 83 amino acids. The protein has several functions, including immune evasion via major 
histocompatibility complex (MHC) repression and regulating apoptosis. Moreover, the E5 protein plays 
a role in cell cycle pathways via interaction with growth factor receptors (Graham & Faizo, 2017; 
Kardani & Bolhassani, 2018a). Similar to other HR proteins, the E5 influences cellular gene expression 
by regulating small non-coding ribonucleic acid (RNA) molecules, thereby exhibiting oncogenic 
activity (Georgescu et al., 2018).  
The E6 and E7 proteins exhibit oncogenic activity by associating with tumour protein 53 (p53) and 
retinoblastoma protein (pRB) (Altamura et al., 2018; Georgescu et al., 2018; Pal & Kundu, 2020). 
Expression of these ORFs in the lower epithelial layer triggers differentiating cells of the suprabasal 
layers (the thin layer above the basal layer) to re-enter the synthesis-phase (S-phase) in which DNA 
replicates. This phase is highly regulated and conserved, and dysregulation generally leads to cell 
apoptosis (Georgescu et al., 2018; Kardani & Bolhassani, 2018a). E6 proteins are responsible for 
degrading p53, which inhibits apoptosis, and therefore the infected cells continue viral DNA replication 
by recruiting E1/E2 complexes which play a significant role in replication. The pRB gene acts as a 
tumour suppressor by suppressing the replication of enzyme expression genes (Pal & Kundu, 2020). 
When E7 binds to pRB, the complex inactivates, stimulating replication and cell division. Association 
of the oncoproteins with these tumour suppressor genes leads to disruption of the physiological 
functions of these genes and subsequent possible malignant transformation (Pal & Kundu, 2020). 
6 
 
 
 
Figure 2: Schematic drawing of human papillomavirus type 11 (HPV11) replication initiation mechanisms.  
Early proteins E1 and E2 are involved. Locations of the functional domains in the proteins are indicated. OBD origin binding 
domain, TAD transactivation domain, DBD Deoxyribonucleic acid binding domain, and H hinge region. Replication is 
initiated by E1 (red), by E2 (blue), to the OBD. This involves an interaction between the E2 TAD and the E1 helicase domain. 
E2 recruits additional E1 molecules. Adenosine triphosphate (ATP) also stimulates helicase activity of E1, which interacts 
with host cell replication factors to promote bidirectional replication of the viral genome. E1 interacts with host cell replication 
factors to promote bidirectional replication of the viral genome. Adapted from D'Abramo & Archambault (2011) and Stenlund 
(2003). 
 
Recent studies have demonstrated the role of oxidative stress and chronic inflammation in carcinogenic 
development. The oncogenes E5, E6 and E7, are all involved in developing chronic inflammation, 
which induces oxidative stress, leading to cell damage and subsequent malignant transformation 
(Georgescu et al., 2018). The type of papillomavirus influences the oncogenicity of E5, E6 and E7. 
HPV types such as HPV11 have limited activity compared to the other HPV types and are classified as 
LR-HPV. LR-HPV types, unlike HR-HPV types, do not degrade pRB or p53 and are less likely to result 
in malignant transformation than their HR counterparts (Egawa & Doorbar, 2017; Klingelhutz & 
Roman, 2012; Pal & Kundu, 2020). 
7 
1.3.2. The late region 
The late region contains two ORFs, namely L1 and L2, which express structural- or capsid proteins 
required for transmission and survival of HPV in the upper, more differentiated layers of the infected 
tissues (Buck et al., 2013; Wang & Roden, 2013). The L1 major capsid protein can spontaneously self-
assemble into virus-like particles (VLPs), presenting an icosahedral exterior surface. The L1 gene is 
highly conserved, but contains a small number of lineage specific nucleotide polymorphisms that makes 
it useful for typing (Buck et al., 2013; Burk et al., 2011). The structure is highly immunogenic and has 
formed the basis of successful vaccines targeted against HR-HPV types (Buck et al., 2013).  
The L1 capsid surface contains knob-like structures constituting 360 copies of the protein organised 
into 72 pentameric capsomers with a copy of L2 protein in the centre. The L1 has two termini, namely 
the N- and C termini, arranged as 'invading arms' arranged to form the floor between the knob-like 
capsomeres (Buck et al., 2013; Conway & Meyers, 2009). The capsid undergoes various essential 
conformational changes during the virus life cycle. These conformational changes mediate vital 
functions for virus survival, including encapsidation of the papillomavirus genome, interaction with the 
host cell for infectious entry, and releasing the viral DNA into a new host cell (Buck et al., 2013). 
The capsid protein L2 has complex roles in the biology of all papillomaviruses, most notably in virus 
assembly and the infectious process. Unlike the major capsid protein L1, the minor capsid protein L2 
cannot self-assemble into VLPs, although it can be integrated into VLPs when co-assembled and 
expressed with the L1 protein (Conway & Meyers, 2009; Wang & Roden, 2013). Roles of the L2 protein 
include facilitation of efficient genome encapsidation, vesicular trafficking of the viral genome in the 
direction of the host cell nucleus and escaping the vesicular compartment to travel to the host cell 
nucleus for successful infection (Conway & Meyers, 2009; Wang & Roden, 2013). 
1.3.3. Upper regulatory region 
The URR is the most variable region within the HPV genome since it does not encode for proteins. 
Consequently, it is capable of accumulating and tolerating more nucleic mutations. The URR is located 
between the E6 ORF and L1 ORF and consists of approximately 850bp (Kardani & Bolhassani, 2018a; 
Ribeiro et al., 2018). The URR interacts with numerous cellular and viral factors and is involved with 
functions such as virus replication, gene expression, and transcription. The region divides into three 
segments which all include E2 binding sites. The URR includes the 5' segment, the central segment and 
the 3' segment. The 3' segment also bears the E1 binding site, which overlaps with the origin of 
replication (Graham & Faizo, 2017; Ribeiro et al., 2018). The URR includes genetic elements, for 
example, early promotors, the transcription enhancer, the origin of replication, the late polyadenylation 
8 
site, and the late regulatory element. Mutations in the URR may impact binding sites and functionality 
(Fang et al., 2020; Graham & Faizo, 2017; Ribeiro et al., 2018). 
1.4. Classification and taxonomy of human papillomavirus 
Initially, papillomaviruses and polyomaviruses were grouped into one family, namely the 
Papovaviridae. These viruses were subsequently separated into two families, Papillomaviridae and 
Polyomaviridae, due to the lack of nucleotide and amino acid similarities, different genome sizes and 
genome organisation (Bernard et al., 2010; Fauquet et al., 2005; van Regenmortel et al., 2002). 
Papillomaviruses consists of a family of viruses that classifies into different genera, species, and types. 
HPVs consist of three significant genera, including the Alphapapillomaviruses, Betapapillomaviruses 
and Gammapapillomaviruses, but smaller genera Mupapillomavirus and Nupapillomavirus, also exist 
(Bernard et al., 2010; de Villiers, 2013; Murahwa et al., 2019). 
Throughout the evolutionary process, nucleotide sequences across the HPV genome have transformed. 
Evolutionary changes in papillomaviruses' hosts created new ecological niches for papillomaviruses to 
adapt to, resulting in the formation of different clades. These viruses then co-evolved alongside their 
specific hosts resulting in further co-speciation (Bernard, 1994; van Doorslaer, 2013). HPV tropism is 
used to classify viruses into cutaneous viruses or mucosal viruses. Mucosal viruses are further divided 
into LR, probable HR, and HR viral types (Egawa & Doorbar, 2017; Egawa et al., 2015).  
A DNA sequence-based classification system is primarily used to classify HPVs. The International 
Committee on Taxonomy of Viruses (ICTV) established the designation and naming of virus taxa based 
on recommendations from the Papillomaviridae Study Group, which consists of 11 researchers 
(https://talk.ictvonline.org/taxonomy/). A classification and nomenclature system for the 
Alphapapillomaviruses was established in 2011 by Burk and colleagues (2011). This study was the first 
to describe the nomenclature system for HPV6 and HPV11 variants based on whole-genome analyses.  
The ORF nucleotide sequence coding for the capsid protein L1 is used to classify HPV types and 
represent whole-genome variation due to the high level of conservation of the L1 gene (Bernard et al., 
2010; Burk et al., 2011; de Villiers et al., 2004; de Villiers, 2013). Consensus primers that target the L1 
ORF are used to differentiate between various HPV types. These amplicons can be sequenced and 
aligned to existing HPV prototypes to identify HPV types, lineages and sub-lineages or any nucleic 
heterogeneity (Bernard et al., 2010; Burk et al., 2011; de Villiers et al., 2004; de Villiers, 2013). A 
novel HPV type has less than 90% similarity to any HPV type. Nucleotide differences in the complete 
genome of between 1.0% to 10.0% and 0.5% to 1.0% define variant lineages and sub-lineages, 
respectively (Burk et al., 2011). Data acquired by sequencing is used to construct phylogenetic trees 
and used for taxonomy (Burk et al., 2011). Approximately 220 HPV types have thus far been identified 
9 
as of 2021 according to the International HPV Reference Centre (Bernard et al., 2010; de Villiers et al., 
2004) (https://www.hpvcenter.se/human_reference_clones). 
The HPV11 genome was formally classified into two sub-lineages (A1 and A2) based on complete 
HPV11 genomes (Burk et al., 2011; Maver et al., 2011). A more recent study on the global genomic 
diversity of HPV11 identified a separate lineage (lineage B) and two additional sub-lineages (sub-
lineages A3 and A4) (Jelen et al., 2016). These results were also generated by sequencing the E5a ORF, 
E5b ORF, L1 ORFs and the URR, which reliably produced the same phylogenetic results as whole-
genome sequencing. Moreover, this study identified a 208bp region found between the 3' end of the E2 
ORF and the 5' of the non-coding region-2 (NCR2) that is the most suitable genomic region to sequence 
to distinguish all identified HPV11 lineages and sub-lineages when whole-genome sequencing is 
impractical (Jelen et al., 2016). A review of literature revealed that additional studies on HPV11 are 
required to investigate the heterogeneity observed in this study. 
1.5. Life cycle of human papillomavirus 
Papillomaviruses all follow similar life cycles but are species-specific regarding infection and 
replication within hosts (Doorbar et al., 2012; Kardani et al., 2018). They infect epithelial cells, which 
are part of the cutaneous and mucosal tissue that generally serves as a protection against the external 
environment (Madison, 2003; Stanley, 2020).  
Basal cells compose the bottom layer of the epithelial layer and are capable of mitotic division. During 
mitosis, a daughter cell moves up through the epithelial layer to replace non-living surface epithelial 
cells. This movement marks the end of the cell cycle and the beginning of terminal differentiation, 
resulting in the loss of the nucleus (Kardani et al., 2018; McBride, 2017). The cell cycle occurs in four 
phases. Cellular growth occurs in the growth-1-phase (G1-phase), host DNA replicates in the S-phase, 
the cells prepare for division in the growth-2-phase (G2-phase), and chromosomes are separated, and 
daughter cells form in the mitosis-phase (M-phase) (Kardani et al., 2018; McBride, 2017). HPVs do 
not possess replication machinery apart from the E1 replication enzyme. To overcome this, HPVs 
depend on the epithelial cellular replicative enzymes for propagation and enter basal cells to link virus 
and host replication life cycles (Doorbar et al., 2012; McBride, 2017).  
There are four main stages of replication during the HPV life cycle: virus entry, establishment, 
maintenance of the non-productive infectious state, and virus production (Kardani et al., 2018; 
McBride, 2017). HPV replication is depicted in Figure 3. The first phase of HPV replication is host cell 
entry. Infection with HPV is thought to require epithelium micro-abrasions to allow access of the virus 
into actively dividing basal cells; however, multiple entry-pathways have been reported for the immense 
diversity of HPV types (Graham & Faizo, 2017; Kardani et al., 2018; McBride, 2017). The L1 capsid 
10 
protein then binds to the host cell receptor such as heparin sulphate proteoglycans (HSPGs) which are 
the primary receptors. Receptor types and strategies may be dependent on the HPV type and the host 
cell. The virus enters the host cell using endocytosis and travels through vesicular trafficking to the 
nucleus, where the virus enters the nucleus through nuclear pores or following cell mitosis (Graham & 
Faizo, 2017; Kardani et al., 2018; McBride, 2017). 
Once the virus has successfully entered the host cell, the second- or non-productive infectious state is 
established. The initial amplification phase of the virus is thought to be transient and rapid, and relies 
on host cell machinery for replication (Graham & Faizo, 2017; Kardani et al., 2018; McBride, 2017). 
Early genes necessary for the initial genome amplification are expressed (E1, E2, E6 and E7). The URR, 
E1 and E2 are the primary genes required for successful replication. The E1 and E2 proteins are 
dependent on the host's replication machinery and DNA polymerase. In HR-HPVs, the E6 and E7 
proteins have a pivotal role in driving cell proliferation in the basal layers and subverting pathways that 
signal cell growth arrest, thus supporting viral genome replication. In LR-HPVs, these proteins do not 
have a clear role in replication (Graham & Faizo, 2017; Kardani et al., 2018; McBride, 2017). The viral 
genome doubles and segregates the viral DNA into daughter cells during basal cell division and 
replicates with the host DNA as episomes (S-phase). Low copy numbers (50−200 copies) of the viral 
episomes are maintained by maintenance replication to avoid host immune system detection (Graham 
& Faizo, 2017; Kardani et al., 2018; McBride, 2017) (Figure 3). 
In the third phase, the non-productive infectious state is maintained. Viral genome maintenance in 
proliferating basal cells follows a burst of viral DNA replication, also known as vegetative viral DNA 
amplification. The E4 and E5 proteins are expressed during this phase, although E4 is not essential for 
HPV11 replication (Graham & Faizo, 2017; Kardani et al., 2018; McBride, 2017). Similarly, the late 
proteins (L1 and L2) necessary for viral assembly are expressed (Buck et al., 2013; Wang & Roden, 
2013). After differentiation of basal cells into keratinocytes, the cells exit the cell cycle (Graham & 
Faizo, 2017; McBride, 2017). The purpose of the E6 and E7 proteins in HR- and LR-HPVs is to preserve 
a reservoir of infection and direct differentiating cells into the S-phase for viral amplification in the 
upper basal layers (Egawa & Doorbar, 2017) (Figure 3). 
In the last phase of viral replication, large numbers of progeny viral genomes are synthesised. Structural 
proteins expressed in the upper layers of epithelium and progeny virion particles are assembled and 
released upon cell death (Conway & Meyers, 2009; Graham & Faizo, 2017; Kardani et al., 2018; 
11 
McBride, 2017) (Figure 3). When HPV infects and replicates within the respiratory tract mucosa, 
papillomas may develop (Benedict & Derkay, 2021; Hoesli et al., 2020; Seedat et al., 2013).  
 
 
Figure 3: Human papillomavirus (HPV) replication in epithelial cells.  
HPV moves through the epidermis to promote infection. The proteins involved in the process include early proteins (E1, E2, 
E4, E5, E6 and E7) and late proteins (L1 and L2). Modified from Stanley, 2020. 
 
1.6. Transmission of human papillomavirus 
HPV is commonly transmitted during sexual contact with an infected partner, even when asymptomatic 
(Kardani et al., 2018). According to the Cancer Association of South Africa (CANSA), approximately 
80% of people are infected with HPV at least once before the age of 50 years (https://cansa.org.za/). 
Globally, HPV is characterised as a prevailing sexually transmitted infection (STI). HPV can also be 
transmitted via auto-or hetero-inoculation, for example, kissing, non-penetrative sex, genital scratching, 
or finger-genital contact (Sabeena et al., 2017). In addition, HPV is also known to persist in a person's 
mouth, and HPV transmission between family members can thus be expected (Sabeena et al., 2017). 
Although sexual transmission of HPV is predominant, HPV DNA has been identified in lesions in 
infants, young children, and women who are not yet sexually active, which suggests that the virus can 
be transmitted from an infected mother to child during or before childbirth (Kardani et al., 2018; 
Sabeena et al., 2017; Zahreddine et al., 2020; Zouridis et al., 2018). Infants born via caesarean section 
tend to have lower HPV transmission rates than those born naturally, although this delivery mode does 
not exclude the probability of infection (Tseng et al., 1998; Zouridis et al., 2018). Many well-conducted 
prospective studies have found that vertical transmission of HPV to newborn babies is relatively rare, 
with less than 5% of children being infected with HPV from their mother (Smith et al., 2010; Watts et 
12 
al., 1998; Zouridis et al., 2018). However, results vary significantly, with other studies reporting higher 
(>20%) rates of mother-to-infant transmission (Hahn et al., 2013; Rintala et al., 2005; Tseng et al., 
1992, 1998). A systematic review of the literature published in 2018, including 421 HPV-positive 
mothers and their progenies, showed a 4.94% rate of vertical transmission of HPV and the relative risk 
of vertical transmission of HPV between women undergoing caesareans and vaginal deliveries to be 
0.912 (Zouridis et al., 2018). 
Few studies have reported on the differences between intrauterine transmission and transmission during 
labour and delivery. These studies produced varying results, with some studies unable to confirm 
intrauterine transmission and other studies reporting high rates of intrauterine HPV transmission. 
Nonetheless, an HPV positive mother continues to be a risk factor of infant infection. The prevalence 
of HPV infection in children infected in this manner is an essential area of research due to the impact 
on vaccination and management strategies. 
1.7. Epidemiology of human papillomavirus type 11 in South Africa 
A study conducted in the Western Cape between November 2012 to July 2013 on young women (age 
16–24 years) determined that 71% of the population was infected with HPV, with half (50.1%) of the 
HPV positive population infected with multiple HPV types. It was reported that between 1% and 3.1% 
of the HPV-positive population was infected with HPV11 and HPV6, respectively. These are the HPV 
types responsible for RRP development. This study also found that the younger women in the study 
population were more likely to test HPV positive than the older women (83% among ages 16−17 years) 
(Giuliano et al., 2015). 
A study that recruited sexually active, human immunodeficiency virus (HIV)-negative young women 
(age 16–22 years) from Cape Town and Soweto between November 2013 and December 2014 reported 
a lower HPV prevalence among the study population (66%). In addition, this study revealed a lower 
percentage of infection with multiple HPV types (41.6%). However, a higher prevalence of HPV11 and 
HPV6 infections (~4% and ~6%, respectively) in the HPV-positive population was reported (Mbulawa 
et al., 2018). According to a previous surveillance study (2015-2016) for cervical HPV infections on 
unvaccinated women aged 18-20 years, it was determined that approximately two thirds (64.4%) of the 
South African female population was infected with HPV, with a clear association between HPV and 
HIV. In addition, most women were infected with more than one HPV type with a median of three HPV 
types. Genotyping revealed that 3.4% of the population who tested HPV positive were infected with 
HPV11, and 4.8% were infected with HPV6 (Mbulawa et al., 2017). 
A recent cross-sectional study showed that among women aged 38–55 years visiting a community 
health clinic in the OR Tambo district municipality of the Eastern Cape province of South Africa, HR-
13 
HPV prevalence was 28.5%. Of the 417 participants, 40.7% of women infected with an HR-HPV type 
were HIV-positive, and 14.4% of women reported having ulcers or warts in their lifetime. In addition, 
HIV-positive women with normal or abnormal cytology had a higher viral load than HIV-negative 
women (Taku et al., 2020). However, a limitation of most of these studies is that they targeted specific 
population groups or sampling areas and did not include children who predominantly suffer from RRP.  
1.8. Human papillomavirus pathogenicity 
HPVs are ubiquitous in the human population and often cause morbidity. LR-HPVs cause many 
seemingly benign lesions such as genital-, common-, and flat warts, as well as verrucas and other skin 
lesions. Generally, lesions caused by HPV are self-limiting and are frequently cleared by the cell-
mediated response (Sterling et al., 2001). However, HPV associated papillomas are often refractory to 
treatment and may persist. The development of cancer due to LR-HPV infection requires the host to be 
genetically susceptible or immunosuppressed to endure raised viral gene expression and recalcitrant 
lesions to progress to malignancy (Egawa et al., 2015; Georgescu et al., 2018; Pinidis et al., 2016; 
Reidy et al., 2004). Nevertheless, the association between LR-HPV and carcinoma remains ambiguous. 
RRP, which is associated with HPV11, can persist for years regardless of surgical intervention, and can 
in some instances lead to malignant lesions in the lower respiratory tract and lungs (Gerein et al., 2005; 
Reidy et al., 2004). In these circumstances, the viral genome is integrated into the hosts' cell 
chromosome, signifying deregulated viral gene expression pursued by acquiring additional genetic and 
epigenetic modifications as seen in HR-HPV types (Huebbers et al., 2013; Reidy et al., 2004). In some 
RRP-associated cancers, rearrangement of the HPV11 genome has been observed, but viral gene 
expression patterns in this regard are still poorly understood. Compared to the prevalence of HPV6 and 
HPV11 infection in individuals, the development of RRP is rare, which may suggest that this disease 
should be considered as a multigene disease as HPV type and tissue-specific immune deficiency hinders 
the clearance and management of HPV6 and HPV11 infection. Therefore, in individuals who develop 
this disease, long term follow-up is essential (Bonagura et al., 2010; Seedat, 2020; Seedat et al., 2013).  
HPV pathogenicity is determined by genotype, epithelial micro-environment, and the infection site and 
consequent pathogenesis is influenced mainly by viral protein function and regulation (Georgescu et 
al., 2018; Stanley, 2020). Knowledge of molecular pathogenesis at the gene regulation and protein 
function level is necessary to explain why LR-HPVs are less likely to cause progression to malignancy 
compared to HR-HPVs (Georgescu et al., 2018; Stanley, 2020). In tumour cells, the virus integrates 
into the host genome and interrupts the functions of the E2 protein, which is responsible for E6 and E7 
transcription, and subsequently results in the E6 and E7 oncoproteins being expressed at elevated levels. 
As a result, infected cells are immortalised and unable to differentiate (Georgescu et al., 2018; 
Longworth & Laimins, 2004; Stanley, 2020). In contrast to LR-HPV, HR-HPV E6 and E7 proteins 
14 
disturb epithelial differentiation and apoptosis by binding to host cell proteins with high affinity 
(Stanley, 2020). Epithelial differentiation and apoptosis disruption are stimulated through cellular 
proliferation, synthesis of viral DNA and interference in the cell cycle (Stanley, 2020). 
In HR-HPVs, the E6 proteins form a complex with p53 and a ubiquitin ligase, E6-associated protein 
(E6AP), instigating cell cycle arrest and loss of apoptotic functions by blocking progression at the G1/S-
phase checkpoint (Altamura et al., 2018; Pal & Kundu, 2020). The E7 protein inactivates the pRB 
protein which disrupts its interaction with the E2 factor (E2F) at the G1-phase which subsequently 
results in disruption at the cell cycle control checkpoints (Liu et al., 2008; Pal & Kundu, 2020). 
Additionally, the E7 protein interacts with the deacetylases, an enzyme, and the cyclin and cyclin-
dependant kinase regulatory proteins to alter the cell cycle (Wang & Roden, 2013). The interaction of 
E7 with enzymes triggers DNA synthesis and cell replication in generally inactive mature epithelial 
cells, subsequently stimulating differentiation‐dependent viral DNA amplification, leading to 
pathological cell growth (Bedell et al., 1991; Pal & Kundu, 2020). The virions then assemble and are 
released when the squamous cell layer is reached (Conway & Meyers, 2009). 
1.9. Host immune response to human papillomavirus 
People with RRP often develop a robust serological response to the HPV vaccine; however, a 
serological response against natural infection is often delayed and produces low levels of antibodies. 
The delayed serological response is attributable to low levels of exposure to viral proteins due to 
immune evasion and the absence of viremia. It is postulated that only 50-70% of people infected with 
HPV develop specific antibodies (Buchinsky et al., 2020; Zahreddine et al., 2020).  
Initially, patients diagnosed with RRP generate a measurable serum antibody response to HPV6 and 
HPV11 infection, indicating viral immune recognition. Therefore, immune dysfunction in patients 
diagnosed with RRP is indicative of HPV6 and HPV11 tolerance instead of a lack of viral recognition 
(Buchinsky et al., 2020; Ivancic et al., 2020). Furthermore, studies have demonstrated site‐specific 
immune tolerance of HPV6 and HPV11 in the mucosa, suggesting that RRP is a multigene disease that 
polarises the immune system to tolerate local and chronic HPV6 and HPV11 infection (Buchinsky et 
al., 2020; Ivancic et al., 2020). 
The adaptive immune system includes naïve T-lymphocytes that differentiate into cluster of 
differentiation (CD) 4+ and CD8+ cells (cell-mediated immunity) and B-lymphocytes, including 
plasma- and memory cells producing antibodies (humoral immunity). Phagocytes and antigen-specific 
cytotoxic T-lymphocytes, which form part of the cell-mediated immunity, are activated, and cytokines 
are released in response to the antigen. Due to cell-mediated immunity, the vast majority of papillomas 
regress within two years (Ivancic et al., 2020). B-lymphocytes, which display terminal differentiation 
15 
and plasma cells, named multiple myeloma oncogene-1 (MUM1+), produce antibodies that correlate 
with disease severity. HPV vaccination increases the level of antibodies and memory cells, thereby 
boosting immunity to HPV (Buchinsky et al., 2020; Ivancic et al., 2020). 
Conversely, the innate immune system is a non-specific system that includes cells such as dendritic-, 
mast-, and natural killer cells, as well as macrophages and granulocytes. The innate immune system is 
activated by the presence of antigens, such as the L1 and L2 capsid proteins (Ivancic et al., 2020). The 
system further includes infiltration of leukocytes and production of nitric oxide, cytokines, and 
chemokines at the site of infection. Antibodies developed against HPV are associated with containment 
of the virus and papilloma regression (El Achkar et al., 2020; Ivancic et al., 2020). 
Infection with HPV6 and HPV11 stimulates viral immune recognition and mounts a measurable serum 
antibody response (Ivancic et al., 2020; El Achkar et al., 2020). The CD3+ T-cells count represents the 
total number of T-lymphocytes. A higher number of CD3+ cells has been found in adults, who generally 
present with less severe RRP. A lower number of CD8+ cells was observed in juvenile patients, who 
generally present with more severe RRP. The immature juvenile immune system may affect the 
presentation of antigens and the secretion of pro-inflammatory cytokines, contributing to the severity 
of RRP. A higher number of CD8+ cells were detected in patients displaying low-grade dysplasia, 
whereas the CD4+ count remained unchanged in different degrees of dysplasia (El Achkar et al., 2020). 
Regulatory T-cells are responsible for immune self-tolerance by suppressing the activation of T-cells. 
A lower number of CD4+ regulatory T-cells, such as T-helper cells and natural killer cells, are observed 
in patients with frequent relapses (Ivancic et al., 2020; El Achkar et al., 2020). 
A study describing the vertical transmission and clearance of immunoglobulin-G (IgG) antibodies 
against HPV6, HPV11, HPV16 and HPV18 in children showed that antibodies from newborns and 
mothers were moderately correlated, and that 80–100% of anti-HPV antibodies were cleared within the 
first two years of life in seropositive newborns, suggesting vertical transfer of the antibodies 
(Zahreddine et al., 2020). Thus, serological studies on HPV antibodies are essential to study natural 
immunity and to monitor the impact of HPV vaccination programs.  
1.10. Recurrent respiratory papillomatosis 
RRP is a debilitating disease characterised by the recurrent formation of benign papillomas, more 
commonly referred to as warts, in the mucosa of the respiratory tract (Benedict & Derkay, 2021). The 
glottic and supraglottic regions of the larynx are most frequently affected. There are two forms of RRP, 
namely juvenile-onset RRP and adult-onset RRP (Novakovic et al., 2018; Seedat, 2020; Swain et al., 
2020). HPV6 and HPV11 mainly cause RRP. However, HPV types 16, 18, 31, 33, 39, 44, 45, 55, and 
16 
70 have also been identified in respiratory papillomas (Hoesli et al., 2020; Peñaloza-Plascencia et al., 
2000).  
Papillomas in the airway cause dysfunction in the larynx and trachea and may lead to morbidity and 
possible mortality due to airway obstruction. Although the papillomas are histologically benign, the 
disease may be life-threatening to some individuals if treatment is not sought (Benedict & Derkay, 
2021; Seedat, 2020; Swain et al., 2020). 
A study reviewing data from patients diagnosed with RRP between 2011 and 2015 in South Africa 
established that RRP in South Africa has a predominantly juvenile onset. This study reported the overall 
incidence of RRP to be 0.51 per 100000 population per year and the prevalence of RRP to be 1.39 per 
100000 population. In children, the incidence of RRP was 1.34 per 100000 children per year and 
prevalence 3.88 per 100000 children. This study also found that RRP in children caused by HPV11 
tended to be diagnosed at a younger age (median 3.2 years) than RRP caused by HPV6 (median 5.6 
years) (Seedat & Schall, 2018). 
1.10.1. Risk factors associated with the development of recurrent respiratory papillomatosis 
Numerous studies have compared the severity of RRP with the HPV genotype. It has been established 
that infection with HPV11 is possibly more severe, especially in the younger population, due to the 
rapid regrowth of the lesions (Intakorn & Sonsuwan, 2014; Omland et al., 2014; Seedat, 2020). HPV 
infection disease is transmitted during childbirth or sexual contact with an infected partner (Kardani et 
al., 2018; Sabeena et al., 2017; Zouridis et al., 2018). Condylomas during pregnancy are regarded as a 
significant risk factor for acquiring juvenile-onset RRP by vertical HPV transmission (Rodier et al., 
2013). 
Risk factors for the development of RRP include any immunodeficiency or co-infection, particularly 
with herpes viruses and HIV. Prolonged exposure to the virus and a high viral load may also be risk 
factors for HPV11 infection and RRP development. Furthermore, the number of children born by a 
mother and the age at which birth is given may increase the likelihood of HPV11 infection and the 
development of associated diseases (Rodríguez-Álvarez et al., 2018; Taku et al., 2020). Another factor 
that may govern a patient's susceptibility to RRP includes genetic predisposition (Hahn et al., 2013; 
Rintala et al., 2005; Smith et al., 2010; Zouridis et al., 2018). However, more research on the vertical 
transmission of genes that increase the likelihood of HPV infection is needed. The tissue adjacent to the 
site of infection may also act as a latent virus reservoir. A trigger such as recuperation after surgical 
intervention to remove papillomas may prompt reactivation and replication of the HPV in the 
surrounding tissue (So et al., 2019). 
17 
Previous studies reported that RRP, although a benign neoplasm, might progress to carcinoma. 
Consequently, patients diagnosed with RRP showing evidence of dysplastic epithelium may be at 
possible increased risk of developing laryngeal cancer (Benedict & Derkay, 2021; Cornall et al., 2013; 
Georgescu et al., 2018; Pinidis et al., 2016). However, a study on the association between LR-HPV 
types and the development of laryngeal neoplasia found no association between infection with HPV11 
and laryngeal squamous intraepithelial neoplasia (SIN)-2+ or carcinoma. This study also found that co-
infection with other HR-HPV types did not correlate with high-grade SIN and carcinoma. A significant 
preponderance of SIN2+ was instead identified in an HPV negative adult with adult-onset RRP (Omland 
et al., 2014).  
1.10.2. Diagnosis of recurrent respiratory papillomatosis 
The presenting symptoms of respiratory papillomas are progressive dysphonia, stridor, and respiratory 
distress. Laryngeal papillomas appear as off-white, exophytic, pedunculated, polypoidal masses. Single 
or multiple papillomas may be present (Ivancic et al., 2018; Seedat, 2020; Wilcox et al., 2014). 
Histopathological examination of a biopsy of the lesion gives a definitive diagnosis with RRP. 
Exophytic finger-like projections of keratinised squamous epithelium maintained by connective tissue 
and a vascular centre present in RRP. Vacuolated cells with noticeable cytoplasmic inclusions will be 
visible, indicating the presence of viruses (Ivancic et al., 2018; Seedat, 2020; Welschmeyer & Berke, 
2021; Wilcox et al., 2014). 
1.10.3. Treatment of recurrent respiratory papillomatosis 
Once a patient develops RRP, there is no definitive cure. Papillomas are removed using various 
techniques but tend to recur (Ivancic et al., 2018; Seedat, 2020; Swain et al., 2020). HPV DNA is 
present in uninvolved tissue and anatomical sites adjacent to the papillomas. Therefore, albeit with the 
removal of all papillomas, lesions tend to recur. The frequency of recurrence tends to decrease over 
time for most patients diagnosed with RRP, although this is not the case for all patients (Ivancic et al., 
2018; Seedat, 2020; Seedat et al., 2013). 
The mainstay of treatment for RRP is repeated microlaryngoscopic procedures aiming to clear the 
airway while preserving the mucosa and vocal folds (Ivancic et al., 2018; Seedat, 2020; Swain et al., 
2020). However, in developing countries, cold steel instruments are often the only mean of removing 
papillomas (Seedat, 2020; Swain et al., 2020). Complications due to repeated surgical interventions 
may result in long-standing abnormal vocal quality. Patients with airway obstruction may also require 
a tracheostomy (Ivancic et al., 2018; Seedat, 2020; Swain et al., 2020).  
A popular treatment option includes the microdebrider, which is quickly becoming the new gold 
standard for removing respiratory papillomas. The microdebrider causes minimal trauma to the 
18 
surrounding tissue and minimises the lower respiratory tract from being contaminated with papillomas 
and blood (Seedat, 2020; Swain et al., 2020). Controlled ablation is a relatively non-invasive low heat 
method used for the dissolution of soft tissue. This method is designed to cause minimal charring and 
burning of the tissue (Seedat, 2020; Swain et al., 2020). 
Therapeutic vaccines that trigger the cell-mediated immune response are ideal for treating established 
HPV infections (Chabeda et al., 2018). Numerous approaches are being explored to develop 
prophylactic and therapeutic vaccines, including peptide-based vaccines, epitope-based vaccines, 
recombinant vaccines, bacteria-based vaccines, yeast-based vaccines, VLP-based vaccines, DNA 
vaccines, plant-based vaccines, dendritic cells (DC)-based vaccines, and protein-based subunit 
vaccines. Several candidates have progressed to clinical trials (Chabeda et al., 2018; Dadar et al., 2018). 
The E1, E2, E6 and E7 proteins are near-ideal targets for vaccines. The E6 and E7 oncoproteins are 
expressed constitutively and at high levels and have a low mutation rate to maintain malignancy. The 
E1 and E2 proteins are essential proteins expressed in all HPVs. These proteins are expressed at very 
high levels at the early stages of infection and are a valuable target for therapeutic vaccines. Currently, 
no therapeutic HPV vaccines have been approved for use in people infected with HPV, but promising 
vaccine candidates have been identified in numerous studies (Chabeda et al., 2018; Dadar et al., 2018).  
Prophylactic vaccines have also been used as adjuvant therapy for RRP (Rosenberg et al., 2019). A 
systematic review and meta-analysis published in 2019 including patients previously diagnosed with 
RRP receiving the Gardasil® vaccine as a therapeutic option showed that the number of monthly 
surgical procedures for removal of laryngeal papillomas significantly reduced (0.35 to 0.06 per month) 
and that the intersurgical interval increased from seven months to over 34 months (Rosenberg et al., 
2019). 
Another adjuvant therapy for RRP treatment is intralesional cidofovir, an antiviral agent for treating 
cytomegalovirus retinitis in individuals diagnosed with acquired immunodeficiency syndrome (AIDS). 
The mechanisms of action of cidofovir involve decreasing the efficiency of DNA transcription of HPV. 
In RRP, cidofovir has been shown to increase relapse-free time and decrease the number of surgical 
procedures to remove papillomas (Fusconi et al., 2014; Gazia et al., 2020; Grasso et al., 2014; Graupp 
et al., 2013; Tjon Pian Gi et al., 2012; Welschmeyer & Berke, 2021). 
1.11. Prophylactic vaccines against human papillomavirus  
There are currently three vaccines for protection against HPV: Cervarix®, Gardasil®, and Gardasil-9®. 
The vaccines are developed using VLPs and mimic a natural HPV infection. These VLPs are not 
infectious and do not contain any HPV DNA (Barra et al., 2019). The vaccines utilise the fact that HPV 
L1 proteins form VLPs, which are antigenically like native virions when expressed in a range of cell 
19 
types. The targeted HPV types are blocked from entering the host cell by eliciting neutralising 
antibodies that bind to the VLPs. However, these vaccines cannot eliminate established HPV infections 
since the target antigens are not expressed in infected cells (Benedict & Derkay, 2021; Chabeda et al., 
2018). 
Cervarix is a bivalent vaccine that protects against HR-HPV types 16 and 18, responsible for causing 
high–grade cervical lesions. Gardasil is a quadrivalent vaccine that protects against two HR-HPV types, 
HPV16 and HPV18, and two LR-HPV types, HPV6 and HPV11, responsible for RRP development. 
Cervarix and Gardasil are aluminium-based first-generation vaccines proven to be highly immunogenic. 
Both vaccines exhibit cross-protection against HPV types 31, 33, 45, and 51 due to their phylogenetic 
relationship to HPV16 and HPV18. Gardasil-9 is a second-generation vaccine that protects against five 
HPV types in addition to the HPV types targeted by the quadrivalent Gardasil vaccine. These include 
HPV types 31, 33, 45, 52, and 58 (Barra et al., 2019; Chabeda et al., 2018; Dadar et al., 2018). The 
effectiveness of HPV vaccines in preventing infection by the targeted types has been documented in 
many countries (Brotherton, 2019).  
Cervarix® has been incorporated into the national vaccination program by the South African National 
Department of Health in 2014 and is administered to girls aged nine to ten at public schools in two 
doses approximately six months apart. Approximately 354 000 age-eligible girls in grade four have 
been vaccinated (Delany-Moretlwe et al., 2018). However, this vaccine does not confer immunity 
against other HPV types, such as HPV6 and HPV11. A study conducted by Mbulawa and colleagues in 
2018 reported a high prevalence of the HPV types targeted by the Gardasil-9 vaccine (38.5%) 
circulating amongst South-African women, encouraging the introduction of this vaccine into school 
health programs (Mbulawa et al., 2018). The introduction of this vaccine could be beneficial against 
the development of genital warts and RRP. 
Nokavic and colleagues published a five-year report on surveys of 28 paediatric otolaryngologists on 
cases of RRP diagnosed post-HPV vaccination implementation in Australia. They demonstrated a 
decrease in the incidence of RRP from 0.16 to 0.02 per 100 000 children and was the first study to report 
a decrease in the incidence of RRP following the implementation of an HPV vaccination program 
(Novakovic et al., 2018). 
Future studies on the effectiveness of the 2014 HPV vaccination campaign are essential to inform 
vaccination campaigns, monitor the vaccination campaign's impact on circulating HPV types, and 
collect baseline data for future impact studies. Prevalence surveys reporting on the 2014 HPV 
vaccination campaign in South Africa are underway and expected to be published in 2024. Additionally, 
progress in immunology- and biotechnology-derived therapeutics, recombinant DNA technology and 
20 
molecular biology could multiply opportunities to fabricate vaccines that can effectively prevent and 
treat infection with HPV, which may in return result in a diminution of HPV cases globally.  
1.12. Detection of human papillomavirus infections 
Accurate identification and typing of HPVs relies on molecular biology techniques as the virus cannot 
be grown in conventional cell culture. At present, nucleic acid hybridisation -, signal amplification- and 
nucleic acid amplification assays are primarily used to identify and type HPV (Abreu et al., 2012). 
1.12.1. Nucleic acid hybridisation assays 
Nucleic acid hybridisation assays include Southern blotting, dot blot hybridisation and in situ 
hybridisation. However, nucleic acid hybridisation assays are not routinely used as they are time-
consuming and have low sensitivity (Abreu et al., 2012). 
1.12.2. Signal amplification assays 
Two signal amplification assays commonly utilised for diagnostic purposes are the Hybrid Capture®2 
(hc2, Digene Corp., USA) and the Cervista® HPV HR assay (Abreu et al., 2012). The hc2 detects 13 
HR-HPV types (HPV types 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, and 68). However, hc2 can 
cross-react with LR-HPV types, including HPV11 (Burd, 2016). The Cervista® HPV HR assay detects 
the same HR-HPV types as the hc2 plus HPV66 and has a lower cross-reactivity rate to other HPV 
types (Burd, 2016). Although signal amplification assays have increased sensitivity for genotyping and 
a low false-positive rate, they are not intended for single HPV genotyping (Abreu et al., 2012). 
1.12.3. Nucleic acid amplification assays 
There are numerous nucleic acid amplification-based methods to detect the presence of HPV in clinical 
samples reliably. Polymerase chain reaction (PCR) is a widely used, specific and sensitive way to detect 
the presence of HPV DNA and targets conserved regions such as the L1 capsid gene. In conventional 
PCR, consensus primers targeting the HPV L1 gene are often used for amplification. Primers, for 
example, MY09/MY11, GP5+/GP6+, PGMY and SPF10, are designed to detect various HPV types 
(Cornelissen et al., 1992; de Roda Husman et al., 1995). HPV genotypes can also be detected using 
primers targeting the E6 and E7 ORFs. The nucleotide sequences of the E6 and E7 ORFs contain many 
sequence variations (Bernard et al., 2006). Other ORFs such as the E5 ORF, in combination with the 
L1 ORF and URR, can also be used to distinguish between HPV types (Jelen et al., 2016). Following 
amplification, HPV can be genotyped using different techniques, for instance, genotype-specific 
primers, restriction-fragment length polymorphism (RFLP), sequencing, hybridisation, and linear probe 
assays (Abreu et al., 2012; Dixit et al., 2011). Real-time PCR is a specific and sensitive tool that has 
21 
been shown to reliably detect and genotype HPV. Real-time PCR targets a relatively small segment of 
the genome and can thus be used on archival clinical samples. This method delivers reproducible, rapid 
results and can be used on clinical samples (Abreu et al., 2012). 
The Linear Array® HPV Genotyping Test (Roche Molecular Diagnostics, CA, USA) is an assay based 
on PCR amplification of an L1 gene segment and co-amplification of the β-globin gene, combined with 
reverse line blot hybridisation, which can distinguish between 15 HR-HPVs, three probable HR-HPVs, 
ten LR-HPVs (including HPV11) and nine other HPV genotypes with undetermined risk (Abreu et al., 
2012). The Clinical arrays® HPV kit can be used to detect and genotype HPV and allows detection of 
20 HR-HPV types and 15 LR types, including HPV11, and can also detect co-infections (Abreu et al., 
2012). The Microplate colorimetric hybridisation assay (MCHA) is a PCR-based method that relies on 
amplifying a region within the L1 gene followed by colorimetric hybridisation to HPV type-specific 
probe micro-well plates to identify six different HR-HPV types (Abreu et al., 2012). The COBAS® 
4800 HPV test combines automatic sample preparation and real-time PCR to detect 14 HR-HPV types 
(Burd, 2016). The CLART® Human papillomavirus 2 (Genomica, Madrid, Spain) is an amplification-
based methodology that targets a conserved region, L1, within the HPV genomic region and a region 
within the formylmethanofuran-tetrahydromethanopterin formyltransferase (FTR) gene. This test 
detects 35 HPV types using specific probes in a low-density microarray (Abreu et al., 2012). 
1.12.4. Genotyping 
Many HPV tests use probes that test for 13−14 of the most common HPV types. It has been proposed 
that testing for other HPV types may have a minimal effect on the knowledge of known, circulating 
HPV types. Still, there is an increasing need to distinguish between different HPV genotypes due to 
current advancements in the HPV field, evidence that certain HPV types correlate with high-grade 
carcinogenicity, the effect of multiple HPV infections on clinical presentation and the effect of 
vaccination campaigns on the current circulating HPV genotypes (Abreu et al., 2012; Brink et al., 2007; 
Godínez et al., 2014; Pinidis et al., 2016). 
Traditionally, Sanger sequencing, also known as the chain termination method, was used for analysing 
DNA (Sanger et al., 1977). However, Sanger sequencing has limitations due to its restricted sensitivity, 
and it cannot perform a parallel investigation of multiple targets. Even though, Sanger sequencing 
remains the gold standard when analysing HPV DNA, developments in NGS technologies such as 
whole genome sequencing (WGS) and corresponding analytical tools have provided comprehensive 
novel genomic information on HPV and associated diseases on an unprecedented scale (Ambulos et al., 
2016; Parker & Chen, 2017; Tuna & Amos, 2017). NGS enables the analysis of millions of DNA 
fragments simultaneously and has successfully been used to provide detailed information on the 
aetiology of HPV-driven diseases and cancers (Ambulos et al., 2016; Parker & Chen, 2017; Tuna & 
22 
Amos, 2017). Additionally, the advancement of NGS technology allows for the development of a high-
throughput, affordable assay for HPV genotyping and has proven to be sensitive, specific, and capable 
of identifying multiple co-infected HPV genotypes from a single sample (Ambulos et al., 2016; Parker 
& Chen, 2017; Tuna & Amos, 2017). 
HPV genome sequencing can be used to detect and genotype HPV on an assortment of clinical 
specimens such as blood, saliva, tissue, and formalin-fixed paraffin-embedded samples using the L1 
ORF (Ambulos et al., 2016; Parker & Chen, 2017). Additional sequencing is required to differentiate 
between the different lineages and sub-lineages (Burk et al., 2011; Maver et al., 2011). It has been 
determined that sequencing the E5 region and a small 208bp segment which includes the 3' end of E2 
to the 5' end of NCR2, can be used to construct a phylogenetic tree representing the different lineages 
and sub-lineages of HPV11 (Jelen et al., 2016). 
1.13. Phylogenetic analysis of human papillomavirus isolates 
Phylogenetics is the study of phylogeny, which pertains to the evolutionary relationship among and 
within different organisms and species. Phylogenetics is linked to taxonomy, which is concerned with 
naming, describing, and classifying organisms (Balaban et al., 2019). Taxonomy relies on information 
gathered for phylogenetics during the classification of organisms. In phylogenetics, DNA sequencing 
methods such as Sanger sequencing or NGS investigate inheritable traits (Ambulos et al., 2016; Parker 
& Chen, 2017; Sanger et al., 1977). This results in a schematic postulate of the relationship between 
organisms, termed a phylogenetic tree, that reflects the evolutionary history of said organism (Balaban 
et al., 2019; Hirose et al., 2018). 
1.13.1. Sequence evolution 
Before the division of any cell, its genome must be duplicated to be inherited by the offspring. Despite 
proof-reading mechanisms, errors still occur in the replication process. In time, genomic mutations such 
as point-mutations accumulate as traces of evolutionary variances. Point-mutations include nucleotide 
substitutions, which are the exchange of one nucleotide by another, the insertion of one or more bases, 
and the deletion of one or more bases. To distinguish between specific point-mutations, the sequence 
of a common ancestor is necessary to decide whether an insertion or deletion has occurred. Therefore, 
when investigating the evolutionary relationship of HPV11, a prototype sequence is used as a reference 
to identify nucleic heterogeneity (Balaban et al., 2019; Hirose et al., 2018).  
Genomic mutations of DNA may also affect the amino acid sequence translated in protein-coding 
regions. Synonymous mutations occur if the nucleotide substitution does not alter the amino acid, and 
non-synonymous mutations occur when the nucleotide substitution changes the amino acid translated 
(Lebeuf-Taylor et al., 2019).  
23 
1.13.2. Multiple sequence alignment 
Sequence alignment is an important research field in bioinformatics as it guides crucial tasks such as 
phylogenetic analysis. A multiple sequence alignment is often used to analyse homologous sequences. 
An alignment is a data matrix where homologous characters of the sequence are aligned in columns to 
identify discrepancies (Chowdhury et al., 2017). 
1.13.3. Phylogenetic trees 
Molecular Evolutionary Genetics Analysis (MEGA) is an example of software that provides a powerful 
and flexible interface for conducting phylogenetic analyses (Hall, 2013). Phylogenetic trees are a 
practical way to present the evolutionary relationship between organisms as the genetic sequence of 
contemporary sequences evolved from a common ancestor (Balaban et al., 2019). A phylogenetic tree 
consists of a root, nodes, tips and branches. The shape in which the branches connect the tips, nodes 
and root is termed the tree's topology. The tips of the phylogenetic tree represent the descendant or 
current taxa, and the nodes represent a common ancestor. The root represents the DNA sequence of all 
the species' sole common ancestor in the data set. Phylogenetic trees can be rooted or unrooted. A rooted 
tree denotes a common ancestor, whereas an unrooted tree has no origin and does not hypothesise the 
ancestral line (Balaban et al., 2019). 
1.13.4. Types of phylogenetic methods  
Methods of tree reconstruction based on DNA sequences include maximum parsimony methods, 
evolutionary distances between sequences and approaches applying the maximum likelihood principle 
(Rusinko & McPartlon, 2017; Serdoz et al., 2017).  
Neighbor-Joining is a distance-based agglomerative clustering technique that takes a distance matrix 
detailing the distance between each pair of taxa as an input. Distance-based methods alter the sequence 
data into a pairwise similarity matrix to use during tree interpretation. The algorithm starts with a 
completely unresolved tree and iterates until the tree is resolved and branch lengths are established 
(Rusinko & McPartlon, 2017). The Neighbor-Joining method is suited for complex datasets comprising 
lineages with variable rates of evolution and permits correction for numerous substitutions. 
Additionally, the Neighbor-Joining method is suited for large input data sets and generates results in a 
small amount of time. However, due to the Neighbor-Joining tree being distance matrix based, the 
output information is often limited, and only one out of several possible trees are depicted depending 
on the model of evolution used (Kuhner & Felsenstein, 1994; Saitou & Nei, 1987). 
Parsimony reconstruction and maximum likelihood methods are both character-based methods that use 
all known evolutionary information, such as nucleotide substitutions, to identify the most likely 
24 
ancestral relationship (Serdoz et al., 2017). Character-based methods aim to create an algorithm for 
scoring the probability that a given tree would produce the observed sequences at its leaves. The 
algorithm then filters through the possible trees to identify a tree with the maximum probability of 
producing the correct results (Serdoz et al., 2017).  
The most popular character-based method when constructing a phylogenetic tree for HPV11 is the 
maximum likelihood method (Burk et al., 2011; Jelen et al., 2016). This algorithm provides 
probabilities that a particular evolutionary model has generated the observed data. This algorithm uses 
each position in a sequence alignment and considers all possible trees. The higher the probability of the 
sequence given, the more the tree is favoured until the maximum likelihood is determined. Since an 
evolutionary model can be chosen, this tree is suitable for a large variety of groups (Miguel Rocha & 
Ferreira, 2018; Serdoz et al., 2017). The supposed advantages of maximum likelihood methods include 
a lower variance rate compared to other methods, and it is rarely affected by errors during sampling. 
The method tends to be robust to several violations of evolutionary model assumptions, and even with 
short sequences, it outperforms alternate methods. However, the maximum likelihood method is 
computationally intensive, and the result is dependent on the model of evolution used (Miguel Rocha 
& Ferreira, 2018; Serdoz et al., 2017).  
1.14. Problem statement 
During a previous study conducted at the Division of Virology, UFS, a novel HPV11 lineage B isolate 
was identified, warranting investigation of further isolates for clarification of lineages currently in 
circulation (Makatsa, 2012). It is essential to characterise the current strains circulating amongst the 
community, compare the various lineages and sub-lineages with disease severity in future studies, and 
monitor the impact of the vaccination campaign on the circulating HPV types and guide vaccine 
development. Baseline data on circulating HPV genotypes may effectively monitor the impact of the 
vaccination program on the community. Also, determining the genotype of HPV responsible for RRP 
in patients may have prognostic implications. Hence, this study investigated HPV11 lineages circulating 
in patients with RRP and identify novel lineages. 
1.15. Aims and objectives 
The aim of this study is to genetically characterise HPV11 isolates from patients diagnosed with RRP 
treated at Universitas Academic Hospital, Free State, South Africa.  
To achieve these aims the following objectives were identified: 
• To determine the nucleotide sequence of the L1, URR, E5a/b and a segment of E2 genomic 
regions of HPV11 isolates from patients with RRP in the Free State, South Africa. 
25 
• To conduct phylogenetic analyses using sequence data from HPV11 isolates to determine the 
genetic relationship and to determine the presence of HPV11 variants and lineages. 
• To generate and analyse the whole genome sequences of novel HPV11 variants.  
26 
CHAPTER 2- Phylogenetic analysis of human papillomavirus type 11 
isolates  
2.1. Introduction 
HPV11 is a causative agent of RRP, a benign laryngeal neoplasm presenting mainly in children 
(Benedict & Derkay, 2021). To date, no published data on the HPV11 intratypic variants circulating in 
the Free State region is available. Therefore, phylogenetic analysis may aid in identifying circulating 
variants in patients with RRP.  
It is commonly accepted that natural selection influenced the evolution of organisms and their 
contemporary genes. An increasing number of DNA sequences are being analysed today, and the study 
of the ancestry of organisms and their phylogenetic trees is in high demand. A better understanding of 
phylogenetic trees and the evolutionary processes that they model is necessary to gain insight into how 
organisms have mutated. 
Phylogenetic analysis investigates evolutionary development in different species by analysing genome 
information such as DNA, deepening our knowledge of how different species' genomes develop 
(Charleston, 2013; Felsenstein, 1981; Hall, 2013). To date, over 220 HPV types have been identified 
and classified into different risk groups through phylogenetic analysis, according to The International 
HPV Reference Centre (Bernard et al., 2010; de Villiers et al., 2004) 
(https://www.hpvcenter.se/human_reference_clones). Although Sanger sequencing remains the gold 
standard for sequencing, especially when sequencing single genes, recent advances in NGS technology 
has led to NGS being applied as the preferential technology for several kinds of molecular studies and 
typing (Ambulos et al., 2016; Kocjan et al., 2015). 
Analysis of sequence heterogeneity across the complete genome of HPV is frequently used to identify 
HPV variants. The ORF nucleotide sequence coding for the L1 capsid protein is sufficient for 
classifying HPV types and is used to represent the whole genome variation due to its high level of 
conservation (Burk et al., 2011, 2013). However, there is a loss of clear resolution when the L1 sequence 
is used to identify intratypic HPV variants. To discriminate between different HPV11 lineages, the URR 
and a coding region such as the L1 ORF are necessary, but for clustering of sub-lineages, additional 
sequencing is required (Burk et al., 2011, 2013). Sequence data can be aligned to a prototype genome 
to identify nucleotide heterogeneity, and variant lineages and sub-lineages of HPV11 can be identified 
by the percentage of nucleotide differences in the complete genome. A nucleic acid change of 0.5%-
1.0% across the whole genome defines a variant sub-lineage, 1%-10% defines a variant lineage, and 
>10% defines a novel HPV type (Burk et al., 2011). In 2011, the circulating HPV11 variants were 
27 
classified as A1 and A2, and in 2016, whole-genome analysis of 78 HPV11 complete genomes revealed 
two additional sub-lineages (A3 and A4) and a novel lineage B (Burk et al., 2011; Jelen et al., 2016). 
Nucleotide variances in genomic DNA can lead to changes in translated gene products. Therefore, the 
amino acid sequence can also help study the evolutionary relationship between organisms (Charleston, 
2013; Felsenstein, 1981; Hall, 2013). 
Phylogenetic trees are constructed by use of sequence data and are helpful to depict the evolutionary 
relationships between organisms. Phylogenetic trees that reflect the evolutionary history of an organism 
is preferred (Charleston, 2013; Felsenstein, 1981; Hall, 2013). Finding an accurate phylogenetic tree 
for a set of related species with only DNA is complex. Statistical inference using statistical models and 
Markov models has helped scientists estimate how comparable a phylogenetic tree is to the actual 
phylogenetic tree for a specified set of DNA sequences (Charleston, 2013; Felsenstein, 1981; Hall, 
2013).  
Neighbor-Joining is a distance-based agglomerative clustering technique that takes a distance matrix 
detailing the distance between each pair of taxa as an input (Rusinko & McPartlon, 2017). The 
Neighbor-Joining method is suited for large, complex datasets comprising lineages with variable rates 
of evolution and permits correction for numerous substitutions and generates results in a small amount 
of time (Kuhner & Felsenstein, 1994; Saitou & Nei, 1987). 
However, maximum likelihood trees are preferred when constructing a tree for HPV11 isolates and use 
an explicit evolutionary model. This method provides probabilities that a particular evolutionary model 
will generate the observed data until the tree with the maximum likelihood is determined (Charleston, 
2013; Felsenstein, 1981; Hall, 2013). The method has been proven to outperform alternate methods 
(Charleston, 2013; Felsenstein, 1981; Hall, 2013). 
The current study explored phylogenetic relatedness and nucleotide variability among HPV11 isolates 
from patients diagnosed with RRP. The L1, URR, E5a/b and a segment of the E2 ORF were targeted 
for sequencing. The concatenated L1-URR is necessary to discriminate between HPV11 lineages (Burk 
et al., 2011), and according to a study published in 2016, the concatenated L1-URR-E5a/b can 
discriminate between different lineages and sub-lineages (Jelen et al., 2016). The 208bp region in the 
E2 ORF has also been suggested to represent whole-genome variation and could therefore be used to 
construct phylogenetic trees representative of the different lineages and sub-lineages (Jelen et al., 2016).  
Characterising the current circulating strains will aid in future disease severity studies, guide vaccine 
development and have prognostic implications. Hence, this study investigated HPV11 lineages and sub-
lineages circulating in patients with RRP.  
28 
2.2. Materials and methods 
2.2.1 Study samples  
During a previous study conducted at the Division of Virology at the University of the Free State, 
Bloemfontein, 94 laryngeal papilloma biopsies were collected from 2008 to 2018 and stored at -80℃ 
(ETOVS 194/2007 and ECUFS 6/2011) (Appendix 1). Informed consent for collection and storage of 
biopsies was obtained from each patient by Professor Seedat from the Department of 
Otorhinolaryngology, Faculty of the Health Sciences, University of the Free State. 
All samples were assigned a VBD number followed by the year of collection. DNA was extracted from 
each biopsy by use of the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the 
manufacturer’s instructions and stored at -20℃. Samples were screened for HPV DNA by PCR, 
targeting a region of the L1 ORF using the GoTaq ® Flexi DNA Polymerase mediated PCR 
amplification kit (Promega, Madison, USA) according to manufacturer’s instructions. Following PCR 
samples were cleaned with the Promega Wizard ® SV Gel PCR Clean-up System kit according to 
manufacturer’s instructions (Promega, Madison, USA). The positive reactors were genotyped by 
nucleotide sequence determination of the amplicon with the BigDye ® Terminator v 3.1 Cycle 
Sequencing kit (Thermo Fisher Scientific, Illinois, USA) and aligned with sequence data retrieved from 
GenBank using Basic Local Alignment Search Tool (BLAST) analysis. A novel HPV11 lineage B 
isolate identified in a previous study was also included in the current study (Makatsa, 2012). 
2.2.2 Study setting and population 
All tests were performed at the Division of Virology, Faculty of Health Sciences at the University of 
the Free State (UFS). The study population included patients diagnosed with RRP at the Universitas 
Academic Hospital, Bloemfontein, a referral hospital including patients mainly from the Free State 
province, but also from surrounding regions. Eighty-one isolates from 60 patients were available for 
this study. Additional sequence data for 28 geographically distinct representatives of each HPV11 
lineage, including lineages A and sub-lineages A1 to A4, and lineage B, were retrieved from GenBank 
(Appendix 2). The current study was approved by the Health Sciences Research Ethics Committee of 
the University of the Free State (UFS-HSD2019/1109/2708) (Appendix 3). 
2.2.3 Amplification of five human papillomavirus genomic regions 
PCR amplification of the complete L1 ORF, URR, E5a ORF and E5b ORF was performed with primers 
as described by Maver and colleagues (2011) summarised in Table 1. Primers flanking a segment of the 
E2 were designed according to whole genome HPV11 sequences retrieved from GenBank (Appendix 
4). Sequence data for the E2 ORF from 28 HPV11 isolates from different geographic distribution were 
29 
retrieved from GenBank and aligned using ClustalX v2.1 (Larkin et al., 2007). Primers were designed 
to amplify the 3’ of E2 to the 5’ of the NCR2 which is 208bp.  
The primers’ specificity was determined with BLAST analysis and are summarised in Appendix 5. The 
GC content and melting temperature (Tm) of the forward primer (HPV11-E2seg-F) and reverse primer 
(HPV11-E2seg-R) were determined with Thermo Fisher Scientific Tm calculator (Allawi & 
SantaLucia, 1997) and are summarised in Table 1. PCR amplification of the partial E2 ORF was 
performed with the designed primer pair which targets a region of approximately 331bp, flanking the 
target partial E2 ORF. Amplification of all samples was performed with the Applied Biosystems™ 
Proflex™ PCR system (Thermo Fisher Scientific, Illinois, USA). PCR amplification was performed 
using the Go Taq®G2 Hot Start Polymerase (Promega, Madison, USA) according to the manufacturer’s 
instructions.  
Briefly, all reaction mixtures were prepared in 200μl PCR reaction tubes. Each reaction comprised 4μl 
template HPV11 DNA, 10μl 5XGreen Go Taq® flexi buffer, 2mM MgCl2 solution, 0.2mM PCR 
nucleotide mix, 0.4μM forward primer, 0.4μM reverse primer, 1.25U Go Taq ® G2 Hot Start Polymerase 
and nuclease free water up to 50μl. A no template control was included in each PCR amplification run 
by replacing the template with nuclease free water during preparation of the reaction. PCR components 
are included in Table 2. 
PCR amplification conditions were as follows: initial denaturation at 95℃ for two minutes for one 
cycle, followed by 30 cycles of denaturation at 95℃ for 30 seconds, annealing at 47℃ for 30 seconds 
and elongation at 72℃ for two minutes. Lastly, final elongation at 72℃ for five minutes before cooling 
to 4℃ indefinitely.  
 
  
30 
Table 1: List of primers used for sequencing the L1, E5a/b, upper regulatory region (URR) and a segment of the E2 of 
human papillomavirus type 11 (HPV11). Primers HPV11-L1F, HPV11-L1R, HPV11-LCR-F, HPV11-LCR-R, HPV11-E5F 
and HPV11-E5R are modified from Maver et al., 2011. Primers HPV11-E2seg-F and HPV11-E2seg-R were designed 
according to whole genome HPV11 sequences retrieved from GenBank. 
Primer sequence GC Primer binding 
Region Primer name e f fTm 
(5'→3') e d
Gene size Amplicon size 
content site 
TGTTTTTATTACAG
a
HPV11‐L1F 32.00% 56.0 ℃ nt 5682–5706
GTTCTGACTTC
 L1 1,506bp 1,770bp
AAAACATACATAC
a
HPV11‐L1R 28.00% 55.4 ℃ nt 7451–7427
ACATTCCACAAA
CTACAGCCCCCAA
a
HPV11‐LCR‐F 55.56% 57.5 ℃ nt 7236–7253
ACGAA
 URR 756bp 823bp
CGTGGAGGCATCTT
a
HPV11‐LCR‐R 47.62% 58.5 ℃ nt 125–105
TACTTTC
AATACCACCCACC
a
HPV11‐E5F 50.00 % 56.4 ℃ nt 3772–3791
ATTAGGC
 E5a/b  g500bp 684bp
GGCTGACGCACGTT
b
HPV11‐E5R 58.82 % 56.2 ℃ nt 4455–4439
TAC
ACAGTGCAGCTAC
 c
HPV11-E2seg-F 50,00% 56.0 ℃ nt 3561 – 3580
GCCTATA
c
 E2 segment 208bp 331bp
TTGTACAGGCACTA
c
HPV11-E2seg-R 47.83% 60.1 ℃ nt 3891-3869
CCTCCATAC
 a
 Primers reported by Maver et al. , 2011.
 b 
Primers reported by Maver et al. , 2011 with modifications.
c
Primers designed according to geographically distinct whole genome human papillomavirus type 11 sequences retrieved from GenBank (GenBank Acc. No.
M14119.1; JN644141.1; JQ773408.1; MN788368.1; LN833187.1). 
 d 
Positions of the nucleotides determined with respect to the prototype human papillomavirus type 11 genome (GenBank acc. no. M14119.1).
 e 
Melting temperature (Tm) and GC content determined by Thermo Fisher Scientific Tm calculator (Allawi & SantaLucia, 1997).
 f 
Size determined with respect to the prototype human papillomavirus type 11 genome (GenBank acc. no. M14119.1).
 g
 The E5a/b region contains one overlapping nucleotide (E5a – nt3871-4146; E5b – nt4146-4370) and therefore consist of 500bp.
 
 
2.2.4 Agarose gel electrophoresis 
The size of the PCR amplicons generated during PCR amplifications were determined by separating 
5μl aliquots of PCR products with gel electrophoresis. A 1% agarose gel was used to determine the 
amplicon size and integrity of the amplicon generated by the PCR. A table summarising the preparation 
of agarose gels is included in Appendix 7. For all amplicons, a 1% gel was prepared with 1g Seakem® 
31 
LE agarose powder and 100ml of 1x Tris-Acetic acid- (ethylenediaminetetraacetic acid)- EDTA (TAE) 
buffer at pH 8.0 and the gel was electrophoresed at 90 volts (V) for 45 minutes. The preparation of TAE 
is included in Appendix 6. The agarose gel was stained with a GelRed nucleic acid gel stain (Thermo 
Fisher Scientific, Illinois, USA) (Appendix 8) and visualised with the BioRad Molecular Imager Gel 
Doc™ XR+ with Image Lab™ Software to determine the fragment sizes according to the known DNA 
size marker (BioRad, California, USA). The O’GeneRuler™ 100bp DNA ladder SM1173 and SM0333 
(Fermentas, Illinois, USA) containing DNA fragments from 100 to 10 000bp was used to estimate the 
size of the amplicons. Expected amplicon sizes varied, with the primers targeting the L1 ORF producing 
the largest amplicon (1770bp), followed by the primers targeting the URR (823bp), the E5a/b ORF 
(685bp) and the E2 segment (331bp).  
 
Table 2: Polymerase chain reaction (PCR) components for amplifying human papillomavirus type 11 (HPV11) L1 gene, 
E5a/b gene, and upper regulatory region (URR). 
PCR components Volume Final concentration
 5XGreen Go Taq® flexi buffer 10μl 1x
 MgCl2 solution, 25mM 4μl 2mM
 PCR nucleotide mix, 10mM each 1μl 0.2mM
 Forward primer: HPV11‐L1F (20pmol/μl) 1μl 0.4 μM
 Reverse primer: HPV11‐L1R (20pmol/μl) 1μl 0.4 μM
 GoTaq ®G2 Hot Start Polymerase (5U/μl) 0.25μl 1.25U
 Template DNA 4μl N/A
 Nuclease free water 28.75μl N/A
 Total 50µl N/A
 
2.2.5 Purification of PCR product 
Following electrophoresis, DNA amplicons were purified using the GeneJET PCR Purification Kit 
(Thermo Scientific, Illinois, USA) according to the manufacturer’s instructions. Briefly, equal amounts 
of binding buffer and PCR mixture were mixed thoroughly and transferred to the purification column 
before centrifuging for 60 seconds on the Eins-Sci E-C15-12.2 High Speed Micro Centrifuge (Eins Sci, 
South Africa) at 25200 relative centrifugal force (rcf) and discarding the flow-through. A 700µl aliquot 
of wash buffer was added to the purification column and centrifuged twice for 60 seconds (2520xrcf) 
and discarding the flow-through twice. The column was transferred to a 1,5ml microcentrifuge tube and 
32 
between 30µl to 50µl aliquots of elution buffer was added to the column. The tube was centrifuged at 
2520xrcf for 60 seconds and the column was discarded. The eluted DNA was stored at -20 ℃ until use.  
2.2.6 Determination of DNA concentration 
DNA concentration was determined with the NANODROP 2000 spectrophotometer (Thermo Fisher 
Scientific, Illinois, USA).  
2.2.7 Sequencing 
The nucleotide sequences of each amplicon were determined with Sanger sequencing to identify the 
nucleotide composition in order to identify the variant lineages and sub-lineages. Sequencing reactions 
were prepared with the BigDye Terminator v3.1 Sequencing Reaction kit according to the 
manufacturer’s instructions (Thermo Fisher Scientific, Illinois, USA). Briefly, the purified HPV 
isolates were diluted with nuclease-free water to 20 ng/µl. Sequencing primers were diluted with 
nuclease-free water to a concentration of 3.2pmol/µl.  
For the L1 ORF, four primers were used for sequencing as described by Maver and colleagues in 2011 
(Table 3). For the URR, primers used for the initial PCR as described in Table 1, with one additional 
primer (HPV11-LCR-FF, 5’- TTCGGTTGCCCTTACATACA -3’, nt7598 - 7617) were used as 
described by Maver and colleagues (2011). For E5a/b ORF and the E2 segment, primers used for the 
initial PCR as described in Table 1 were used. Each amplicon was sequenced using bidirectional 
sequencing. 
Table 3: List of primers used for sequencing the L1 gene of human papillomavirus type 11 (HPV11) from Maver et al., 2011. 
Primer sequence        
Region Primer name c  c b d dGC content Tm Primer binding site Gene size Amplicon size 
(5' → 3')
CGTAAACGTATTCC
a
HPV-11‐L1U1 29.17% 54.24℃ nt 5743 - 5766
CTTATTTTTT
871bp
TGATCTGTTATTAC
a
HPV-11‐L1U1R 37.50% 56.16℃ nt 6613 - 6590
CCCCTTTTAC
L1 1,506bp
TTTTATTTGCGAAA
a
HPV-11‐L1U2 30.00% 51.86℃ nt 6503- 6522
GGAACA
809bp
ACATATAAATAAC
a
HPV-11‐L1U2R 30.77% 56.30℃ nt 7311- 7286
ACAACACACTGAC
 a
 Primers reported by Maver et al. , 2011.
 b 
Positions of the nucleotides determined with respect to the prototype human papillomavirus type 11 genome (GenBank acc. no. M14119.1).
 c 
Melting temperature (Tm) and GC content determined by Thermo Fisher Scientific Tm calculator (Allawi & SantaLucia, 1997).
 d 
Size determined with respect to the prototype human papillomavirus type 11 genome (GenBank acc. no. M14119.1).
 
33 
A reaction mixture for every primer containing 2ul 5x sequencing buffer, 1ul BigDye v3.1 ready 
reaction, 1ul primer (3,2pmol/µl) was prepared. A total volume of 2µl diluted HPV DNA and 8µl of 
each reaction mixture was added to the well of the 96-well plate. The sequencing components for 
nucleotide determination of HPV11 isolates are included in Table 4. The plate was sealed with thermo-
adhesive film and briefly centrifuged. The plate was placed in the Applied Biosystems™ Proflex™ 
PCR system (Thermo Fisher Scientific, Illinois, USA) for DNA amplification. PCR amplification 
conditions were as followed: initial denaturation at 96℃ for one minute and one cycle, followed by 25 
cycles of denaturation at 96℃ for 10 seconds, annealing at 50℃ for five seconds and elongation at 
60℃ for four minutes before cooling to 4℃ until further use. 
Table 4: Sequencing reaction components for nucleotide determination of human papillomavirus type 11 (HPV11) isolates. 
Components Volume
 5 x Sequencing Buffer 2µl
 Primer (3,2pmol/µl) 1µl
 BigDye v3.1 1µl
 Template DNA 2µl
 Nuclease free water 4 µl
 Total 10µl
 
Following DNA amplification, ethanol/EDTA precipitation was performed. Nuclease free water and 
125mM EDTA was combined in a 2:1 ratio, and a 15µl aliquot of the diluted EDTA solution was 
added to each well. Thereafter, a 60µl aliquot of cold 96-100% ethanol stored at -20℃ was added to 
each well. A silicone cover was placed on the 96-well plate before briefly vortexing the plate. The 
plate was placed in the -20℃ freezer for five minutes. Afterwards, the plate was centrifuged at 
2720xrcf for 80 minutes at 4℃. After centrifugation, the supernatant was aspirated entirely without 
disturbing the pellet. A volume of 200µl cold 70% ethanol stored at -20℃ was added to each well. The 
plate was sealed and centrifuged at 2720xrcf for 40 minutes at 4℃. The liquid was aspirated without 
disturbing the pellet. The plate was then placed in the Applied biosystems™ Proflex™ PCR system 
(Thermo Fisher Scientific, Illinois, USA) at 94℃ for 25-40 seconds to evaporate ethanol. Lastly, a 
10µl aliquot Hi-Di was added to each well, and the samples were denatured at 95℃ for five minutes 
in the Applied biosystems™ Proflex™ PCR system (Thermo Fisher Scientific, Illinois, USA).  
The Applied Biosystems™ 3500Xl Genetic Analyzer (Thermo Fisher Scientific, Illinois, USA) was 
used to sequence all samples. Briefly, a primer, enzyme and four fluorescently labelled 
dideoxynucleotides triphosphates (ddNTPs) are added to the reaction. The ddNTPs emit light at 
different wavelengths when excited by a laser. This emission can be captured by a camera and 
34 
converted to a chromatogram. As the fluorescently labelled extension products pass the laser, each 
nucleotide is “called”. Raw sequence data were analysed as described below. 
2.2.8 Data analysis 
Analysis of nucleotide variation 
Sequence data for five regions, namely the L1- (1506bp), URR- (758bp), E5a- (276bp), E5b region 
(225bp) and a section from the 3’ of E2 to the 5’ of the NCR2 (208bp) was determined. The E5a/b 
region contains one overlapping nucleotide (E5a – nt3871-4146; E5b – nt4146-4370) and therefore 
consist of 500bp. Raw sequence data was manually verified with Unipro UGENE (Okonechnikov et 
al., 2012). Briefly, the ends of the reads were trimmed based on the quality value. Each region was 
sequenced bi-directionally, and the chromatograms of the filtered trimmed reads were aligned and 
inspected to correct for possible nucleotide-calling faults due to ambiguous peaks.  
Genomic variants and genomic positions in HPV11 L1-, E5a, E5b- and a segment of the E2 ORF and 
the URR were identified by comparing the sequence data with the prototype HPV11 genome (GenBank 
accession number M14119.1). For the URR, a corrected sequence with a 2bp insertion at genomic 
position 7717-7718 was used when determining genomic variants and genomic positions (Maver et al., 
2011). The nucleotide substitutions, nucleotide insertions, and nucleotide deletions were identified for 
the isolates sequenced in this study with respect to prototype strain (GenBank accession number 
M14119.1) by use of MEGA X software (Kumar et al., 2018).  
To estimate the percentage of variation within coding regions, the number of nucleotide variations 
compared to the A1 prototype sequence M14119.1 were converted into a percentage using the following 
equation: 
𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑛𝑢𝑐𝑙𝑒𝑜𝑡𝑖𝑑𝑒 𝑣𝑎𝑟𝑖𝑎𝑛𝑐𝑒𝑠 𝑤𝑖𝑡ℎ𝑖𝑛 𝑎 𝑠𝑝𝑒𝑠𝑖𝑓𝑖𝑐 𝑐𝑜𝑑𝑖𝑛𝑔 𝑟𝑒𝑔𝑖𝑜𝑛 𝑐𝑜𝑚𝑝𝑎𝑟𝑒𝑑 𝑡𝑜 𝑀14119.1
 × 100  
𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑛𝑢𝑐𝑙𝑒𝑜𝑡𝑖𝑑𝑒𝑠 𝑤𝑖𝑡ℎ𝑖𝑛 𝑠𝑝𝑒𝑠𝑖𝑓𝑖𝑐 𝑐𝑜𝑑𝑖𝑛𝑔 𝑟𝑒𝑔𝑖𝑜𝑛 𝑜𝑓 𝑀14119.1
Degree of divergence 
The degree of divergence was calculated using pairwise analysis of percentage divergence of 
nucleotides with MEGA X software using concatenated E5a/b-L1-URR sequences of sequences 
obtained in the current study and sequences retrieved from GenBank. Codon positions included were 
1st, 2nd, 3rd, and non-coding. All positions with less than 95% site coverage were removed using the 
pairwise deletion option. 
35 
Analysis of amino acid variation 
The amino acid data order was determined for the L1- (501aa), E5a- (91aa), and E5b region (74aa) with 
use of a codon chart included in Appendix 9. Amino acid variants in HPV11 L1-, E5a, E5b ORFs were 
identified by comparing the amino acid data with the prototype HPV11 (GenBank accession number 
M14119.1). 
Phylogenetic analysis 
All sequences were aligned with ClustalX v2.1. For L1 ORF sequence data, the ClustalX alignment 
file was exported to IQTree webserver (Trifinopoulos et al., 2016) to determine the best model for a 
reliable estimate maximum likelihood phylogeny with an ultrafast bootstrap of 1000. This model was 
used to construct all maximum likelihood phylogenetic trees using MEGA X software. Additional 
sequence data for geographically distinct representatives of each HPV11 lineage, including lineages 
A, sub-lineages A1 to A4, and lineage B retrieved from GenBank were also included in downstream 
phylogenetic analysis.  
Concatenated L1-URR and E5a/b-L1-URR sequences were generated with Geneious Prime software 
(https://www.geneious.com). To explore the phylogenetic relationship of the HPV isolates, maximum 
likelihood phylogenetic trees with a bootstrap of 1000 were constructed with the concatenated L1-
URR sequences and the concatenated E5a/b-L1-URR sequences. Phylogenetic trees were constructed 
with MEGA X software.  
To explore whether the 208bp region in the E2 ORF sequenced in this study represents whole-genome 
variation, a Neighbor-Joining phylogenetic tree and a maximum likelihood phylogenetic tree with a 
bootstrap of 1000 were constructed with MEGA X software. 
2.2.9 Ethical considerations 
Ethical clearance was obtained from the Health Sciences Research Ethics Committee of the UFS. All 
isolates used in this study were collected by Professor Seedat (UFS-HSD2019/1109/2708) and informed 
consent was obtained to store the isolates and use them for related studies (ETOVS 194/2007 and 
ECUFS 6/2011). No additional isolates were collected in this study. Permission to perform the study 
was be obtained from the Head of the Division of Virology and the Head of the School of Pathology 
(National Health Laboratory Service). 
 
  
36 
2.3. Results 
2.3.1 Patient data 
During previous studies at the Division of Virology at the University of the Free State, Bloemfontein, 
laryngeal papilloma biopsies were collected from 2008 to 2018. DNA extracted from each biopsy was 
screened for HPV DNA and positive reactors were genotyped. Over this 10-year period, 94 HPV11 
isolates from 70 patients diagnosed with RRP were identified. Eighty-one isolates from 60 patients were 
available for this study. Patient data is included in Appendix 1. 
2.3.2 L1 ORF amplification and sequencing 
PCR amplification of the L1 ORF was performed on all available isolates with primers HPV11-L1 and 
HPV11L1-R (Table 1). Eighty-one samples were purified, and separated with gel electrophoresis and 
72 samples had a band at the predicted size of approximately 1770bp confirming the presence of HPV11 
L1 DNA. The DNA concentration of the 72 samples ranged from 14.5ng/µl to 202.1ng/µl. DNA 
concentrations of all isolates are included in Table 5.  
Nucleotide sequences of each amplicon within the predicted size range was determined with Sanger 
sequencing. Nucleotide substitutions, insertions and deletions are summarised in Table 6. By comparing 
sequence data of isolates sequenced in the current study and the A1 prototype sequence L1 sequence, 
86 nucleotide substitutions were observed in 11 genomic regions. This included a C6028T in 69 isolates 
(all except VBD34/08, VBD28/14 and VBD04/11), C6831T in one isolate (VBD34/08), A7126C in 
one isolate (VBD23/10), A7131C in one isolate (VBD34/08). Additionally, isolates VBD34/08 and 
VBD28/14 had A5929G, T6296A, T6298C, T6949A, G7045A C7197T, and T7237C nucleotide 
substitutions. The maximum number of nucleotide substitutions in a single isolate, VBD34/08, was nine 
which is 0,6% of the complete L1 ORF. Only one of the 72 (1.4%) isolates, VBD04/11, was identical 
to the prototype.  
 
  
37 
Table 5: Quantitative estimation of DNA concentration revealed by Nanodrop spectrophotometer of human papillomavirus 
type 11 (HPV11) genomic regions including late region L1, upper regulatory region (URR), early region E5a/b and a segment 
of early region E2. 
Isolates with insufficient DNA for quantitative estimation of DNA concentration are marked in dark grey.  
 
VBD L1 (ng/µl) URR (ng/µl) E5a/b (ng/µl) E2 segment (ng/µl)
 01/10 103,5 81,2 77,8 68,4
 02/12 101,9 136,3 103,2 67,3
 04/11 72,2
 04/12 34 114 194 62,6
 07/10 16,7 79,8 142,9 67
 08/09 14,5 99,2 85,8 52,9
 08/13 27,9 109,3 28,7 104
 09/12 50,1 87,1 95,8 54,1
 12/18 44,4 80,8 92,8 58,4
 13/10 41,5 163,9 84,6 44
 14/09 49,75 126,8 92,7 58
 14/11 87,9 133,9 100,8 74,4
 15/10 81,4 100,3 108,9 60,3
 16/09 122,7 85,3 111,4 57,8
 16/10 110,2 66,9 117,9 56,1
 17/09 93,5 48,5 79,6 65,5
 17/10 76,8 106,1 71,1 76,6
 21/10 149,2 125,7 55,2 64,4
 23/10 124,1 159,7 112,4 117,5
 26/10 77,4 118 72 60,7
 30/11 119,9 76,3 32,7 71,3
 33/10 95,5 134,8 137,4 53,1
 33/11 89,7 423,9 33,9 42,1
 34/08 60,9 254 68,9 45,7
 34/10 143,5 84,1 133,9 77,4
 34/11 111,7 115,6 178,9 65,6
 35/11 140,1 147,1 93 54,6
 37/08 73,4 126 55,9 49
 37/10 112,6 117,9 69,8 67,9
 37/11 63,7 119,2 83,7 48,2
 37/12 27,4 122,6 54,7 63,6
 39/12 29,9 106,1 74,9 62,1
 41/11 102,9 135,8 95,1 54,4
 41/12 59,7 111,5 73,2 61,1
 45/08 75,2
 47/12 29 103,5 62,4 61,9
 48/10 86,6 122,9 51,1 67,8
 48/12 29,3 116,5 40,1 47,9
 49/08 35 138,8 53,2 51,7
 49/12 33,8 125,4 229,3 63,3
 52/09 104,7 115,3 136,7 51,1
 52/11 81,6 127,3 121,3 52,2
 54/08 71,1
 55/08 120,7 99,7
 58/11 27,2 73,8 77 47,6
 59/08 202,1 90,2 143,1 70,1
 59/09 153 142,5 209,2 49,2
 61/11 43 136,3 88,9 56,1
 62/11 88 142,1 95,5 52,9
 63/09 88,1 141,3 102,1 60,4
 63/11 100,4 108,5 108,7 63,1
 69/09 112,7 138,2 108,2 48,5
 74/09 77,6 92,9 97,9 58,1
 79/09 66,4 88 87,6 50,9
14/15 21,6 122,1 77,3 46
16/15 83,6 75,3 67 58,7
17/14 35,2 116,8 56,7 58,6
22/14 93,7 141,2 46,4 58,4
23/17 43,8 141,5 91,4 52,4
28/14 73,5 117,5 91,4 36,6
29/13 50,1 93,5 94,4 69,1
29/14 40 135 92,7 83,9
33/16 29,9 110,6 135,8 52,3
41/14 62 179,6 85,3 66
41/15 23,6 123,9 116,7 54,2
44/15 23,6 146,2 75,2 56,3
48/16 29,8 126,8 33,7 60,5
49/15 21,2 198,6 47,8 53,7
55/13 40,4 100,05 80,5 64,1
68/15 16 120,52 113,2 57,5
68/16 22,5 119,8 68,4 55,6
69/15 21,7
38 
Table 6: Sequence comparison of nucleotide variances among 72 human papillomavirus type 11 (HPV11) isolates L1 region 
against the HPV11 prototype with GenBank accession number M14119.1.  
Residues that differed to those of HPV11 L1 prototype are indicated by a white colour difference and the substituted base. 
L1 Genomic region
5 6 6 6 6 6 7 7 7 7 7
9 0 2 2 8 9 0 1 1 1 2
2 2 9 9 3 4 4 2 3 9 3
9 8 6 8 1 9 5 6 1 7 7
Base A C T T C T G A A C T
Isolate 
VBD 
Number
 12/18 T
23/17 T
68/16 T
48/16 T
33/16 T
68/15 T
49/15 T
41/15 T
44/15 T
16/15 T
14/15 T
41/14 T
28/14 G A C A A T C
17/14 T
22/14 T
29/14 T
55/13 T
29/13 T
 08/13 T
 48/12 T
 47/12 T
 39/12 T
 37/12 T
 09/12 T
 61/11 T
 62/11 T
 58/11 T
 52/11 T
 41/11 T
 37/11 T
 35/11 T
 49/12 T
 30/11 T
 34/11 T
 14/11 T
 04/11
 48/10 T
 33/10 T
 63/11 T
 02/12 T
 04/12 T
 26/10 T
 21/10 T
 23/10 T C
 01/10 T
 07/10 T
 17/10 T
 34/10 T
 79/09 T
 74/09 T
 15/10 T
 59/09 T
 63/09 T
69/15 T
 55/08 T
 34/08 G A C T A A C T C
 37/08 T
 08/09 T
 14/09 T
 41/12 T
 17/09 T
 49/08 T
 59/08 T
 69/09 T  
 16/10 T
 16/09 T
 52/09 T
 37/10 T
 33/11 T
 45/08 T
 13/10 T
 54/08 T
39 
2.3.3 URR amplification and sequencing 
Following the amplification of the L1 ORF, four isolates had insufficient DNA and were excluded from 
DNA amplification and nucleotide determination during downstream analysis. These included 
VBD04/11, VBD69/15, VBD45/08 and VBD54/08. 
PCR amplification of the URR was performed on the available isolates with primers summarised in 
Table 1. The remaining 68 samples were purified, and 5μl aliquots of the purified HPV11 DNA were 
separated with gel electrophoresis. The gel was visualised and 68 samples had a band at the predicted 
size confirming the presence of HPV11 URR DNA. The DNA concentration of the 68 samples ranged 
from 48.5ng/µl – 423.9ng/µl. DNA concentrations of all isolates are included in Table 5. 
Nucleotide sequences of each amplicon within the predicted size range were determined with Sanger 
sequencing using the same primers as for the initial PCR (Table 1) plus an additional primer HPV11-
LCR-FF. By comparing sequence data of isolates sequenced in the current study and the A1 prototype 
sequence URR sequence, 237 nucleotide substitutions could be observed in 23 genomic regions. 
Nucleotide substitutions, insertions, and deletions in the URR are summarised in Table 7. All isolates 
had a T7547C nucleotide substitution. Isolates VBD28/14 and VBD34/08 had A7289G, A7302C, 
G7319T, G7329C, G7349C, T7359C, T7411G, G7519T, C7536T, A7570C, A7591G, A7626C, 
T7646A, T7775G, G7780T, C7880T, C7928T, G29T, and C50T nucleotide substitutions. Other 
nucleotide substitutions included C7333A in 10 isolates, A7413C in 55 isolates, C7479T in 66 isolates. 
The maximum number of nucleotide substitutions per isolate was 20 in VBD34/08 and VBD28/14. Five 
nucleotide substitutions were detected in isolates VBD33/16, VBD68/15, VBD41/15, VBD41/14, 
VBD35/11, VBD59/09, VBD63/09, VBD16/09, VBD52/09, VBD37/10. A total of 118 nucleotide 
insertions were present among 58 isolates. The majority of isolates had a C (50/68, 73.5%) or CC (7/68, 
10.3%) insertion following genomic position 7575 (All except VBD44/15, VBD29/14, VBD55/13, 
VBD47/12, VBD39/12, VBD37/11, VBD34/11, VBD23,10, VBD74/09, VBD15/10, and VBD34/08). 
Only isolates with a C or CC insertion following genomic position 7575 had no nucleotide substitution 
at genomic position 7413. 
The maximum number of nucleotide insertions in an isolate was 28 in VBD28/14 in five genomic 
regions, followed by 27 in VBD34/08 in four genomic regions. Insertions in VBD28/14 included a 
GCACGC insertion following genomic position 7527, a C insertion following genomic position 7575, 
a GGCGCCA insertion following genomic position 7715, a TGGGTTG insertion following genomic 
position 7744, and a TTATCTC insertion following genomic position 7746. Insertions in VBD34/08 
included a GCACGC insertion following genomic position 7527, a GGCGCCA insertion following 
 
40 
Table 7: Sequence comparison of nucleotide variances among 68 human papillomavirus type 11 (HPV11) isolates upper 
regulatory region (URR) against the HPV11 prototype with GenBank accession number M14119.1.  
For the URR, a corrected sequence with a 2bp insertion at nt 7717-7718 was used when determining genomic variants and 
genomic positions (Maver et al., 2011). Residues that differed to those of HPV11 URR prototype are indicated by colour 
differences. White depicts nucleotide substitutions, yellow depicts nucleotide insertions and green depicts nucleotide deletions. 
Samples excluded from analysis are indicated in dark grey. 
 
URR Genomic region
Base A A G G C G T T A C T G T-G T C A A-C A A T T GCCC AAGTAT T T-G A-T G-T T G C C G C
Isolate 
VBD 
Number
 12/18 C T Del C C
23/17 C T Del C C
68/16 C T Del C C
48/16 C T Del C C
33/16 A C T Del C C
68/15 A C T Del C C
49/15 C T Del C C
41/15 A C T Del C C
44/15 T Del C
16/15 C T Del C C
14/15 C T Del C C
41/14 A C T Del C C
28/14 G C T C C C G T GCACGC C T C C G C A Del Del Del Del GGCGCCA TGGGTTG TTATCTC G T T T T T
17/14 C T Del C CC
22/14 C T Del C CC
29/14 T Del C
55/13 T Del C
29/13 C T Del C C
 08/13 C T Del C C
 48/12 C T Del C C
 47/12 T Del C
 39/12 T Del C
 37/12 C T Del C C
 09/12 C T Del C C
 61/11 C T Del C C
 62/11 C T Del C C
 58/11 C T Del C C
 52/11 C T Del C C
 41/11 C T Del C C
 37/11 T Del C
 35/11 A C T Del C C
 49/12 C T Del C C
 30/11 C T Del C C
 34/11 T Del C
 14/11 C T Del C C
 04/11
 48/10 C T Del C C
 33/10 C T Del C C
 63/11 C T Del C C
 02/12 C T Del C C
 04/12 C T Del C C
 26/10 C T Del C C
 21/10 C T Del C C
 23/10 T Del C
 01/10 C T Del C CC
 07/10 C T Del C CC
 17/10 T Del C CC
 34/10 C T Del C CC
 79/09 C T Del C C
 74/09 T Del C
 15/10 T Del C
 59/09 A C T Del C C
 63/09 A C T Del C C
69/15
 55/08 C T Del C C
 34/08 G C T C C C G T GCACGC C T C G C A Del Del Del Del GGCGCCA TGGGTTG TTATCTC G T T T T T
 37/08 C T Del C C
 08/09 C T Del C C
 14/09 C T Del C C
 41/12 C T Del C C
 17/09 C T Del C C
 49/08 C T Del C C
 59/08 C T Del C C
 69/09 C T Del C C
 16/10 C T Del C C
 16/09 A C T Del C C
 52/09 A C T Del C C
 37/10 A C T Del C C
 33/11 C T Del C CC
 45/08
 13/10 C T Del C C
 54/08
 
 
genomic position 7715, a TGGGTTG insertion following genomic position 7744, and a TTATCTC 
insertion following genomic position 7746. 
41 
50
29
7928
7880
7780
7775
7746-7747
7744-7745
7715-7716
7699
7692-7697
7684-7687
7682
7646
7626
7591
7575-7576
7570
7536
7547
7527-7528
7519
7506
7479
7413
7411
7359
7349
7333
7329
7319
7302
7289
There were 90 nucleotide deletions observed in the 68 isolates; 66 of the 68 (97%) isolates had a single 
nucleotide deletion at genomic position 7506 and isolates VBD28/14 and VBD34/08 each had 12 
nucleotide deletions at genomic positions 7682, 7684-7687, 7692-7697 and 7699. No isolates were 
identical to the prototype (GenBank accession number M14119.1). 
2.3.1 E5a/b ORF amplification and sequencing 
PCR amplification of the E5a/b ORF were performed on all available isolates with primers summarised 
in Table 1. One isolate, VBD55/08, had insufficient DNA for downstream analysis.  
Samples were purified, and 5μl aliquots of the purified HPV11 DNA were separated with gel 
electrophoresis and visualised. Sixty-seven isolates had a band at the predicted size confirming the 
presence of HPV11 E5a/b DNA. The DNA concentration of the isolates ranged from 28.7 ng/µl–229.3 
ng/µl. All isolates DNA concentration are included in Table 5. 
Nucleotide sequences of each amplicon within the predicted size range were determined with Sanger 
sequencing using the same primers as for the initial PCR (Table 1). By comparing sequence data of 
isolates sequenced in the current study and the A1 prototype sequence E5a/b sequence, 166 nucleotide 
substitutions could be observed in 15 genomic regions (Table 8). These included A3891C in one isolate 
(VBD23/10), A3952T and G3991C in all 67 isolates, A4142C in 11 isolates, G4325T in one isolate 
(VBD48/10), and A4344G in one isolate (VBD68/16). Additionally, isolates VBD34/08 and VBD28/14 
had C3902G, A3978G, A3993T, T4048C, C4166G, C4227T, A4274C, C4312A, and C4333T 
nucleotide substitutions. 
The maximum number of nucleotide substitutions was 11 in isolates VBD28/14 and VBD34/08, which 
is 2.2% of the complete E5a/b ORF, followed by four nucleotide substitutions in VBD23/10, which is 
0.8% of the complete E5a/b ORF. All isolates had nucleotide substitutions at genomic position 3952 
and 3991. No nucleotide insertions or nucleotide deletions were observed compared to GenBank 
accession number M14119.  
 
 
  
42 
Table 8: Sequence comparison of nucleotide variances among 67 human papillomavirus type 11 (HPV11) isolates E5a/b 
region against the HPV11 prototype with GenBank accession number M14119.1.  
Residues that differed to those of HPV11 E5a/b prototype are indicated by a white colour difference and the substituted base. 
Samples excluded from analysis are indicated in dark grey. 
E5a/b Genomic region
3 3 3 3 3 3 4 4 4 4 4 4 4 4 4
8 9 9 9 9 9 0 1 1 2 2 3 3 3 3
9 0 5 7 9 9 4 4 6 2 7 1 2 3 4
1 2 2 8 1 3 8 2 6 7 4 2 5 3 4
Base A C A A G A T A C C A C G C A
Isolate 
VBD 
Number
 12/18 T C
23/17 T C
68/16 T C G
48/16 T C
33/16 T C
68/15 T C
49/15 T C
41/15 T C
44/15 T C C
16/15 T C
14/15 T C
41/14 T C
28/14 G T G C T C G T C A T
17/14 T C
22/14 T C
29/14 T C C
55/13 T C C
29/13 T C
 08/13 T C
 48/12 T C
 47/12 T C C
 39/12 T C C
 37/12 T C
 09/12 T C
 61/11 T C
 62/11 T C
 58/11 T C
 52/11 T C
 41/11 T C C
 37/11 T C C
 35/11 T C
 49/12 T C
 30/11 T C
 34/11 T C C
 14/11 T C
 04/11
 48/10 T C T
 33/10 T C
 63/11 T C
 02/12 T C
 04/12 T C
 26/10 T C
 21/10 T C
 23/10 C T C C
 01/10 T C
 07/10 T C
 17/10 T C
 34/10 T C
 79/09 T C
 74/09 T C C
 15/10 T C C
 59/09 T C
 63/09 T C
69/15
 55/08
 34/08 G T G C T C G T C A T
 37/08 T C
 08/09 T C
 14/09 T C
 41/12 T C
 17/09 T C
 49/08 T C
 59/08 T C
 69/09 T C
 16/10 T C
 16/09 T C
 52/09 T C
 37/10 T C
 33/11 T C
 45/08
 13/10 T C
 54/08  
43 
2.3.2 E2 ORF amplification and sequencing 
PCR amplification of the E2 ORF segment was performed on all available isolates with designed 
primers (Table 1). The 67 available samples were purified, and a 5μl aliquot of the purified HPV11 
DNA was separated with gel electrophoresis. All the isolates had a band at the predicted size confirming 
the presence of target DNA. The DNA concentration ranged from 36.6 ng/µl – 117.5 ng/µl. DNA 
concentrations of all isolates are included in Table 5. 
Nucleotide sequences of each amplicon were determined with Sanger sequencing using the same 
primers as for the initial PCR (Table 1). Among the 67 isolates, 144 nucleotide substitutions were 
observed by comparing sequence data of isolates sequenced in the current study and the E2 segment of 
the A1 prototype. Nucleotide substitutions are summarised in Table 9. Nucleotide substitutions were 
observed in 11 genomic regions. These included A3633C in 65 isolates (all except VBD34/08 and 
VBD28/14), A3652G in all 67 isolates, T3672C in one isolate (VBD62/11), C3705A in one isolate 
(VBD61/11), A3738T in one isolate (VBD14/11), G3758C in one isolate (VBD29/14), A3779C is one 
isolate (VBD74/09), and A3827G in one isolate (VBD34/08). Isolates VBD34/08 and VBD28/14 had 
G3638C, C3788T, A3821G nucleotide substitutions. 
The maximum number of nucleotide substitutions in the 208bp gene segment of the E2 was five (5/208, 
2.4%) nucleotide substitutions in VBD34/08 and four (4/208, 1.9%) nucleotide substitutions in 
VBD28/14. No nucleotide insertions or nucleotide deletions were observed. No isolates were identical 
to the prototype (GenBank accession number M14119.1).  
2.3.3 Analysis of amino acid variations 
Analysis of L1 ORF sequences 
The L1 gene contains 501 amino acids. By comparing the amino acid of isolates sequenced in the 
current study and the A1 prototype, six nucleotide substitutions were identified as synonymous, and 
five as non-synonymous. Non-synonymous nucleotide substitutions resulted in four amino acid 
substitutions.  
Nucleotide substitutions changed the amino acid sequence of two isolates, namely VBD28/14 and 
VBD34/08. Both isolates contained T6296A and T6298C nucleotide substitutions causing a serine (S) 
to a threonine (T) amino acid substitution and a C7197T nucleotide substitution causing an alanine (A) 
to a valine amino acid substitution and only VBD34/08 contained a C6831T nucleotide substitution 
causing a S to a leucine (L) amino acid substitution and a A7131C nucleotide substitution causing a 
glutamic acid (E) to an A. 
44 
Table 9: Sequence comparison of nucleotide variances among 67 human papillomavirus type 11 (HPV11) isolates E2 segment 
against the HPV11 prototype with GenBank accession number M14119.1.  
Residues that differed to those of HPV11 E2 segment prototype are indicated by a white colour difference and the substituted 
base. 
E2 Genomic region
3 3 3 3 3 3 3 3 3 3 3
6 6 6 6 7 7 7 7 7 8 8
3 3 5 7 0 3 5 7 8 2 2
3 8 2 2 5 8 8 9 8 1 7
Base A G A T C A G A C A A
Isolate 
VBD 
Number
 12/18 C G
23/17 C G
68/16 C G
48/16 C G
33/16 C G
68/15 C G
49/15 C G
41/15 C G
44/15 C G
16/15 C G
14/15 C G
41/14 C G
28/14 C G T G
17/14 C G
22/14 C G
29/14 C G C
55/13 C G
29/13 C G
 08/13 C G
 48/12 C G
 47/12 C G
 39/12 C G
 37/12 C G
 09/12 C G
 61/11 C G A
 62/11 C G C
 58/11 C G
 52/11 C G
 41/11 C G
 37/11 C G
 35/11 C G
 49/12 C G
 30/11 C G
 34/11 C G
 14/11 C G T
 04/11
 48/10 C G
33/10 C G
 63/11 C G
 02/12 C G
 04/12 C G
 26/10 C G
 21/10 C G
 23/10 C G
 01/10 C G
 07/10 C G
 17/10 C G
 34/10 C G
 79/09 C G
 74/09 C G C
 15/10 C G
 59/09 C G
 63/09 C G
69/15
 55/08
 34/08 C G T G G
 37/08 C G
 08/09 C G
 14/09 C G
 41/12 C G
 17/09 C G
 49/08 C G
 59/08 C G
 69/09 C G
 16/10 C G
 16/09 C G
 52/09 C G
 37/10 C G
 33/11 C G
 45/08
 13/10 C G
 54/08
45 
Analysis of E5a/b ORF sequences 
The E5a gene (nt 3871-4146) contains 91 amino acids and the E5b gene (nt 4146-4370) contains 73 
amino acids. Three nucleotide substitutions were identified as synonymous and 12 substitutions were 
identified as non-synonymous by comparing the amino acid of isolates sequenced in the current study 
and the A1 prototype. Eleven amino acid substitutions were observed. Non-synonymous substitutions 
included A3891C nucleotide substitution causing a glutamine (Q) to isoleucine (I) amino acid 
substitution in one isolate (VBD23/10), A4142C nucleotide substitution causing Q to proline (P) amino 
acid substitution in 11 isolates (VBD44/15, VBD29/14, VBD55/13, VBD47/12, VBD39/12, 
VBD41/11, VBD37/11, VBD34/11, VBD23/10, VBD74/09 and VBD15/10), and A4344G nucleotide 
substitution causing a N to aspartic acid (D) amino acid substitution in one isolate (VBD68/16). All 
isolates contained a A3952T and G3991C nucleotide substitutions causing an I to phenylalanine (F) and 
a valine to L amino acid substitution, respectively.  
Isolates VBD28/14 and VBD34/08 had the most non-synonymous substitutions including C3902G 
nucleotide substitution causing an A to glycine (G) amino acid substitution, A3952T nucleotide 
substitution causing an I to F amino acid substitution, G3991C and A3993T nucleotide substitution 
causing valine to L amino acid substitution, C4166G nucleotide substitution causing a histidine to Q 
amino acid substitution, C4227T nucleotide substitution causing a L to F amino acid substitution, 
A4274C nucleotide substitution causing a lysine (K) to asparagine (N) amino acid substitution, C4312A 
nucleotide substitution causing a T to N amino acid substitution, and C4333T nucleotide substitution 
causing a S to L amino acid substitution. 
2.3.4 Phylogenetic analysis 
Four phylogenetic trees were constructed to explore the phylogenetic relationship of the HPV11 isolates 
sequenced in this study. Neighbor-Joining phylogenetic trees and maximum likelihood trees were 
constructed with sequences obtained in this study and 28 sequences retrieved from GenBank of 
geographically distinct HPV isolates belonging to different (sub)lineages.  
Isolates with GenBank accession numbers M14119.1, LN833187.1, LN833185.1, LN833184.1, 
LN833183.1, LN833169.1, LN833165.1, LN833161.1, KU298879.1, JQ773412.1, JQ773411.1, 
JQ773409.1, JQ773408.1, JN644141.1, HE611263.1, HE574702.1, FR872717.1, FN907963.1, 
FN907962.1, FN870021.1, EU918768.1, MN788368.1, MK463921.1, MK463916.1, MK463914.1, 
MK313767.1, MK313765.1, and MK313763.1 were included. Lineage and sub-lineage representatives 
are summarised in Table 10. 
 
46 
Table 10: GenBank accession numbers of human papillomavirus type 11 (HPV11) isolates and the (sub)lineage 
representation.  
GenBank Accession number Lineage and sub-lineage representatives
M14119.1  Sub-lineage A1
LN833161.1  Sub-lineage A2
Lineage A
LN833169.1  Sub-lineage A3
LN833187.1  Sub-lineage A4
LN833183.1                                  Lineage B
 
 
Maximum Likelihood method 
The evolutionary history was deduced using the maximum likelihood method. The Tamura-Nei model 
was determined as the best model for a reliable estimate maximum likelihood phylogeny with an 
ultrafast bootstrap of 1000. The trees with the highest log-likelihood for concatenated L1-URR (-
10510,15) and E5a/b-L1-URR (-11642,10) are depicted in Figure 4 and Figure 5, respectively.  
Analysis of concatenated L1-URR involved 96 nucleotide sequences, including 68 isolates sequenced 
in this study and 28 sequences of geographically distinct isolates retrieved from GenBank. Results 
revealed that analysis of concatenated L1-URR resolved into two lineages, namely the lineage A and 
lineage B. The majority of isolates (49/68, 72.0%) clustered together with a 94% certainty in the 
bootstrap test.  
Analysis of concatenated E5a/b-L1-URR involved 95 nucleotide sequences. Sixty-seven sequences 
obtained in this study, and 28 sequences retrieved from GenBank from geographically distinct isolates. 
HPV11 concatenated E5a/b-L1-URR resolved into two lineages, namely lineage A and lineage B. The 
majority of the isolates sequenced in this study (48/67, 71.6%) clustered with the A2 prototype 
LN833161.1 and revealed a 97% certainty in the bootstrap test. Seven isolates from this study, clustered 
with one isolate (retrieved from GenBank) previously identified as an A2 sub-lineage isolate with an 
82% certainty in the bootstrap test (Jelen et al., 2016).  
Three isolates previously identified as A1 sub-lineage isolates (EU918768.1, FN870021.1 and 
FN907963.1), did not closely cluster together. No isolates sequenced in this study clustered with the A3 
and A4 prototype strains.  
47 
Lineage A 
Figure 4: Phylogenetic tree of human papillomavirus 
type 11 (HPV11) based on alignment of 96 nucleotide 
sequences of HPV11 concatenated L1-URR. This 
analysis involves 68 isolates sequenced in this study 
and 28 sequences of geographically distinct isolates 
retrieved from GenBank.  
M14119.1 (blue) was used as a representative of sub-
 
lineage A1, LN833161.1 (green) as a representative of 
Lineage B sub-lineage A2, LN833169.1 (yellow) as a 
representative of sub-lineage A3, LN833187.1 (red) as 
 a representative of sub-lineage A4. Lastly, LN833183.1 
was used as a representative of lineage B. The 
maximum likelihood tree was constructed using MEGA 
 
X using the Maximum Likelihood method and Tamura-
Nei model.  
  
 
48 
Ten isolates from this study (VBD15/10, VBD29/14, VBD34/11, VBD37/11, VBD39/12, VBD44/15, 
VBD47/12, VBD55/13, VBD23/10 and VBD74/09) clustered with two (MK463921.1 and 
MK463916.1) sequences retrieved from GenBank with 99% and 100% certainty in the bootstrap test in 
HPV11 concatenated L1-URR and E5a/b-L1-URR data sets, respectively. The sub-lineage 
classification of these GenBank sequences are unknown.  
Seven isolates from the current study (VBD01/10, VBD07/10, VBD17/10, VBD17/14, VBD22/14, 
VBD33/11, and VBD34/10) clustered with isolates FN907963.1 and FN907962.1 with a 98% and 99% 
certainty in the bootstrap test in HPV11 concatenated L1-URR and E5a/b-L1-URR data sets, 
respectively. However, FN907963.1 has been previously identified as sub-lineage A1 and FN907962.1 
as sub-lineage A2. One confirmed A1 sub-lineage isolate (EU918768.1) retrieved from GenBank shared 
a node with confirmed A2 sub-lineage isolates with a 95% certainty in the bootstrap test. In both 
concatenated L1-URR and E5a/b-L1-URR sequences, three lineage B isolates, one from GenBank 
(LN833183.1) and two from the current study (VBD34/08 and VBD28/14), clustered together in the 
bootstrap test with 100% certainty with one isolate being identical to the previously identified lineage 
B isolate.  
Pairwise analysis of percentage divergence of nucleotides  
Analyses were performed with the use of the Maximum Composite Likelihood model and included 95 
nucleotide sequences and used the concatenated E5a/b-L1-URR data set. This includes 67 sequences 
obtained in this study, and 28 sequences retrieved from GenBank. All numbers were limited to three 
decimals. The pairwise analysis of percentage divergence of nucleotides using the human 
papillomavirus type 11 concatenated E5a/b-L1-URR data set is included in Appendix 10. 
Divergence from the A1 prototype M14119.1 ranged from minimum 0,087 (EU918768.1 and 
FN870021.1) to a maximum of 0,154 (VBD34/08, FN907962.1 and LN833183.1) with an average 
divergence of 0,119. Divergence from the A2 prototype LN833161.1 ranged from 0,001 (VBD02/12, 
VBD04/12, VBD08/09, VBD08/13, VBD09/12, VBD12/18, VBD13/10, VBD14/09, VBD14/11, 
VBD14/15, VBD16/10, VBD16/15, VBD17/09, VBD21/10, VBD23/17, VBD26/10, VBD29/13, 
VBD30/11, VBD33/10, VBD37/08, VBD37/12, VBD41/11, VBD41/12, VBD48/12, VBD48/16, 
VBD49/08, VBD49/12, VBD49/15, VBD52/11, VBD58/11, VBD59/08, VBD61/11, VBD62/11, 
VBD63/11, VBD69/09, HE611263.1, JN644141.1, JQ773409.1, MK313763.1, MN788368.1, 
VBD79/09) to 0,166 (VBD34-08 and LN833183.1) with an average divergence of 0,037. Divergence 
from the A3 prototype LN833169.1 ranged from 0,000 (LN833165.1) to 0,158 (LN833183.1) with an 
average divergence of 0,058. Divergence from the A4 prototype LN833187.1 ranged from 0,005 
(LN833165.1 and LN833169.1) to 0,159 (VBD34/08 and LN833183.1) with an average divergence of 
0,060. Divergence from the lineage B prototype LN833183.1 ranged from 0,000 (VBD34/08) to 0,166  
49 
Sub-lineage A2 
Sub-lineage A4 
Sub-lineage A3 
Sub-lineage A1 
 
 
Figure 5: Phylogenetic tree of human papillomavirus 
type 11 (HPV11) based on alignment of 95 nucleotide 
sequences of HPV11 concatenated E5a/b-L1-URR. This 
analysis involves 67 isolates sequenced in this study and 
28 sequences of geographically distinct isolates 
retrieved from GenBank.  
M14119.1 (blue) was used as a representative of sub-
lineage A1, LN833161.1 (green) as a representative of 
sub-lineage A2, LN833169.1 (yellow) as a 
representative of sub-lineage A3, LN833187.1 (red) as a 
Lineage B representative of sub-lineage A4. Lastly, LN833183.1 
(orange) was used as a representative of lineage B. The 
maximum likelihood tree was constructed using MEGA 
 
X using the Maximum Likelihood method and Tamura-
Nei model. 
 
50 
(VBD16/09, VBD33/16, VBD35/11, VBD37/10, VBD41/14, VBD41/15, VBD48/10, VBD52/09, 
VBD59/09, VBD63/09, VBD68/15, VBD68/16, FN870021.1, FR872717.1, JQ773408.1, JQ773409.1, 
JQ773411.1, JQ773412.1, KU298879.1, LN833161.1, LN833165.1, LN833169.1, LN833183.1, 
LN833184.1, LN833185.1, M14119.1, MK313763.1, MK313765.1, MK313767.1, MK463914.1) with 
an average divergence of 0,161. VBD28/14 had a divergence of 0,120 from LN833183.1 and VBD34/08 
(Appendix 10). 
Analysis of E2 segment as representative of whole genome variation 
The evolutionary history was inferred with the Neighbor-Joining method and the Maximum Composite 
Likelihood method and involved 95 nucleotide sequences. There were a total of 208 nucleotide 
positions in the final dataset. The phylogenetic trees are shown in Figure 6 and Figure 7. 
HPV11 E2 segment sequences clearly resolved into two lineages, namely the lineage A and lineage B. 
Sixty-five of the 67 isolates (97.0%) sequenced clustered together with the A2 prototype LN833161.1 
and revealed a 52% and 56% certainty in the bootstrap test the Neighbor-Joining and maximum 
likelihood  phylogenetic trees, respectively. Lineage B isolates clustered together with a 95% certainty 
in the bootstrap test in both the Neighbor-Joining and maximum likelihood phylogenetic trees. 
Four isolates clustered with the A1 prototype M14119.1 with 54% and 59% confidence according to 
the Neighbor-Joining and maximum likelihood methods, respectively. Analysis of estimates of 
evolutionary divergence between sequences revealed the minimum divergence from the A1 prototype 
M14119.1 was 0,000 (EU918768.1, FN870021.1, and FN907963.1), the maximum was 0,024 
(VBD34/08 and LN833183.1) (Appendix 11). 
Divergence from A2 prototype LN833161.1 ranged from 0,000 (VBD01/10, VBD02/12, VBD04/12, 
VBD07/10, VBD08/09, VBD08/13, VBD09/12, VBD12/18, VBD13/10, VBD14/09, VBD14/15, 
VBD15/10, VBD16/09, VBD16/10, VBD16/15, VBD17/09, VBD17/10, VBD17/14, VBD21/10, 
VBD22/14, VBD23/10, VBD23/17, VBD26/10, VBD29/13, VBD30/11, VBD33/10, VBD33/11, 
VBD33/16, VBD34/10, VBD34/11, VBD35/11, VBD37/08, VBD37/10, VBD37/11, VBD37/12, 
VBD39/12, VBD41/11, VBD41/12, VBD41/14, VBD41/15, VBD44/15, VBD47/12, VBD48/10, 
VBD48/12, VBD48/16, VBD49/08, VBD49/12, VBD49/15, VBD52/09, VBD52/11, VBD55/13, 
VBD58/11, VBD59/08, 59/09, VBD63/09, VBD63/11, VBD68/15, VBD68/16, VBD69/09, 
VBD69/15, VBD79/09, HE574702.1, HE611263.1, JN644141.1, JQ773409.1, KU298879.1, 
LN833184.1, LN833185.1, MK313763.1, MK313765.1, MK313767.1, MN788368.1) to 0,020 
(VBD34/08 and LN833183.1) (Appendix 11). 
No isolates sequenced in the current study clustered with the A3 or A4 prototype sequences. Divergence 
from the A3 prototype LN833169.1 ranged from 0,000 (LN833165.1) to 0,024 (VBD34/08 and 
51 
LN833183.1) (Appendix 11). The A4 prototype LN833187.1 contains a wobble nucleotide in the 208bp 
region of the E2 ORF. One nucleotide was substituted with the degenerative nucleotide ‘K’, which can 
be interpreted as either a G or a T. Therefore, the trees were constructed using both a G and a T and 
allocated LN833187.1(1) and LN833187.1 (2), respectively (Appendix 4).  
Divergence from LN833187.1_(1) ranged from 0,005 (VBD01/10, VBD02/12, VBD04/12, VBD07/10, 
VBD08/09, VBD08/13, VBD09/12, VBD12/18, VBD13/10, VBD14/09, VBD14/15, VBD15/10, 
VBD16/09, VBD16/10, VBD16/15, VBD17/09, VBD17/10, VBD17/14, VBD21/10, VBD22/14, 
VBD23/10, VBD23/17, VBD26/10, VBD29/13, VBD30/11, VBD33/10, VBD33/11, VBD33/16, 
VBD34/10, VBD34/11, VBD35/11, VBD37/08, VBD37/10, VBD37/11, VBD37/12, VBD39/12, 
VBD41/11, VBD41/12, VBD41/14, VBD41/15, VBD44/15, VBD47/12, VBD48/10, VBD48/12, 
VBD48/16, VBD49/08, VBD49/12, VBD49/15, VBD52/09, VBD52/11, VBD55/13, VBD/11, 
VBD59/08, VBD59/09, VBD63/09, VBD63/11, VBD68/15, VBD68/16, VBD69/09, VBD69/15, 
VBD79/09, EU918768.1, FN870021.1, FN907963.1, HE574702.1, HE611263.1, JN644141.1, 
JQ773409.1 KU298879.1, LN833161.1, LN833165.1, LN833169.1, LN833184.1, LN833185.1, 
LN833187.1_(2), M14119.1, MK313763.1, MK313765.1, MK313767.1, MN788368.1) to 0,020 
(VBD34/08 and LN833183.1) (Appendix 11).  
Divergence from LN833187.1_(2) ranged from 0,005 (LN833187.1_(1)) to 0,024 (VBD34/08 and 
LN833183.1) with an average divergence of 0,011. Divergence from LN833183.1 ranged from 0,000 
(VBD34/08) to 0,034 (FR872717.1, JQ773408.1, JQ773411.1, JQ773412.1, and MK463914.1) 
(Appendix 11). 
Three lineage B isolates (VBD34/08, VBD28/14 and, LN833183.1) clustered together in the bootstrap 
test with 95% certainty according to the bootstrap test in both the Neighbor-Joining and maximum 
likelihood phylogenetic trees. Divergence from ranged from 0,000 (VBD34/08) to 0,034 (FR872717.1, 
JQ773408.1, JQ773411.1, JQ773412.1 (Appendix 11). 
  
52 
Lineage A 
Lineage B 
 
Figure 6: Phylogenetic tree of human papillomavirus type 11 (HPV11) based on 95 nucleotide sequence alignments of 
HPV11 E2 segment. This analysis involves 67 isolates sequenced in this study and 28 sequences of geographically distinct 
isolates retrieved from GenBank.  
M14119.1 (blue) was used as a representative of sub-lineage A1, LN833161.1 (green) as a representative of sub-lineage 
 
A2, LN833169.1 (yellow) as a representative of sub-lineage A3, LN833187.1 (red) as a representative of sub-lineage A4. 
Lastly, LN833183.1 (orange) was used as a representative of lineage B. A single, double peak was denoted as a wobble 
nucleotide in the LN833187.1 genome sequence submitted to GenBank, and therefore for readability, the trees were 
constructed using both a G and a T and allocated LN833187.1(1) and LN833187.1 (2), respectively. The maximum 
likelihood tree was constructed using MEGA X using the Maximum Likelihood method and Tamura-Nei model. 
 
53 
Lineage A 
Lineage B 
Figure 7: Phylogenetic tree of human papillomavirus type 11 (HPV11) based on 95 nucleotide sequence alignments of 
 
HPV11 E2 segment. This analysis involves 67 isolates sequenced in this study and 28 sequences of geographically distinct 
isolates retrieved from GenBank.  
  M14119.1 (blue) was used as a representative of sub-lineage A1, LN833161.1 (green) as a representative of sub-lineage 
A2, LN833169 (yellow) as a representative of sub-lineage A3, LN833187.1 (red) as a representative of sub-lineage A4. 
Lastly, LN833183.1 (orange) was used as a representative of lineage B. A double peak was denoted as a wobble nucleotide 
  
in the LN833187.1 genome sequence submitted to GenBank, hence, the tree was constructed using both a G and a T and 
allocated LN833187.1(1) and LN833187.1 (2), respectively. The Neighbor-Joining tree was constructed using MEGA X. 
 
54 
2.4. Discussion 
During the course of this study, genome sequencing was used to identify unique HPV11 variants 
circulating in patients diagnosed with RRP treated at the Universitas Academic Hospital. HPV11 has a 
prevalence of 1% to 4% in cervical samples in various South African regions (Giuliano et al., 2015; 
Mbulawa et al., 2018). Several studies have reported HPV prevalence from different parts of South 
Africa (Giuliano et al., 2015; Mbulawa et al., 2018). However, very few studies have focused on the 
prevalence of HPV11 genetic variants in South Africa. Therefore, in the current study, we aimed to 
investigated HPV11 variants circulating in the study population by means of genomic sequencing of 
the L1, E5a/b and URR genes, which have been postulated to produce phylogenetic trees able to 
distinguish between lineages and sub-lineages (Jelen et al., 2016). In addition, the hypothesis that a 
208bp segment of the E2 genome generates tree topology which represents whole-genome variation 
was also challenged (Jelen et al., 2016). HPV11 variant investigation is essential, as it is unknown if 
genome variations may result in divergent infectivity rates, affects vaccine effectiveness, and disease 
prognosis. 
A previous study aiming to identify HPV6 variants in patients diagnosed with RRP in South Africa 
identified three novel HPV6 variants (Combrinck et al., 2012). Subsequent studies focusing on the 
molecular characterisation of HPV6 suggested that HPV6 sub-lineage B1 is associated with an 
increased risk of developing genital warts (Flores-Díaz et al., 2017). HPV11 variants circulating in 
South Africa are currently largely unknown and the common occurrence of HPV6 variants in patients 
diagnosed with RRP in South Africa, suggest that similar patterns may be observed with HPV11. 
Therefore, further investigative studies with regards to HPV 11 are warranted.  
Between 2008 and 2018, 94 HPV11 isolates were identified in patients diagnosed with RRP at the 
Universitas Academic Hospital in the Free State province of South Africa. Previously, a novel lineage 
B isolate was identified, necessitating further investigation (Makatsa, 2012). However, this isolate was 
not available for characterisation in the current study. In this study, the concatenated L1-URR and 
E5a/b-L1-URR genes were characterised genetically to discriminate between different (sub)lineages. 
Despite the proof-reading abilities of host cell polymerases, many SNPs were identified in isolates 
characterised in this study which likely reflect a difference in the HPV11 genome.  
Within the L1 ORF, which is generally considered a conserved region of the HPV genome, sequence 
variation was low, likely due to the slow genomic evolutionary rate, which is estimated to be 10−8 
nucleotide substitutions per site per year (Chen et al., 2009, 2011). The highest percentage of divergence 
from the A1 prototype M14119.1 was 0.6%, implying a variant sub-lineage as this region is often used 
to represent whole-genome variation (Burk et al., 2011). Ninety-five per cent (69/72) of sequences 
incorporating a C6028T substitution and only one isolate was identical to the A1 prototype M14119.1. 
55 
However, the L1 gene is generally only used to identify the type of HPV, and additional sequencing is 
required to identify variant lineages and sub-lineages reliably (Burk et al., 2011).  
Although nucleic acid changes may imply a variant lineage or sub-lineage, nucleic acid variances do 
not necessarily impact the function of the expressed protein. DNA alterations in an ORF may lead to 
alterations in the gene product if non-synonymous substitutions are present (Lebeuf-Taylor et al., 2019). 
Analysis of genome variances in the L1 ORF identified four non-synonymous substitutions in two 
isolates, namely VBD28/14 and VBD34/08. The L1 major capsid protein is highly immunogenic and 
has formed the basis of successful vaccines (Chabeda et al., 2018; Dadar et al., 2018). The L1 also 
mediates vital functions for virus survival, such as encapsulation of the papillomavirus genome, 
interaction with the host cell for infectious entry, and releasing the viral DNA into a new host cell (Barra 
et al., 2019; Benedict & Derkay, 2021). Consequently, amino acid changes may impact virus survival 
and the effectiveness of HPV11 targeted vaccines. 
Typically, evaluation of vaccine antibody responses is studied using serological assays. Sites of 
variation for the L1 region of HPV11 isolates analysed in this study were confined to a limited number 
of internal residues implying that the influence of these variances on recognition by L1-specific 
antibodies is likely to be insignificant, as indicated in a study on HPV16 (Pastrana et al., 2004). The 
consequences of these polymorphisms in the novel lineage B and sub-lineage A3 and A4 and antibody 
recognition following natural infection or vaccination by the present-day vaccines requires additional 
investigation. 
For HPV11 sub-lineage classification, sequencing of additional gene segments is required. Genomic 
sequencing of the E5a/b revealed a 2.2% divergence from the A1 prototype M14119.1 in VBD28/14 
and VBD34/08, and a 0.8% divergence from the prototype in VBD23/10. Most of the nucleotide 
substitutions were non-synonymous and resulted in amino acid alterations, which may interfere with 
the function of this protein (Lebeuf-Taylor et al., 2019). Proteins expressed by the E5a/b are each made 
up of 83 amino acids and are involved in many processes, including immune evasion, and regulating 
apoptosis. The E5a/b proteins also play a role in cell cycle pathways and influence cellular gene 
expression (Chagas et al., 2011; Zhang et al., 2018). 
Few studies have reported on gene mutations of E5 in HPV11, but studies on various HPV types have 
reported that non-synonymous mutations might lead to changes in polarity, hydropathic potential, and 
the amino acid side chain, which may alter protein folding (Halavaty et al., 2014; Hemmat & Baghi, 
2018; Venuti et al., 2011; Zhang et al., 2018). Point-mutations in E5 may inhibit cell transformation, 
hinder activation of the cyclin A pathway, and disrupt the acidification of endosomes. The E5 protein 
of HPV has also been proven to increases the expression level of hepatocyte growth factor receptors, 
which promotes transformed cell invasiveness and regulates the proliferation of infected cells (Halavaty 
56 
et al., 2014; Hemmat & Baghi, 2018; Venuti et al., 2011; Zhang et al., 2018). Conversely, studies have 
also demonstrated that the E5 ORF can tolerate many mutations and maintain the hydrophobic nature 
of E5, and that the conserved residues are sufficient to confer transforming activity (Mattoon et al., 
2001; Venuti et al., 2011). As E5 is necessary for many pathways, minor sequence variations between 
E5 proteins from different HPV11 lineages and sub-lineages may significantly impact the function of 
this protein. Thus, functional analysis of E5 in HPV11 may further decipher the effects of E5 mutations 
on the HPV virus life cycle. 
The URR is the most variable region within the HPV genome capable of accumulating and tolerating 
more nucleotide mutations as it does not encode proteins. The URR interacts with many cellular and 
viral factors and is involved with functions such as virus replication, gene expression, and transcription 
(Fang et al., 2020; Ribeiro et al., 2018). In the current study, the URR of 68 isolates was successfully 
sequenced, and genome analysis revealed 237 nucleotide substitutions, 118 nucleotide insertions and 
90 nucleotide deletions. Isolates VBD34/08 and VBD28/14 had the most nucleotide differences 
compared to the A1 prototype M14119.1, with both containing 20 nucleotide substitutions and 12 
nucleotide deletions. In addition, isolate VBD28/14 had the maximum number of nucleotide insertions 
of all isolates, 28, followed by 27 in VBD34/08. 
A correlation between the transcriptional activity of HPV11 variants and RRP disease severity have 
previously been reported (Gáll et al., 2013). HPV11 presents E2 binding sites distributed along the URR 
regions and various promotors. These promotors are regulated differently, which indicates that 
independent regulation of early proteins is essential for the viral life cycle (DiLorenzo & Steinberg, 
1995; Dollard et al., 1992; Stoler et al., 1989). Duplication in the early viral promoter sequence of 
HPV11 has been associated with a higher degree of disease severity and the genome alterations T7904A 
and thymine at position 7546, as in the A1 prototype sequence M14119.1, may have enhancer effects 
(Gáll et al., 2013). Due to the frequency of mutations in isolates from the current study, the functionality 
of binding sites in the URR may be impacted, affecting many cellular and viral factors. Although the 
URR is highly variable, the E2 transcription binding sites are reported to be highly conserved, and 
mutations are rarely found in these regions (Fang et al., 2020; Ribeiro et al., 2018). 
Analysis of the E2 genome segment sequenced in this study revealed that most isolates (60/67) had only 
two point-mutations, and only a few (7/67) isolates had other mutations. The maximum number of 
point-mutations was five in VBD34/08 (2,4%), followed by four in VBD28/14 (1,9%). The E2 protein 
regulates essential factors during the viral life cycle, such as replication, transcription, and viral genome 
partitioning. Therefore, the binding of the E2 protein to corresponding binding sites is necessary for 
viral survival (Graham & Faizo, 2017; Kardani & Bolhassani, 2018a; Wallace & Galloway, 2014). 
57 
Phylogenetic trees are a practical way to present the evolutionary relationship between organisms as the 
genetic sequence of contemporary sequences evolved from a common ancestor. Specific HPV11 
genomic regions have previously been used to identify genetic variants as they provide sufficient 
genetic variation to differentiate between HPV11 variants. In 2011, Maver and colleagues identified 
two clades based on the topology of the maximum likelihood phylogenetic tree, namely the prototypic 
and non-prototypic clades (Maver et al., 2011). Subsequently, Burk and colleagues defined a new HPV 
sub-lineage as a 0.5% to 1.0% variation from the complete genome (Burk et al., 2011). This study 
revealed two clades and that the maximum pairwise difference between variants is approximately 0.4%. 
They designated the two clades as sub-lineage A1 (previously termed prototypic variant group) and 
sub-lineage A2 (previously termed non-prototypic variant group) (Burk et al., 2011). Further 
comparative phylogenetic sequence analysis of isolates collected from Australia, Slovenia, China, 
Hungary, and Thailand revealed that the A2 sub-lineage predominates (Danielewski et al., 2013; Jelen 
et al., 2016). Results were further supported by a generally high degree of sequence conservation 
observed between diverse geographical regions throughout the world, suggesting that geographically 
specific variants were uncommon for HPV11 (Danielewski et al., 2013; Jelen et al., 2016; Maver et al., 
2011). However, the discovery of new (sub)lineages in geographically restricted areas contradicts 
previous assumptions that intratypic variants of HPV11 are not geographically restricted (Jelen et al., 
2016). 
An extensive study on the genomic diversity of HPV11 from six continents revealed an additional 
lineage B and two additional sub-lineages A3 and A4, for the first time (Jelen et al., 2016). Lineage B 
had a 1.3% maximal pairwise distance, sub-lineage A4 had a complete nucleotide pairwise difference 
of above 0.5%, and the two sub-lineage A3 isolates had a total nucleotide pairwise difference in the 
range of 0.5% (Jelen et al., 2016). Results were visualised with a heatmap, and the specific complete 
nucleotide pairwise difference was not mentioned. A single, double peak was denoted as a wobble 
nucleotide in the LN833187 genome sequence submitted to GenBank, and therefore, the exact sequence 
is unknown (Appendix 4). As in the current study, phylogenetic analysis of E5a/b ORF, the L1 ORF 
and the URR using the maximum likelihood method identified sub-lineage A2 as the predominant sub-
lineage globally (Jelen et al., 2016). For increased accuracy of phylogenetic analysis in the current 
study, 28 geographically distinct HPV11 representatives were included. Nonetheless, the tree topology 
generated in the present study did not correlate completely with that of the study published by Jelen and 
colleagues (Jelen et al., 2016).  
Phylogenetic analysis of the concatenated L1-URR and E5a/b-L1-URR sequences identified in this 
study and sequences retrieved from GenBank correctly resolved into two lineages: Lineage A and 
lineage B. However, sub-lineage classification was frequently unclear. For example, isolates previously 
identified as sub-lineage A1 (FN907963.1) and A2 (FN907962.1), did not cluster closely with the 
58 
corresponding prototypes and instead, clustered together. Seven isolates from the current study 
clustered with isolates FN907963.1 and FN907962.1 with great certainty in the bootstrap test, therefore, 
phylogenetic analysis of the concatenated L1-URR and E5a/b-L1-URR is unable to reliably classify 
these isolates.  
Neighbor-Joining and maximum likelihood trees were constructed using E2 segment data to determine 
whether E2 tree topology would be identical to phylogenetic trees constructed using concatenated 
E5a/b-L1-URR or L1-URR sequence data, and to determine whether the Neighbor-Joining tree and 
maximum likelihood tree based on E2 segment sequence data would generate similar results. Maximum 
likelihood tree construction is computationally intensive, therefore, using the Neighbor-Joining method 
would be advantageous to generate results fast when using large data sets and for bootstrap analysis. In 
this study, the E2 segment tree topology was not identical to the phylogenetic trees using either the 
concatenated E5a/b-L1-URR or L1-URR. For instance, slight but essential variations were observed in 
the maximum likelihood tree constructed using the E2 segment. EU918768.1, FN870021.1 and 
FN907963.1 clustered correctly with M14119.1 when using the E2 segment, but not the concatenated 
E5a/b-L1-URR or L1-URR segments. However, in the study published by Jelen and colleagues (2016), 
analysis of the complete and partial genomes revealed EU918768.1, FN870021.1 and FN907963.1 
clustered appropriately with the A1 prototype M14119.1. 
In this study, we used phylogenetic software to calculate evolutionary distances between sequences and 
identify correspondence regions by computing the proportion of nucleotide differences between each 
pair of sequences. Analysis revealed isolates highly analogous to reference strains LN833169, 
LN833187.1, LN833165.1 and LN833183.1 appropriately clustered, and the results collated with those 
observed in the phylogenetic tree topology. Further analysis revealed that lineage B isolates VBD34/08 
and LN833183.1 had the greatest divergence from the A1 prototype M14119.1, which is anticipated. 
Analysis of concatenated E5a/b-L1-URR revealed FN907962.1 as highly dissimilar, which is 
anomalous because FN907962.1 belongs to sub-lineage A2. LN833183.1 and VBD34/08 were the most 
different to LN833169.1 and LN833187.1, irrespective of the wobble nucleotide in the E2 segment. 
Analysis of estimates of evolutionary divergence between sequences revealed sub-lineage A2 isolates 
FR872717.1, JQ773408.1, JQ773411.1, JQ773412.1, and MK463914.1 were the most dissimilar to 
lineage B using concatenated E5a/b-L1-URR sequences and the E2 segment. However, the E2 segment 
also identified several other isolates belonging to various sub-lineages to be equally dissimilar.  
Discrepancies observed in this study may be due to the large number of additional isolates included in 
this study or differences in software used to analyse the sequence data. Jelen and colleagues (2016) used 
RAxML and Bayesian trees to produce phylogenetic trees with complete genome data, and RAxML 
HPC2 (version 8.1.11) and MEGA (version 5) software to identify the most informative areas for whole-
59 
genome-based phylogenetic clustering (Jelen et al., 2016). In the current study, MEGA X was used to 
analyse the most informative regions determined by Jelen and colleagues (2016).  
Results obtained in the current study supports the notion of whole-genome sequencing for HPV11 
classification below lineage level as a standard. Whole-genome sequencing generates more information 
regarding genetic variants and eliminates discrepancies seen in the current study. Concatenated L1-
URR, E5a/b-L1-URR sequences and the E2 segment had equivalent discriminatory power for lineage 
identification. However, concatenated E5a/b-L1-URR provides unclear results regarding sub-lineage 
classification. E2 Neighbor-Joining and maximum likelihood tree generated in this study generated a 
similar tree topology. Due to the inconsistencies and discrepancies observed in the phylogenetic tree 
topology using concatenated E5a/b-L1-URR, the sub-lineage classification of several isolates remained 
undetermined and therefore it is unclear whether tree topology using the E2 segment can reliably 
distinguish between sub-lineages. Investigations with a greater sample size are necessary to validate 
these findings. 
It is essential to characterise the current strains circulating amongst the community to compare the 
various lineages and sub-lineages with disease severity in future studies, monitor the impact of the 
vaccination campaign on the circulating HPV types, and guide vaccine development. In addition, 
baseline data on circulating HPV genotypes may effectively monitor the impact of the vaccination 
program on the community. Also, determining the genotype of HPV responsible for RRP in patients 
may have prognostic implications. 
  
60 
CHAPTER 3- Characterisation of novel human papillomavirus type 11 
isolates  
3.1. Introduction 
The identification and characterisation of potentially novel HPV lineages and sub-lineages has great 
public health significance (Sridhar et al., 2015). Little is known about the correlation between HPV 
lineages and sub-lineages and disease persistence, severity, prognosis, and malignant capability. The 
relevance of HPV variant classification has increased as HPV type and intratypic variants may possibly 
influence the course of disease (Gáll et al., 2013). 
In the last two decades, NGS has been the most frequently used technique for identifying novel HPV 
types and variants. NGS refers to high-throughput sequencing and is capable of massive parallel 
sequencing of various DNA molecules (Ambulos et al., 2016; Kocjan et al., 2015). This relatively new 
technology is quickly becoming an indispensable tool in laboratories for both the detection and 
characterisation of clinically important pathogens such as HPV. NGS surpasses more conventional 
detection methods such as Sanger sequencing by faster turnaround time and the improved depth of 
knowledge regarding serotyping (Ambulos et al., 2016; Kocjan et al., 2015; Parker & Chen, 2017). 
High-throughput sequencing is a powerful method that has been used to identify novel lineages and 
sub-lineages of HPV11 using a WGS approach. Complete genome sequencing using NGS and 
subsequent determination of percentage homology with known viral nucleotide sequences may aid in 
identifying novel lineages and sub-lineages (Sridhar et al., 2015).  
The classification of HPV into genera, species and types based on the L1 ORF is well established. A 
L1 sequence with >10% dissimilarity to any other deposited sequence is defined as a novel HPV type. 
A nucleotide variance of 0.5%-1.0% across the whole genome defines a variant sub-lineage, and a 
nucleotide variance of 1%-10% defines a variant lineage (Burk et al., 2011; Maver et al., 2011). 
However, the existence of a novel HPV variant is only confirmed when its complete genome is 
sequenced and deposited with the International HPV Reference Centre 
(https://www.hpvcenter.se/human_reference_clones), and the complete genome meets the 
classification requirements set by Burk and colleagues (2011).  
Recently, one new lineage and two new sub-lineages of HPV11 were described, warranting further 
investigation into the genetics and distribution of these lineages (Jelen et al., 2016). Previous reports 
suggested that concatenated E5a/b-L1-URR sequences, as well as a 208bp gene segment in the E2 
reportedly represent whole-genome variation and may be used to construct phylogenetic trees 
representative of the different lineages and sub-lineages (Jelen et al., 2016). Numerous isolates with 
61 
unique SNPs, amino acid changes and indels within the E5a/b, L1 and URR, as well as potential lineage 
B isolates were identified using phylogenetic investigations. However sub-lineages could not be 
conclusively defined, suggesting that a novel lineage and sub-lineage requires a complete genome 
according to the classification and nomenclature system proposed previously (Bernard et al., 2010; 
Burk et al., 2013; Chen et al., 2011; de Villiers et al., 2004; Siqueira et al., 2016). Therefore, in the 
current chapter, whole genome sequences of selected isolates were determined using NGS and the 
genetic relationships analysed. In addition, the hypothesis that the partial genome sequences, as 
obtained in Chapter 2, generates tree topology which represents whole-genome variation is challenged 
(Jelen et al., 2016). Data on novel lineages and sub-lineages of HPV may contribute to future 
evolutionary- and vaccine studies, aid in vaccine development, and give insight into the pathogenicity 
of HPV11. 
3.2. Materials and methods 
3.2.1. Study samples 
Sample selection 
Four isolates with unique SNPs, amino acid changes or indels within the E5a/b, L1 and URR were 
selected for whole-genome sequencing based on results from the phylogenetic analysis described in 
Chapter 2. Isolates which did not cluster closely with sub-lineage prototype sequences, as well as a 
possible lineage B isolate were selected for whole genome sequencing. Isolates included VBD28/14, 
VBD15/10, VBD74/09 and VBD01/10. Two isolates, VBD74/09 and VBD15/10, were isolated from 
one patient collected approximately five months apart to determine whether HPV11 experienced any 
nucleotide mutations between sample collection dates. Information on the selected isolates, including 
the date of birth, date of diagnosis, date of sample collection and sex, is summarised in Table 13. 
Informed consent for collection and storage of biopsies was obtained from each patient by Professor 
Seedat from the Department of Otorhinolaryngology, Faculty of the Health Sciences, UFS.  
HPV11 genome sequences retrieved from GenBank  
Complete genome sequence data for 28 geographically distinct representatives of each HPV11, sub-
lineages A1, A2, A3 and A4, and lineage B, were retrieved from GenBank (Appendix 2). This included 
the following isolates with GenBank accession numbers: M14119.1, LN833187.1, LN833185.1, 
LN833184.1, LN833183.1, LN833169.1, LN833165.1, LN833161.1, KU298879.1, JQ773412.1, 
JQ773411.1, JQ773409.1,JQ773408.1, JN644141.1, HE611263.1, HE574702.1, FR872717.1, 
FN907963.1, FN907962.1, FN870021.1, EU918768.1, MN788368.1, MK463921.1, MK463916.1, 
MK463914.1, MK313767.1, MK313765.1, and MK313763.1. Isolate M14119.1 was used as the sub-
lineage A1 representative, LN833161.1 was used as the sub-lineage A2 representative, LN833169 was 
62 
used as the sub-lineage A3 representative, LN833187 was used as the sub-lineage A4 representative, 
and LN833183 was used as the lineage B representative. Sequence length ranged from 7932bp to 
7949bp and is summarised in Appendix 2. 
Ethical clearance was obtained from the Health Sciences Research Ethics Committee of the UFS (UFS-
HSD2019/1109/2708) (Appendix 3). 
3.2.2. Full‐genome amplification and sequencing 
The complete genome was determined by amplifying two overlapping DNA fragments representing the 
complete HPV11 genome. Primers used for amplification are summarised in Table 11 (Jelen et al., 
2016). Visual representation of overlapping fragments is depicted in Figure 8. For both overlapping 
PCR fragments, a Phusion ® High-Fidelity PCR kit (Thermo Scientific, Illinois, USA) was utilised 
according to the manufacturer's instructions. Contents of the reaction mixture are summarised in Table 
12. The cycling conditions were carried out as follows: 98°C for two minutes, followed by 40 cycles of 
98°C for 10 seconds, 53.5°C for 30 seconds, and 72°C for three minutes. The final extension step was 
carried out at 72°C for eight minutes before cooling to 4°C.  
 
Table 11: List of primers used for sequencing full-length human papillomavirus type 11 (HPV11) genome in two overlapping 
fragments. 
Primer sequence GC Primer binding Amplicon 
Region Primer name  c
c Tm b d
content site size 
5’ → 3’
3′ end of the E2 a TTACAACAAGC
HPV-11-S2F 38.10% 60.1℃ nt 3529 to 3549
ORF, the E5a/b ACCAAAGAAG    
ORF, the L2 ORF, 
4851bp
the L1 ORF, the 
URR, and the 5′ TTCTATTTCACA
a
end of the E6 ORF HPV-11-S2R 40.00% 60.7℃ nt 427 to 446CAACGGCT
HPV-11-
3′ end of the L1 GGATATGAGTTT
a 42.86% 60.7℃ nt 7084 to 7104
ORF, the URR, the S1MS-F TTGGGAGGT
E6 ORF, the E7 
4,521bp
ORF, the E1 ORF, 
and a segment of HPV-11- ATGCCACGTTGA
a 45.00% 62.9℃ nt 3660 to 3679
the E2 ORF S1MS-R AGATGCTA
a
 Primers reported by Jelen et al. , 2016.
b
Positions of the nucleotides determined with respect to the prototype human papillomavirus type 11 genome
(GenBank acc. no. M14119).
c
Melting temperature (Tm) and GC content determined by Thermo Fisher Scientific Tm calculator (Allawi &
SantaLucia, 1997).
d 
Size determined with respect to the prototype human papillomavirus type 11 genome (GenBank acc. no. M14119).
63 
Table 12: Polymerase chain reaction (PCR) components for amplifying human papillomavirus type 11 full-length genome in 
two overlapping fragments (E1 to L1 genes; L1 to E1 genes).  
Component Volume Final concentration
Phusion DNA polymerase 0,5µl 1,0 units
5 x Phusion HF Buffer 10µl 1X
10µM Forward primer 2,5µl 0,5µM
10µM Reverse primer 2,5µl 0,5µM
10mM dNTPs 1µl 200µM
Template DNA 5µl N/A
Nuclease free water 27,5µl N/A
Total 50µl N/A
 
 
 
M14119.1 
7933bp 
 
Figure 8: Genome organisation of a low-risk human papillomavirus type 11 (HPV11). 
E 1-E7 early genes, L1-L2 late genes, URR Upper regulatory region, AE early polyA signal, and P97 and P742 promotors are 
i ndicated. The figure is drawn based on HPV11 A1 prototype (GenBank accession number M14119.1). The yellow arrow line 
indicates genome fragment amplified by primer pair HPV-11-S2F and HPV-11-S2R, and the black arrow line indicates genome 
fragment amplified by the HPV-11-S1MS-F and HPV-11-S1MS-R primer pair. 
 
 
64 
3.2.3. Agarose gel electrophoresis 
PCR amplicons were separated and visualised by electrophoresis using a 1% agarose gel. Briefly, a 1% 
gel was prepared using 1g Seakem® LE agarose powder, and 100ml of 1x TAE buffer at pH 8.0 and 
the gel was electrophoresed at 90V for 45 minutes. Tables summarising the preparation of TAE and 1% 
agarose gels is included in Appendix 6 and 7. The DNA was stained using a GelRed nucleic acid gel 
stain (Thermo Fisher Scientific, USA) (Appendix 8) and visualised using the BioRad Molecular Imager 
Gel Doc™ XR+ with Image Lab™ Software (BioRad, California, USA) to determine the fragment sizes 
according to the known DNA size marker. The O’GeneRuler™ 100bp DNA ladder SM0333 
(Fermentas, Illinois, USA) containing DNA fragments from 100bp to 10 000bp was used to estimate 
the size of the amplicons.  
3.2.4. Purification of PCR product 
The Wizard® SV Gel and PCR Clean-up System (Promega, Madison, USA) was used to purify target 
DNA from a 1% agarose gel according to manufacturer’s instructions. Membrane Binding Solution was 
added at a ratio of 10μl of solution per 10mg of agarose gel and the gel heated at 60°C until completely 
dissolved. The contents were transferred to the SV Minicolumn and washed twice by adding 700μl and 
500μl of Membrane Wash Solution. The DNA was eluted in 50μl of nuclease-free water and stored at 
4°C until further use. 
3.2.5. Determination of DNA concentration 
DNA concentration was measured using the Qubit fluorometer and the Qubit dsDNA BR assay kit, 
according to the manufacturer’s instructions (Thermo Fisher Scientific, Illinois, USA). A working 
solution was made by diluting dsDNA BR reagent and BR buffer (1:200) in microcentrifuge tubes. 
Then, 190μl working solution and 10μl of each standard were loaded in microcentrifuge tubes. In 
separate microcentrifuge tubes, 198μl working solution and 2μl sample were loaded, vortexed and 
incubated for two minutes at room temperature. The Qubit was calibrated, and DNA concentrations of 
all samples were measured.  
3.2.6. MiSeq library preparation and sequencing  
The Nextera XT DNA Library Preparation kit (Illumina, California, USA) was used to convert the 
purified DNA product to a short, fragmented DNA library, followed by size selection using AMpure 
XP beads (Beckman Coulter, California, USA). The multiplexed libraries were analysed on an Illumina 
MiSeq (Illumina, California, USA) with the MiSeq reagent kit v3 (300 cycles) (Illumina, California, 
USA) at the UFS Next Generation Sequencing Unit. 
65 
3.2.7. Next-generation sequencing data analysis  
FASTQ sequences were imported into Geneious 2021 software (https://www.geneious.com) as paired 
ends with an insert size of 500. Reads were trimmed with an error probability limit of 0.05 and filtered. 
Reads were assembled and aligned to the A1 prototype M14119.1 using a medium sensitivity, and a 
consensus sequence was generated using the highest quality threshold. Using Geneious 2021 software 
(https://www.geneious.com), the consensus sequence was inspected to identify ambiguities and 
degenerative bases and exported as text documents. An assembly report was generated and the length 
of the genome, CG content and pairwise identity was determined using Geneious 2021 software.  
Analysis of nucleotide and amino acid variation 
Genomic variants and genomic positions were identified by comparing the sequence data with the 
prototype HPV11 genome (GenBank accession number M14119.1). A corrected sequence with a 2bp 
insertion at genomic position 7717-7718 was used when determining genomic variants and genomic 
positions (Maver et al., 2011). For the isolates sequenced in this study, nucleotide substitutions, 
nucleotide insertions, and nucleotide deletions were identified with respect to the A1 prototype strain 
(GenBank accession number M14119.1) using MEGA X software (Kumar et al., 2018).  
The predicted amino acid sequences for each coding region were determined with the use of a codon 
chart included in Appendix 9. Non-synonymous substitutions resulting in amino acid alterations were 
identified by comparing amino acid data with the HPV11 A1 prototype (GenBank accession number 
M14119.1). 
Percentage variation in coding regions 
To estimate the percentage of variation within the coding regions, the number of nucleotide- and amino 
acid variations compared to the A1 prototype sequence M14119.1 were converted into a percentage 
using the following equations: 
𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑛𝑢𝑐𝑙𝑒𝑜𝑡𝑖𝑑𝑒 𝑣𝑎𝑟𝑖𝑎𝑛𝑐𝑒𝑠 𝑤𝑖𝑡ℎ𝑖𝑛 𝑎 𝑠𝑝𝑒𝑠𝑖𝑓𝑖𝑐 𝑐𝑜𝑑𝑖𝑛𝑔 𝑟𝑒𝑔𝑖𝑜𝑛 𝑐𝑜𝑚𝑝𝑎𝑟𝑒𝑑 𝑡𝑜 𝑀14119.1
 × 100  
𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑛𝑢𝑐𝑙𝑒𝑜𝑡𝑖𝑑𝑒𝑠 𝑤𝑖𝑡ℎ𝑖𝑛 𝑠𝑝𝑒𝑠𝑖𝑓𝑖𝑐 𝑐𝑜𝑑𝑖𝑛𝑔 𝑟𝑒𝑔𝑖𝑜𝑛 𝑜𝑓 𝑀14119.1
and 
𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑎𝑚𝑖𝑛𝑜 𝑎𝑐𝑖𝑑 𝑣𝑎𝑟𝑖𝑎𝑛𝑐𝑒𝑠 𝑤𝑖𝑡ℎ𝑖𝑛 𝑎 𝑠𝑝𝑒𝑠𝑖𝑓𝑖𝑐 𝑐𝑜𝑑𝑖𝑛𝑔 𝑟𝑒𝑔𝑖𝑜𝑛 𝑐𝑜𝑚𝑝𝑎𝑟𝑒𝑑 𝑡𝑜 𝑀1411.1
 × 100 
𝑁𝑢𝑚𝑏𝑒𝑟 𝑜𝑓 𝑎𝑚𝑖𝑛𝑜 𝑎𝑐𝑖𝑑𝑠 𝑤𝑖𝑡ℎ𝑖𝑛 𝑠𝑝𝑒𝑠𝑖𝑓𝑖𝑐 𝑐𝑜𝑑𝑖𝑛𝑔 𝑟𝑒𝑔𝑖𝑜𝑛 𝑜𝑓 𝑀14119.1
Degree of divergence 
The degree of divergence was calculated using pairwise analysis of percentage divergence of 
nucleotides with MEGA X software using the Maximum Composite Likelihood model. Codon positions 
66 
included were 1st, 2nd, 3rd, and non-coding. All positions with less than 95% site coverage were removed 
using the partial deletion option. The degree of divergence was calculated for isolates sequenced in the 
current chapter, as well as the 28 complete genomes retrieved from GenBank and divergence from 
lineage A and B prototypes were described. The degree of divergence between isolates sequenced in 
the current chapter was also calculated. 
Maximum likelihood method 
The evolutionary history was inferred using the maximum likelihood method and the Tamura-Nei 
model with a bootstrap value of 1000 software using sequence data determined in the current chapter, 
and 28 complete sequences retrieved from GenBank. Analysis was performed using MEGA X software. 
Initial tree(s) for the heuristic search were obtained automatically by applying Neighbor-Join and BioNJ 
algorithms to a matrix of pairwise distances estimated using the Tamura-Nei model, then selecting the 
topology with the higher log-likelihood value. The 1st, 2nd, 3rd, and non-coding codon positions were 
included in the analysis.  
Isolates with known (sub)lineage classification based on phylogenetic analysis were aligned with the 
corresponding reference strain using MEGA X software to identify nucleotide- and amino-acid 
variabilities (Kumar et al., 2018).  
3.3. Results 
3.3.1. Selection of isolates for whole genome sequencing  
Four isolates were selected for complete genome determination. Two isolates (VBD15/10 and 
VBD74/09) from one patient collected approximately five months apart were selected because the 
concatenated E5a/b-L1-URR nucleotide sequence profiles were highly similar and therefore considered 
representative of two isolates retrieved from GenBank for which compete genome data was available 
and eight isolates from the current study of RRP patients. VBD01/10 was selected because the 
concatenated E5a/b-L1-URR nucleotide sequence profiles were highly similar to an isolate retrieved 
from GenBank for which compete genome data was available and representative of six isolates from 
the current study. These isolates did not cluster closely with any prototype sequence. VBD34/08 and 
VBD28/14 were identified as potential lineage B isolates based on the tree topology however, there was 
insufficient DNA available to obtain further sequence data for VBD34/08. Thus, overall, the complete 
genome of four HPV11 isolates, VBD01/10, VBD15/10, VBD28/14 and VBD74/09, from three patients 
were sequenced in this study.  
Information regarding patient sex, date of birth, date of diagnosis and sample collection is included in 
Table 13. The DNA sequencing reads were mapped to the A1 prototype M14119.1 and a consensus 
67 
sequence was generated for each isolate. The number of assembled reads is summarised in Table 14. 
The minimum and maximum lengths of the consensus sequences, the CG content and the pairwise 
identity are summarised in Table 15. 
Additional genome sequence data for 28 geographically distinct representatives of each HPV11 lineage, 
including lineage A, sub-lineages A1 to A4, and lineage B, were retrieved from GenBank and used for 
downstream analysis (Appendix 2). 
 
Table 13: Patient information. 
Isolate Sex Date of birth Date of diagnosis Date of sample collection
VBD01/10 Male 2007/01/04 2010/01/06 2009/11/03
VBD28/14 Male 2009/03/29 2014/06/26 2010/01/06
VBD74/09 Male 2009/11/03
2009/10/13 2009/10/23
VBD15/10 Male 2014/06/26  
 
Table 14: Next-generation sequencing assembly report for four complete human papillomavirus type 11 (HPV11) mapped to 
the A1 prototype M14119.1 using Geneious Prime software (https://www.geneious.com). 
   
Assembly report
Isolate Total reads Assembled reads Not assembled reads
VBD01/10  1,033,592 1,022,153 11,439 reads
VBD15/10  1,652,362 1,636,151 16,211 reads
VBD28/14 1,333,518  1,306,323 27,195 reads
VBD74/09 1,903,068  1,879,877 23,191 reads
   
 
Table 15: The lengths of the complete human papillomavirus type 11 (HPV11) consensus sequence, the CG content and the 
pairwise identity of four HPV11 isolates mapped to the A1 prototype M14119.1 using Geneious Prime software 
(https://www.geneious.com).  
The corrected M14119.1 with a two base-pair (bp) insertion at genomic position 7717-7718 was used (Maver et al., 2011). 
.  
Isolate Sequence length CG content Pairwise identity
VBD01/10 7934bp 41.1% 99.3%
VBD15/10 7932bp 41.1% 99.4%
VBD28/14 7949bp 41.1% 99.3%
VBD74/09 7932bp 41.1% 99.4%
  
68 
3.3.2. Nucleotide and amino acid variances across the human papillomavirus type 11 
genome  
The nucleotide sequence variabilities for the four complete HPV11 genomes are summarised in Table 
16. Briefly, VBD01/10 contained 25 nucleotide substitutions, a nucleotide deletion and two nucleotide 
insertions compared to the A1 prototype M14119.1, VBD15/10 and VBD74/09 contained 26 nucleotide 
substitutions and one nucleotide deletion compared to the A1 prototype M14119.1, and VBD28/14 
contained 94 nucleotide substitutions, 12 nucleotide deletions and 28 nucleotide insertions compared to 
the A1 prototype M14119.1. In total, 45 indels were identified among four isolates in the URR.  
Nucleotide insertions include an ACGCGC insertion following genomic position 7529 in VBD28/14, a 
C and CC insertion following genomic position 7584 in VBD28/14 and VBD01/10, respectively, a 
CGCCAGG insertion following genomic position 7723 in VBD28/14, and a GGTTGTGTTATCTC 
insertion following genomic position 7746 in VBD28/14. Nucleotide deletions include a T deletion at 
genomic position 7509 in VBD01/10, VBD15/10 and VBD74/09, and a GTATCTTGCCAA deletion 
from genomic position 7694 to 7705 in VBD28/14. All isolates contained nucleotide substitutions 
T137C, C1783G, G1784C, A2580G, C2884T, T2888C, G3436A, A3645G, A3832G, A3952T, 
G3991C, C4647T, C4887A, and T7547C. VBD15/10 and VBD74/09 had identical nucleotide 
substitutions, insertions, and deletions.  
The amino acid sequence variabilities for the four complete HPV11 genomes are summarised in Table 
17. By aligning the four isolates sequenced in the current study and the A1 prototype sequence 
(GenBank accession number M14119.1), 69 non-synonymous substitutions resulting in changed amino 
acids were identified. Briefly, VBD01/10 had ten non-synonymous substitutions, VBD15/10 and 
VBD74/09 had 12 non-synonymous substitutions, and VBD28/14 had 35 non-synonymous 
substitutions. All isolates contained an arginine (R) to A substitution in the E1 ORF, a K to R non-
synonymous substitution in the E2 ORF, a G to E non-synonymous substitution in the E4 ORF, and a 
valine to F and T to L in the E5a ORF. VBD15/10 and VBD74/09 had identical amino acid sequences.  
As previously mentioned, a nucleotide variance of 0.5%-1.0% across the whole genome defines a 
variant sub-lineage and the nucleotide sequence of the L1 ORF is often used to represent the whole 
genome variation due to the high degree of conservation in this region (Burk et al., 2011, 2013). 
Subsequently, to estimate the degree of variation in coding regions, the percentage difference between 
isolates in the current study and the A1 prototype sequence M14119.1 was determined. In brief, the 
nucleotide sequences of coding regions varied from 0.46% in the L1 ORF to 2.22% in the E5b ORF. 
The amino acid sequences variability ranged from 0.39% in the L1 ORF to 6.75% in the E5b ORF.  
69 
Table 16: Sequence comparison of nucleotide variances among four human papillomavirus type 11 (HPV11) isolates against 
the HPV11 prototype with GenBank accession number M14119.1.  
Residues that differed from those of the HPV11 prototype are indicated by a white (nucleotide substitutions), green (nucleotide 
deletions) and yellow (nucleotide insertions) colour change and the substituted-, deleted- or inserted nucleotides. The 
corrected M14119.1 with the 2bp insertion at genomic position 7717-7718 was used (Maver et al., 2011). 
 IsolateGene Genomic region Base VBD01/10 VBD15/10 VBD24/18 VBD74/09
137 T C C C C
180 C T
E6 102..554 295 C T
 380  C T T T
466 G A
563 G T
E7 530..826 566 C T
662 G T T T
1107 A C
1130 A C C
1352 T C
1381 G A
1426 C T
1488 A C
1623 T C C
1783 C G G G G
1784 G C C C C
E1 2100 T A
832..2781 2169 T C
2172 A T
2256 C A
2262 A G
2328 T G
2358 C T
2385 A G
2412 A C
2523 G A
2580 A G G G G
2854 C T
2884 C T T T T
2888 T C C C
3166 A C
3391 A G
3436 G A A A A
3462 A C C
3487 C T T T
E2 
3492 C T
2723..3826   3511 C A
^E4 3516 T G
3255..3581 3537 A C
3566 G A
3570 C A
3626 A C C C
3631 G C
3645 A G G G G
3772 A C C
3781 C T
3814 A G
3830 T G
3832 A G G G G
3902 C G
3952 A T T T T
E5a 3978 A G
3991 G C C C C
3871..4146 
3993 A T
4048 T C
4142 A C C
4166 C G
E5b 4227 C T
4274 A C
4146..4370
4312 C A
4333 C T
4380 T G G
4452 A G
4584 A G
4647 C T T T T
4740 G A
4752 T C
4815 T G
4821 G A
4887 C A A A A
L2 4989 C A
5059 G A
4417..5784
5157 T G
5235 A G
5290 C A
5389 G A
5416 C A
5470 T C
5518 C T
5523 C T
5706 C T
5929 A G
6028 C T T T
6296 T A
L1 6298 T C
5771..7276 6949 T A
7045 G A
7197 C T
7237 T C
7289 A G
7302 A C
7319 G T
7329 G C
7349 G C
7359 T C
7411 T G
7413 A C
7479 C T T T
7509 T DEL DEL DEL
7519 G T
7529-7530 ACGCGC
URR 7547 T C C C C
7563 C T
7277..7933,
7570 A C
1..101 7584-7585 CC C
7591 A G
7626 A C
7646 T A
7694-7705 GTATCTTGCCA DEL
7724-7725 CGCCAGG
7746-7747 GGTTGTGTTATC
7775 T G
7780 G T
7880 C T
7928 C T
27 G T
48 C T
70 
Table 17: Comparison of amino acid variances among four human papillomavirus type 11 (HPV11) isolates against the 
HPV11 prototype with GenBank accession number M14119.1.  
The total number of amino acids in each gene and the amino acid number where a non-synonymous is observed is indicated. 
Residues that differed from those of the HPV11 prototype are indicated by a white colour difference and the substituted amino 
acid.  
Isolate
Amino Amino 
Gene VBD01/10 VBD15/10 VBD28/14 VBD74/09
acid no. acid*
E6 65 A V
1..150 122 G E
E7   12 V L
1..98 45 A S S S
100 N T T
174 A A
E1 
184 D N
1..649
318 R A A A A
527 Q H
247 N T T
257 S F
263 N K
265 I S
E2 
272 K T
1..367
282 A T
283 A D
308 K R R R R
350 K N N
46 Q R
61 G E E E E
70 T P P
78 T L L L
E4  
80 D S
1..108
86 T K
88 S A
95 S R
106 L I
11 I G
E5A 28 V F F F F
1..91 41 T L L L L
91 Q P P
7 H Q
28 L F
E5B 
43 K N
1..74
56 T N
63 S L
191 D E
215 A T
292 L I
L2 
325 V I
1..455
334 L M
351 F L
368 L F
L1 176 S T
1..501 476 A V
*A – alanine, D – aspartic acid, E – glutamic acid, F – phenylalanine, G – glycine, H – histidine, 
I – isoleucine, K – lysine, L – leucine, M – methionine, N – asparagine, P – proline, Q – 
glutamine, R – arginine, S – serine, T – threonine, V – valine
 
71 
3.3.3. Pairwise nucleotide difference between complete human papillomavirus type 
11 genomes 
Pairwise nucleotide difference between complete genomes obtained in this study and sequence data 
retrieved from GenBank is summarised in Appendix 12. There were a total of 7920 positions in the 
final dataset. Pairwise nucleotide difference between the four complete genomes obtained in this study 
and 28 complete genome sequences obtained from GenBank varied from 0.000 to 0,01275 (Appendix 
12). Divergence from the sub-lineage A1 prototype M14119.1 ranged from 0,00038 (FN907963.1) to 
0,01224 (LN833183.1) with an average divergence of 0,00378. Divergence from the sub-lineage A2 
prototype LN833161.1 ranged 0,00025 (HE611263.1 and JQ773409.1) to 0,01224 (LN833183.1) with 
an average divergence of 0,00241. Divergence from the sub-lineage A3 prototype LN833169.1 ranged 
from 0,00139 (LN833165.1) to 0,01275 (LN833183.1) with an average divergence of 0,00578. 
Divergence from the sub-lineage A4 prototype LN833187.1 ranged from 0,00507 (LN833165.1) to 
0,01275 (LN833183.1) with an average divergence of 0,00624. Divergence from the lineage B 
prototype LN833183.1 ranged from 0,00051 (VBD28/14) to 0,01275 (LN833169.1, LN833187.1) with 
an average divergence of 0,01186 (Appendix 12). 
Pairwise nucleotide difference between the four complete genomes obtained in this study is summarised 
in Table 18. There were a total of 7920 positions in the final dataset. VBD15/10 and VBD74/09 had an 
evolutionary divergence of zero. 
 
Table 18: Estimates of evolutionary divergence between four human papillomavirus type 11 (HPV11) sequences using MEGA 
X software.  
The corrected M14119.1 with the 2bp insertion at genomic position 7717-7718 was used (Maver et al., 2011). 
 
VBD01/10 VBD15/10 VBD28/14 VBD74/09
VBD01/10
VBD15/10 0,00139
VBD28/14 0,01184 0,01197
VBD74/09 0,00139 0 0,011973
 
 
  
72 
3.3.4. Maximum Likelihood method 
The evolutionary history was inferred by using the maximum likelihood method and Tamura-Nei 
model. The tree with the highest log likelihood (-12751.59) is depicted. The analysis involved 32 
nucleotide sequences and 7972 positions were included in the final dataset. Phylogenetic analysis of the 
HPV11 complete genome resolved into two lineages, namely lineage A and lineage B.  
Two isolates, VBD28/14 and LN833183, (2/32) were identified as lineage B and clustered together with 
a 100% certainty in the bootstrap test (Figure 9). The majority of isolates (23/28, 82%), including 
VBD01/10, VBD15/10, and VBD74/09, clustered with the A2 reference LN833161.1. VBD15/10 and 
VBD74/09 clustered separately from the other sub-lineage A2 isolates (Figure 9). 
3.3.5. Genome heterogeneities with respect to the corresponding prototype 
Inferred by phylogenetic analysis, VBD28/14 was identified as a lineage B isolate. There were three 
nucleotide differences identified between VBD28/14 and the lineage B prototype LN833183.1. 
Nucleotide heterogeneities are summarised in Table 19. Based on the alignment of VBD28/14 with the 
lineage B prototype LN833183.1, one non-synonymous substitution could be identified. A C6831T 
nucleotide substitution resulted in an A to E amino acid substitution (Table 19). 
 
Table 19: Genomic variations between human papillomavirus type 11 (HPV11) lineage B isolates VBD28/14 sequenced in 
this study and lineage B prototype LN833183.1 retrieved from GenBank.  
The corrected M14119.1 with the 2bp insertion at genomic position 7717-7718 was used (Maver et al., 2011). 
 
 Genomic position
Isolate 48 3820 6831
VBD28/14 T A C
LN833183.1 C G T
 
VBD01/10, VBD15/10 and VBD74/09 were identified as sub-lineage A2 isolates through phylogenetic 
analysis. Based on the alignment of VBD01/10, VBD15/10 and VBD74/09 with the A2 prototype 
LN833161.1, a total of 14 variable nucleotide positions and nine variable amino acid positions were 
identified. Nucleotide heterogeneities are summarised in Table 20. 
 
  
73 
Table 20: Genomic variations between human papillomavirus type 11 (HPV11) sub-lineage A2 isolates sequenced in this study 
and sub-lineage A2 prototype LN833161.1 retrieved from GenBank.  
The corrected M14119.1 with the 2bp insertion at genomic position 7717-7718 was used (Maver et al., 2011). 
Genomic position
Isolate 1107 1130 1623 2358 3391 3462 3492 3772 4142 4380 7252 7272 7413 7585-7586
LN833161.1 C A T T G A C A A T G C C C insertion
VBD01/10 T A A CC insertion
VBD15/10 A C C C A C C C G A A A No insertion
VBD74/09 A C C C A C C C G A A A No insertion
 
One non-synonymous substitution was identified in the E1 ORF of two isolates. An A1130C nucleotide 
substitution resulted in a N to T in VBD15/10 and VBD74/09 at amino acid 100. Two non-synonymous 
substitutions were identified in the E2 ORF in both VBD15/10 and VBD74/09. An A3462C nucleotide 
substitution resulted in a N to T amino acid substitution at amino acid 247, and an A3772C nucleotide 
substitution resulted in a K to N amino acid substitution at amino acid 350. One non-synonymous 
substitution was identified in the E2 ORF in VBD01/10. A C3492T nucleotide substitution resulted in 
a S to F amino acid substitution at amino acid 257. VBD15/10 and VBD74/09 both contained two non-
synonymous substitutions in the E4 ORF. A G3391A nucleotide substitution resulted in a R to Q amino 
acid substitution at amino acid 46 and an A3462C nucleotide substitution resulted in a T to P amino 
acid substitution at amino acid 70. One non-synonymous substitution was identified in the E4 ORF in 
VBD01/10. A C3492T nucleotide substitution resulted in a P to S amino acid substitution at amino acid 
80. One non-synonymous substitution was observed in VBD15/10 and VBD74/09 in the E5a ORF. An 
A4142C nucleotide substitution resulted in a Q to P amino acid substitution at amino acid 91. One non-
synonymous substitution was identified in three isolates in the L1 ORF. A C7272A nucleotide 
substitution resulted in a T to K amino acid substitution at amino acid 501 in VBD01/10, VBD15/10 
and VBD74/09 (Table 20). 
 
74 
 
 Lineage B Lineage A 
Figure 9: Phylogenetic tree of human papillomavirus type 11 (HPV11) based 32 nucleotide sequence alignments of HPV11 
including four isolates sequenced in this study and 28 sequences of geographically distinct isolates retrieved from GenBank.  
M14119.1 (blue) was used as a representative of sub-lineage A1, LN833161.1 (green) as a representative of sub-lineage A2, 
LN833169.1 (yellow) as a representative of sub-lineage A3, LN833187.1 (red) as a representative of sub-lineage A4 and 
LN833183.1 (orange) was used as a representative of lineage B. The maximum likelihood tree was constructed using MEGA 
X using the maximum likelihood method and Tamura-Nei model. The corrected M14119.1 with the 2bp insertion at genomic 
position 7717-7718 was used (Maver et al., 2011). 
75 
3.4. Discussion 
HPV classification below types is increasingly relevant since within-type variants (lineages and sub-
lineages) are associated with differential prognosis and outcomes concerning virus persistence, 
development of lesions and progression to malignancy (Flores-Díaz et al., 2017). The advent of 
metagenomics using high-throughput Illumina sequencing has enabled the discovery of numerous novel 
viruses in various bio-niches at a reasonable cost and unprecedented speed. Additionally, genome 
characterisation assists in studying viral diversity and the association of virus and disease (Ambulos et 
al., 2016; Kocjan et al., 2015; Parker & Chen, 2017; Tuna & Amos, 2017).  
The HPV nomenclature is well established. However, while classification into species and types is 
based on unique genes, variant lineage and sub-lineage classification are based on the complete genome 
of the virus. HPV variants are considered novel only after the complete genome has been cloned and 
deposited with the International HPV Reference Centre (Bernard et al., 2010; Burk et al., 2011; 
Bzhalava et al., 2015; de Villiers et al., 2004; Kocjan et al., 2015) 
(https://www.hpvcenter.se/human_reference_clones). Phylogenetic analysis of concatenated E5a/b-L1-
URR sequences suggested a supposed novel HPV11 lineage or sub-lineage and isolates of interest using 
a previously published PCR protocol (Jelen et al., 2016; Maver et al., 2011). However, due to the 
discrepancies observed in the phylogenetic tree topology using concatenated E5a/b-L1-URR, the sub-
lineage classification of several isolates remained undetermined in Chapter 2. It was also unclear 
whether the E2 segment can reliably distinguish between sub-lineages. Therefore, the complete HPV11 
viral genome of selected isolates was amplified using long-range PCR and sequenced using high-
throughput sequencing.  
Isolates characterised in this study were initially isolated from respiratory tract papilloma samples 
obtained from patients with a clinical diagnosis of RRP. We assembled four HPV11 complete genomes 
from three different patients. VBD28/14 had the most nucleotide substitutions and indels, followed by 
VBD01/10. VBD15/10 and VBD74/09, isolated from one patient, were identical and indicated no signs 
of evolution within the host. Comparison of the ORFs of each of the four isolates identified non-
synonymous substitutions that changed the amino acid, which may alter protein function and 
expression, which underlie disease phenotype (Lebeuf-Taylor et al., 2019). Also, interference in gene 
expression may lead to cancer progression and failure of treatment options. Therefore, future studies 
regarding viral gene expression are vital.  
Phylogenetic analysis confirmed that VBD28/14 clusters with another lineage B isolate which was 
recently identified (Jelen et al., 2016), and analysis of the genome organisation of VBD28/14 revealed 
many similarities and some differences, including three nucleotide substitutions and one non-
synonymous substitution in the L1 capsid protein. VBD15/10 and VBD74/09 was identified as sub-
76 
lineage A2 but clustered separately from all other sub-lineage A2 isolates. VBD15/10 and VBD74/09 
had seven non-synonymous heterogeneities in the E1-, E2-, E4-, E5a- and L1 ORF compared to the A2 
prototype used. VBD01/10 was the most similar to the A2 prototype and only had three nucleotide 
substitutions, one nucleotide insertion and three non-synonymous substitutions in the E2, E4 and L1 
ORFs. 
Conformational changes in the E1 and E2 proteins may affect replication of the HPV11 circular dsDNA 
genome. Furthermore, E2 possesses an initiation codon for E4, and protein changes in either may affect 
virion release and apoptosis in terminally differentiated cells (Graham & Faizo, 2017; Kardani & 
Bolhassani, 2018a; Wallace & Galloway, 2014). Point-mutations in E5 may inhibit cell transformation, 
hinder activation of various pathways, disrupt the acidification of endosomes, promote transformed cell 
invasiveness, and misregulate the proliferation of infected cells. As E5 is necessary for many pathways, 
sequence variations may significantly impact the function of this protein (Halavaty et al., 2014; Hemmat 
& Baghi, 2018; Venuti et al., 2011; Zhang et al., 2018). Functional analysis of early proteins in HPV11 
variants may further decipher the effects of mutations on the HPV virus life cycle.  
Within the L1 ORF, sequence variation was low, likely due to the slow genomic evolutionary rate (Chen 
et al., 2009, 2011). However, genomic- and amino acid variances within the L1 were identified in all 
samples. In order to determine whether non-synonymous nucleotide substitutions have an effect on the 
biological function of vaccines, functional analysis is required. Amino acid- and protein alterations that 
occur within the conserved epitopes of L1, have the ability to influence vaccine efficacy. However, to 
date, there have been no reports suggesting that the biological function of HPV type specific vaccines 
is influenced by antigenic differences between intratypic variants (Barra et al., 2019; Benedict & 
Derkay, 2021; Buck et al., 2013; Chabeda et al., 2018; Dadar et al., 2018). The consequences of 
polymorphisms in the novel lineage B, isolates of interest VBD15/10 and VBD74/09, and sub-lineage 
A3 and A4 on antibody recognition following natural infection or vaccination by the present-day 
vaccines and effects on the viral life cycle requires additional investigation.  
In conclusion, during this study the complete genome of four isolates of HPV11 were successfully 
identified and characterised from three patients. Additionally, this is also the second report of a lineage 
B isolate identified. Both lineage B isolates identified thus far have been isolated in South Africa, 
suggesting that this lineage B may be geographically restricted or have a low infectivity rate. Further 
research on sub-lineage A2 isolates, VBD15/10 and VBD74/09, is necessary to characterise these 
isolates fully. Research with different sample types and larger sample sizes are needed to clarify the 
prevalence and disease association and the impact of those newly characterised variants on HPV 
persistence and RRP development. 
77 
Chapter 4 - Concluding remarks 
Papillomaviruses have a well-documented history with human hosts, and most humans are infected at 
some point in their lives. Papillomaviruses have a slow evolutionary rate of approximately 10−8 
nucleotide substitutions per site per year and experience little recombination during their evolution; 
hence nucleotide polymorphisms mainly transpire due to arbitrary mutation time (Bernard, 1994; Chen 
et al., 2009, 2011; van Doorslaer, 2013). HPV was discovered in 1949 (Strauss et al., 1949), and 
evidence suggesting the involvement of HPV11 in RRP was first reported in 1982 (Gissmann et al., 
1982). To date, over 220 HPV types are recognised globally 
(https://www.hpvcenter.se/human_reference_clones).  
Despite phylogenetic relatedness, knowledge regarding intratypic variants of HPV11 and association 
with the clinical outcomes of infection are limited. Genetic traits resulting in various lineages and sub-
lineages of the virus are all encoded within the relatively small eight kilobyte circular dsDNA genome. 
HPV11 is ordinarily associated with a more severe disease outcome in patients with RRP and earlier 
age at diagnosis compared to HPV6, suggesting increased virulence and pathogenesis (El Achkar et al., 
2020; Intakorn & Sonsuwan, 2014; Omland et al., 2014; Seedat, 2020).  
According to previous South African surveillance studies, between 64% and 71% of the population are 
infected with HPV, and between 1% and 4% are infected with HPV11. However, majority of these 
studies targeted specific populations, older age groups, restricted sampling areas, and used only cervical 
samples (Giuliano et al., 2015; Mbulawa et al., 2017, 2018; Taku et al., 2020). Furthermore, no large-
scale South African studies or Free State based studies report on HPV11 intratypic variant distribution 
in patients with RRP, and no current information regarding variants circulating in the Free State exists. 
Therefore, this study aimed to genetically characterise HPV11 isolates from patients diagnosed with 
RRP treated at Universitas Academic Hospital. 
In a previous unpublished study performed in our laboratory, a novel HPV11 lineage B isolate was 
identified (Makatsa, 2012). Although not included in this study, this motivated investigation of further 
isolates for clarification of currently circulating lineages and sub-lineages. Therefore, HPV11 genetic 
variants were characterised based on the nucleotide sequence of the L1, URR, E5a/b and a segment of 
E2 genomic regions isolates from patients with RRP in the Free State. According to previous studies, 
these gene segments encompass sufficient SNPs to discriminate between viral lineages and sub-
lineages, as the concatenated L1-URR-E5a sequence reportedly contains adequate information for 
differentiation between A1 and A2 sub-lineages. The E5a/b ORF also has a faster evolutionary rate 
compared to other genes and contains several (sub)lineage specific SNPs. Furthermore, it has been 
reported that the E2 gene segment can reliably distinguish all known HPV11 variants (Bravo & Alonso, 
2004; Burk et al., 2011; Godínez et al., 2014; Jelen et al., 2016; Maver et al., 2011). A previous study 
78 
published by Jelen and colleagues in 2014 suggested that concatenated E5a/b-L1-URR sequences can 
be used as a surrogate for the phylogenetic clustering of HPV6 variants, a LR-HPV type (Jelen et al., 
2014). However, results obtained in the current study uncovered various classification errors using 
concatenated E5a/b-L1-URR sequence data and does not support the use of these gene segments for 
HPV11 variant classification.  
In Chapter 2, the nucleotide- and amino acid composition of the L1-, E5a/b-, and a segment of the E2 
ORF, as well as the nucleotide sequence of the URR were determined using Sanger sequencing. 
Although nucleotide changes may imply a variant lineage or sub-lineage, these variances do not 
necessarily impact the expressed protein function. However, DNA alterations in an ORF may lead to 
gene product alterations if non-synonymous substitutions are present (Lebeuf-Taylor et al., 2019). Few 
non-synonymous substitutions were reported in the L1 ORF of sequenced isolates, unlike the E5a/b 
ORF, where nearly all nucleotide substitutions were non-synonymous. The URR is a variable region 
within the HPV genome capable of accumulating and tolerating many nucleotide mutations as it does 
not encode proteins. Nevertheless, variations in the URR may still impact virus survival as this region 
contains crucial binding sites and promoters (Fang et al., 2020; Ribeiro et al., 2018). Amino acid 
changes may affect many factors such as the effectiveness of HPV11 targeted vaccines, protein folding, 
cell transformation, the viral life cycle, and disease severity. However, to fully understand the impact 
if these changes functional analysis of HPV11 genes is required to decipher the effects of mutations on 
the virus. Consequences of these polymorphisms in the novel lineage B and sub-lineage A3 and A4 
warrants further investigation.  
Analysis of the results obtained in the current study included constructing a maximum likelihood tree 
to confirm the differentiation of the HPV variants based on tree topology and to determine the presence 
of potentially novel intratypic variants. HPV11 concatenated L1-URR and E5a/b-L1-URR resolved into 
two lineages, namely lineage A and lineage B and the majority of the isolates sequenced (48/67) 
clustered together with the globally predominant A2 prototype isolates as anticipated. Two lineage B 
isolates were identified in the current study, VBD34/08 and VBD28/14, with VBD34/08 appearing 
identical to the previously identified lineage B isolate (GenBank accession number LN833183.1) (Jelen 
et al., 2016). The concatenated L1-URR, E5a/b-L1-URR sequences, and the E2 segment provided 
equivalent discriminatory power to distinguish between HPV-lineages; however, tree topology based 
on E5a/b-L1-URR sequences were incoherent for sub-lineage classification.  
Previous studies of intratypic evolution of HPV11 variants rarely dealt with whole-genome sequences. 
Instead, partial regions of the viral genome such as L1, URR, and an ORF gene were used (de Matos et 
al., 2013; Danielewski et al., 2013), leading to classification errors, as HPV genome variants are very 
closely related and only require a 0.5% to 1% variance in the complete genome (Burk et al., 2011). 
Therefore, the complete genome of selected novel HPV11 variants and variants of interest were 
79 
determined in Chapter 3 using NGS technology. Analysis of the whole genome ensures accurate 
differentiation into sub-lineages and detection of any heterogeneity of HPV11 (Burk et al., 2011). 
Based on complete sequence data, the majority of nucleotide substitutions and indels were identified in 
VBD28/14. Non-synonymous substitutions were identified in ORFs of each of the four isolates which 
may alter protein function (Lebeuf-Taylor et al., 2019), which underlie disease phenotype. Likewise, 
altered protein function may lead to cancer progression and failure of treatment options (Barra et al., 
2019; Brotherton, 2019; Cornall et al., 2013; Gerein et al., 2005; Huebbers et al., 2013). Therefore, 
future studies regarding viral gene expression are vital. Phylogenetic analysis of complete HPV11 
genomes identified VBD28/14 as a lineage B variant, and VBD01/10, VBD15/10 and VBD74/09 as 
sub-lineage A2 variants with great certainty. However, VBD15/10 and VBD74/09 contained numerous 
genomic- and amino acid variances compared to the A2 prototype. The slow evolutionary rate of 
papillomaviruses was reinforced as VBD15/10 and VBD74/09 isolated five months from each other 
from a single patient were identical (Bernard, 1994; Chen et al., 2009, 2011; van Doorslaer, 2013). 
Many inconsistencies were observed between the maximum likelihood trees constructed using the 
concatenated E5a/b-L1-URR sequences and WGS. Phylogenetic analysis using the concatenated E5a/b-
L1-URR sequences revealed that VBD01/10 did not cluster closely with the A2 prototype sequence as 
was the case using WGS. Also, analysis using the concatenated E5a/b-L1-URR sequences revealed 
VBD01/10, FN90762.1, and FN907963.1 clustered together with great certainty, However, 
FN907963.1 is a confirmed sub-lineage A1 isolate according to WGS. Furthermore, phylogenetic 
analysis revealed VBD15/10, VBD74/09, MK463916.1 and MK463921.1 clustered closely using the 
concatenated sequences, but this was not the case using complete HPV11 genomes. Discrepancies in 
the location of clustering of sub-lineage A2 isolates JQ773408.1, JQ773411.1, JQJQ773412.1, 
MK463914.1, and FR872717.1 was also revealed. Unlike using concatenated sequences, these 
sequences did not cluster closely with the A2 prototype using the complete HPV11 genome. An 
important discrepancy observed between using specific genes versus the complete genome was that A1 
isolates did not cluster with the corresponding prototype using the concatenated sequences. Therefore, 
using concatenated E5a/b-L1-URR sequences cannot reliably distinguish between HPV sub-lineages as 
previously suggested (Jelen et al., 2016).  
The 208bp region located at the 3′ end of the E2 ORF and the 5′ end of NCR2 provided more accurate 
results for HPV11 whole-genome tree reconstruction compared to the concatenated E5a/b-L1-URR 
sequences. All isolates were classified into appropriate sub-lineages as determined by WGS of the 
complete HPV11 sequence. This is the second report of a lineage B isolate identified in South Africa 
(Jelen et al., 2016). Two isolates of interest were identified in the current study. These isolates had 
numerous amino acid heterogeneities and the consequences of these polymorphisms requires additional 
investigation. The 208bp E2 segment could reliably classify all isolates in this study, suggesting that 
80 
this gene segment contains stable sub-lineage specific SNP’s and may serve in sub-lineage 
identification when complete genome sequences cannot be obtained. 
Although this study successfully completed the aim and objectives set out, limitations in the study were 
identified. The Sanger sequencing approach was used to sequence selected genes of the isolates; 
however, Sanger sequencing has a significantly lower sensitivity for genomic variant detection 
compared to NGS which may hinder detection of genomic variants present at low copy numbers (Parker 
& Chen, 2017; Sanger et al., 1977). Moreover, research with larger sample sizes will contribute towards 
clarification of the prevalence, disease association and impact of newly characterised variants on HPV 
persistence and RRP development. Functional analysis of genes would add valuable information 
regarding protein interactions and functioning.  
This study provides the most comprehensive data on the genomic diversity of HPV11 from patients 
with RRP in the Free State to date. As within type variants may have an association with disease 
outcome, it is essential to characterise the current strains circulating amongst the community. Baseline 
data on circulating HPV variants may significantly contribute to future evolutionary, epidemiological, 
vaccination, and molecular assay development studies, as well as to studies on the pathogenesis of 
HPV11 and other Alphapapillomaviruses. 
  
81 
References 
Abreu, AL., Souza, RP., Gimenes, F. & Consolaro, ME. (2012). A review of methods for detect human 
papillomavirus infection. Virology Journal, 9, 262. DOI: 10.1186/1743-422X-9-262 
Allawi, HT. & SantaLucia, J. (1997). Thermodynamics and NMR of internal G-T mismatches in 
DNA. Biochemistry, 36(34), 10581-10594. DOI: 10.1021/bi962590c 
Altamura, G., Power, K., Martano, M., Degli Uberti, B., Galiero, G., De Luca, G., Maiolino, P. & 
Borzacchiello, G. (2018). Felis catus papillomavirus type-2 E6 binds to E6AP, promotes E6AP/p53 
binding and enhances p53 proteasomal degradation. Scientific Reports, 8(1), 17529. DOI: 
10.1038/s41598-018-35723-7 
Altamura, G., Tommasino, M. & Borzacchiello, G. (2020). Cutaneous vs. Mucosal Tropism: The 
papillomavirus paradigm comes to an "and". Frontiers in Microbiology, 11, 588663. DOI: 
10.3389/fmicb.2020.588663 
Ambulos, N., Schumaker, L., Mathias, TJ., White, R., Troyer, J., Wells, D. & Cullen, K. (2016). Next-
generation sequencing-based HPV genotyping assay validated in formalin-fixed, paraffin-embedded 
oropharyngeal and cervical cancer specimens. Journal of Biomolecular Techniques, 27(2),46-52. DOI: 
10.7171/jbt.16-2702-004 
Balaban, M., Moshiri, N., Mai, U., Jia, X. & Mirarab, S. (2019). TreeCluster: Clustering biological 
sequences using phylogenetic trees. PLOS One, 14(8), e0221068. DOI: 10.1371/journal.pone.0221068 
Barra, F., Leone Roberti Maggiore, U., Bogani, G., Ditto, A., Signorelli, M., Martinelli, F., Chiappa, 
V., Lorusso, D., Raspagliesi, F. & Ferrero, S. (2019). New prophylactics human papilloma virus (HPV) 
vaccines against cervical cancer. Journal of Obstetrics and Gynaecology, 39(1), 1–10. DOI: 
10.1080/01443615.2018.1493441  
Bedell, MA., Hudson, JB., Golub, TR., Turyk, ME., Hosken, M., Wilbanks, GD. & Laimins, LA. 
(1991). Amplification of human papillomavirus genomes in vitro is dependent on epithelial 
differentiation. Journal of Virology, 65(5), 2254-2260. DOI: 10.1128/JVI.65.5.2254-2260.1991 
Benedict, JJ. & Derkay, CS. (2021). Recurrent respiratory papillomatosis: A 2020 perspective. 
Laryngoscope Investigative Otolaryngology, 6(2), 340-345. DOI: 10.1002/lio2.545 
Bernard, HU. (1994). Coevolution of papillomaviruses with human populations. Trends in 
Microbiology, 2(4), 140-3. DOI: 10.1016/0966-842x(94)90602-5 
82 
Bernard, HU., Burk, RD., Chen, Z., van Doorslaer, K., zur Hausen, H. & de Villiers, EM. (2010). 
Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic 
amendments. Virology, 401(1), 70-79. DOI: 10.1016/j. virol.2010.02.002 
Bernard, HU., Calleja-Macias IE. & Dunn, ST. (2006). Genome variation of human papillomavirus 
types: Phylogenetic and medical implications. International Journal of Cancer, 118(5), 1071–1076. 
DOI: 10.1002/ijc.21655 
Bonagura, VR., Du, Z., Ashouri, E., Luo, L., Hatam, LJ., DeVoti, JA., Rosenthal, DW., Steinberg, BM., 
Abramson, AL., Gjertson, DW., Reed, EF. & Rajalingam, R. (2010). Activating killer cell 
immunoglobulin-like receptors 3DS1 and 2DS1 protect against developing the severe form of recurrent 
respiratory papillomatosis. Human Immunology, 71(2), 212-219. DOI: 10.1016/j.humimm.2009.10.009 
Boshart, M., Gissmann, L., Ikenberg, H., Kleinheinz, A., Scheurlen, W. & zur Hausen, H. (1984). A 
new type of papillomavirus DNA, its presence in genital cancer biopsies and in cell lines derived from 
cervical cancer. The EMBO Journal, 3(5), 1151–1157. DOI: 10.1002/j.1460-2075.1984.tb01944.x 
Bravo, IG. & Alonso, A. (2004). Mucosal human papillomaviruses encode four different E5 proteins 
whose chemistry and phylogeny correlate with malignant or benign growth. Journal of Virology, 
78(24), 13613–13626. DOI: 10.1128/JVI.78.24.13613-13626.2004 
Brink, AA., Snijders, PJ. & Meijer, CJ. (2007). HPV detection methods. Disease Markers, 23(4), 273–
281. DOI: 10.1155/2007/147429 
Brotherton, JM. (2019). Impact of HPV vaccination: Achievements and future challenges. 
Papillomavirus Research, 7, 138-140. DOI: 10.1016/j.pvr.2019.04.004 
Buchinsky, FJ., Ruszkay, N., Valentino, W., Derkay, CS., McClay, JE., Bastian, RW., Myer, CM., 
Lollar, KW. & Guris, D. (2020). In RRP, serologic response to HPV is frequently absent and slow to 
develop. PLOS One, 15(3), e0230106. DOI: 10.1371/journal.pone.0230106 
Buck, CB., Day, PM. & Trus, BL. (2013). The papillomavirus major capsid protein 
L1. Virology, 445(1-2), 169–174. DOI: 10.1016/j.virol.2013.05.038 
Burd, EM. (2016). Human papillomavirus laboratory testing: The changing paradigm. Clinical 
Microbiology Reviews, 29(2), 291-319. DOI: 10.1128/cmr.00013-15 
Burk, RD., Chen, Z., Harari, A., Smith, B. C., Kocjan, B. J., Maver, P. J. & Poljak, M. (2011). 
Classification and nomenclature system for human Alphapapillomavirus variants: General features, 
nucleotide landmarks and assignment of HPV6 and HPV11 isolates to variant lineages. Acta 
83 
dermatovenerologica Alpina, Pannonica, et Adriatica, 20(3), 113–123. Retrieved from 
https://www.acta-apa.org/ 
Burk, RD., Harari, A. & Chen, Z. (2013). Human papillomavirus genome variants. Virology, 445(1-2), 
232–243. DOI: 10.1016/j.virol.2013.07.018 
Bzhalava, D., Eklund, C. & Dillner, J. (2015). International standardization and classification of human 
papillomavirus types. Virology, 476, 341–344. DOI: 10.1016/j.virol.2014.12.028 
Chabeda, A., Yanez, R., Lamprecht, R., Meyers, AE., Rybicki, EP. & Hitzeroth, II. (2018). Therapeutic 
vaccines for high-risk HPV-associated diseases. Papillomavirus Research, 5, 46–58. DOI: 
10.1016/j.pvr.2017.12.006 
Chagas, BS., Batista, MV., Guimarães, V., Balbino, VQ., Crovella, S. & Freitas, AC. (2011). New 
variants of E6 and E7 oncogenes of human papillomavirus type 31 identified in Northeastern Brazil. 
Gynecologic Oncology, 123(2), 284–288. DOI: 10.1016/j.ygyno.2011.07.008 
Charleston, M. (2013). Phylogeny, in Maloy, S., Hughes, K (eds) Brenner's Encyclopaedia of Genetics. 
2nd edition. Academic Press, 324,325. DOI: 10.1016/B978-0-12-374984-0.01160-8 
Chen, Z., DeSalle, R., Schiffman, M., Herrero, R. & Burk, RD. (2009). Evolutionary dynamics of 
variant genomes of human papillomavirus types 18, 45, and 97. Journal of Virology, 83(3), 1443–1455. 
DOI: 10.1128/jvi.02068-08 
Chen, Z., Schiffman, M., Herrero, R., Desalle, R., Anastos, K., Segondy, M., Sahasrabuddhe, VV., 
Gravitt, P. E., Hsing, A. W. & Burk, R. D. (2011). Evolution and taxonomic classification of human 
papillomavirus 16 (HPV16)-related variant genomes: HPV31, HPV33, HPV35, HPV52, HPV58 and 
HPV67. PLOS One, 6(5), e20183. DOI: 10.1371/journal.pone.0020183 
Chowdhury, B., Garai, A. & Garai, G. (2017). An optimized approach for annotation of large eukaryotic 
genomic sequences using genetic algorithm. BMC bioinformatics, 18(1), 460. DOI: 10.1186/s12859-
017-1874-7 
Combrinck, CE., Seedat, RY., Randall, C., Roodt, Y. & Burt, FJ. (2012). Novel HPV-6 variants of 
human papillomavirus causing recurrent respiratory papillomatosis in southern Africa. Epidemiology 
and Infection, 140(6), 1095–1101. DOI: 10.1017/s0950268811001580 
Conway, MJ. & Meyers, C. (2009). Replication and assembly of human papillomaviruses. Journal of 
Dental Research, 88(4), 307–317. DOI: 10.1177/0022034509333446 
84 
Cornall, AM., Roberts, JM., Garland, SM., Hillman, RJ., Grulich, AE. & Tabrizi, SN. (2013). Anal and 
perianal squamous carcinomas and high-grade intraepithelial lesions exclusively associated with "low-
risk" HPV genotypes 6 and 11. International Journal of Cancer, 133(9), 2253–2258. DOI: 
10.1002/ijc.28228 
Cornelissen, MT., Bots, T., Briët, MA., Jebbink, M. F., Struyk, AP., van den Tweel, JG., Greer, CE., 
Smits, HL. & ter Schegget, J. (1992). Detection of human papillomavirus types by the polymerase chain 
reaction and the differentiation between high-risk and low-risk cervical lesions. Virchows Archiv, 62(3), 
167–171. DOI: 10.1007/bf02899679 
Crawford, LV. (1965). A study of human papilloma virus DNA. Journal of Molecular Biology, 13(2), 
362-372. DOI: 10.1016/s0022-2836(65)80103-6 
D'Abramo, CM. & Archambault, J. (2011). Small molecule inhibitors of human papillomavirus protein 
- protein interactions. The Open Virology Journal, 5, 80–95. DOI: 10.2174/1874357901105010080 
Dadar, M., Chakraborty, S., Dhama, K., Prasad, M., Khandia, R., Hassan, S., Munjal, A., Tiwari, R., 
Karthik, K., Kumar, D., Iqbal, H. & Chaicumpa, W. (2018). Advances in designing and developing 
vaccines, drugs and therapeutic approaches to counter human papillomavirus. Frontiers in Immunology, 
9, 2478. DOI: 10.3389/fimmu.2018.02478 
Danielewski, JA., Garland, SM., McCloskey, J., Hillman, RJ. & Tabrizi, SN. (2013). Human 
papillomavirus type 6 and 11 genetic variants found in 71 oral and anogenital epithelial samples from 
Australia. PLOS One, 8(5), e63892. DOI: 10.1371/journal.pone.0063892 
Dartmann, K., Schwarz, E., Gissmann, L. & zur Hausen, H. (1986). The nucleotide sequence and 
genome organization of human papilloma virus type 11. Virology, 151(1), 124–130. DOI: 
10.1016/0042-6822(86)90110-8 
de Matos, RP., Sichero, L., Mansur, IM., do Bonfim, CM., Bittar, C., Nogueira, RL., Küpper, DS., 
Valera, FC., Nogueira, ML., Villa, LL., Calmon, MF. & Rahal, P. (2013). Nucleotide and phylogenetic 
analysis of human papillomavirus types 6 and 11 isolated from recurrent respiratory papillomatosis in 
Brazil. Infection, Genetics and Evolution, 16, 282–289. DOI: 10.1016/j.meegid.2012.12.033 
de Roda Husman, AM., Walboomers, JM., van den Brule, AJ., Meijer, CJ. & Snijders, PJ. (1995). The 
use of general primers GP5 and GP6 elongated at their 3′ ends with adjacent highly conserved sequences 
improves human papillomavirus detection by PCR. Journal of General Virology, 76(4), 1057-1062. 
DOI: 10.1099/0022-1317-76-4-1057 
85 
de Villiers, EM. (2013). Cross-roads in the classification of papillomaviruses. Virology, 445(1-2), 2-10. 
DOI: 10.1016/j.virol.2013.04.023 
de Villiers, EM., Fauquet, C., Broker, TR., Bernard, HU. & zur Hausen, H. (2004). Classification of 
papillomaviruses. Virology, 324(1), 17-27. DOI: 10.1016/j.virol.2010.02.002 
Delany-Moretlwe, S., Kelley, KF., James, S., Scorgie, F., Subedar, H., Dlamini, NR., Pillay, Y., Naidoo, 
N., Chikandiwa, A. & Rees, H. (2018). Human papillomavirus vaccine introduction in South Africa: 
Implementation lessons from an evaluation of the national school-based vaccination campaign. Global 
Health: Science and Practice, 6(3), 425-438. DOI: 10.9745/ghsp-d-18-00090 
DiLorenzo, TP. & Steinberg, BM. (1995). Differential regulation of human papillomavirus type 6 and 
11 early promoters in cultured cells derived from laryngeal papillomas. Journal of Virology, 69(11), 
6865–6872. DOI: 10.1128/jvi.69.11.6865-6872.1995 
Dixit, R., Bhavsar, C. & Marfatia, YS. (2011). Laboratory diagnosis of human papillomavirus infection 
in female genital tract. Indian Journal of Sexually Transmitted Diseases and AIDS, 32(1), 50. DOI: 
10.4103/2589-0557.81257 
Dollard, SC., Wilson, JL., Demeter, LM., Bonnez, W., Reichman, RC., Broker, TR. & Chow, LT. 
(1992). Production of human papillomavirus and modulation of the infectious program in epithelial raft 
cultures. Genes and Development, 6(7), 1131–1142. DOI: 10.1101/gad.6.7.1131 
Doorbar, J., Quint, W., Banks, L., Bravo, IG., Stoler, M., Broker, TR. & Stanley, MA. (2012). The 
biology and life-cycle of human papillomaviruses. Vaccine, 30(5), F55–F70. DOI: 
10.1016/j.vaccine.2012.06.083 
Dürst, M, Gissmann, L., Ikenberg, H & zur Hausen, H. (1983). A papillomavirus DNA from a cervical 
carcinoma and its prevalence in cancer biopsy samples from different geographic regions. Proceedings 
of the National Academy of Sciences of the United States of America, 3812–3815. DOI: 
10.1073/pnas.80.12.3812  
Egawa, N. & Doorbar, J. (2017). The low-risk papillomaviruses. Virus Research, 231, 119–127. DOI: 
10.1016/j.virusres.2016.12.017 
Egawa, N., Egawa, K., Griffin, H. & Doorbar, J. (2015). Human papillomaviruses; epithelial tropisms, 
and the development of neoplasia. Viruses, 7(7), 3863–3890. DOI: 10.3390/v7072802 
El Achkar, VNR., Costa, V., Sichero, L., Ribeiro-Silva, A., Carlos, R., Villa, LL. & Kaminagakura, E. 
(2020). Inflammatory cells and HPV type related to aggressiveness in laryngeal papillomatosis. Oral 
86 
Surgery, Oral Medicine, Oral Pathology and Oral Radiology, 30(3) e275. DOI: 
10.1016/j.oooo.2020.04.752 
Fang, L., Lin, X., Yang, Y., Song, Z., Ding, X., Tan, L. & Gao, P. (2020). Genetic variability, phylogeny 
and functional implication of the long control region in human papillomavirus type 16, 18 and 58 in 
Chengdu, China. Virology Journal, 17(1), 1-15. DOI: 10.1186/s12985-020-01349-3 
Fauquet, CM., Mayo, MA., Maniloff, J., Desselberger, U. & Ball, LA. (2005). VIIIth report of the 
International Committee on Taxonomy of Viruses, in CM, Fauquet; MA, Mayo; J, Maniloff; U, 
Desselberger & LA, Ball (eds). Virus Taxonomy. Academic Press, (83), 988-992 
Felsenstein, J. (1981). Evolutionary trees from DNA sequences: A maximum likelihood approach. 
Journal of Molecular Evolution, 17(6), 368–376. DOI: 10.1007/bf01734359 
Flores-Díaz, E., Sereday, KA., Ferreira, S., Sirak, B., Sobrinho, JS., Baggio, ML., Galan, L., Silva, RC., 
Lazcano-Ponce, E., Giuliano, AR., Villa, LL., and Sichero, L. (2017). HPV-6 molecular variants 
association with the development of genital warts in men: The HIM Study, The Journal of Infectious 
Diseases, 215(4), 559–565. DOI: 10.1093/infdis/jiw600 
Fusconi, M., Grasso, M., Greco, A., Gallo, A., Campo, F., Remacle, M., Turchetta, R., Pagliuca, G. & 
DE Vincentiis, M. (2014). Recurrent respiratory papillomatosis by HPV: Review of the literature and 
update on the use of cidofovir. Acta otorhinolaryngologica Italica, 34(6), 375–381. Retrieved from 
https://www.actaitalica.it/index 
Gáll, T., Kis, A., Tatár, TZ., Kardos, G., Gergely, L. & Szarka, K. (2013). Genomic differences in the 
background of different severity in juvenile-onset respiratory papillomatoses associated with human 
papillomavirus type 11. Medical Microbiology and Immunology. 202, 353–363. DOI: 10.1007/s00430-
013-0297-y 
Gaylis, B. & Hayden, RE. (1991). Recurrent respiratory papillomatosis: Progression to invasion and 
malignancy. American Journal of Otolaryngology, 12(2), 104-112. DOI: 10.1016/0196-
0709(91)90045-h 
Gazia, F., Galletti, B., Freni, F., Bruno, R., Sireci, F., Galletti, C., Meduri, F. & Galletti, F. (2020). Use 
of intralesional cidofovir in the recurrent respiratory papillomatosis: A review of the literature. 
European Review for Medical and Pharmacological Sciences, 24(2), 956-962. DOI: 
10.26355/eurrev_202001_20081 
Georgescu, SR., Mitran, CI., Mitran, MI., Caruntu, C., Sarbu, MI., Matei, C., Nicolae, I., Tocut, SM., 
Popa, MI. & Tampa, M. (2018). New insights in the pathogenesis of HPV infection and the associated 
87 
carcinogenic processes: The role of chronic inflammation and oxidative stress. Journal of Immunology 
Research, 2018, 1-10. DOI: 10.1155/2018/5315816 
Gerein, V., Rastorguev, E., Gerein, J., Draf, W. & Schirren, J. (2005). Incidence, age at onset, and 
potential reasons of malignant transformation in recurrent respiratory papillomatosis patients: 20 years’ 
experience. Otolaryngology—Head and Neck Surgery, 132(3), 392-394. DOI: 
10.1016/j.otohns.2004.09.035 
Gissmann, L., Diehl, V., Schultz‐Coulon, HJ & zur Hausen, H. (1982). Molecular cloning and 
characterization of human papilloma virus DNA derived from laryngeal papilloma. Journal of Virology, 
44, 393–400. DOI: 10.1128/jvi.44.1.393-400.1982  
Gissmann, L., Pfister, H. & zur Hausen, H. (1977). Human papilloma viruses (HPV): Characterization 
of four different isolates. Virology, 76(2), 569-580. DOI: 10.1016/0042-6822(77)90239-2 
Gissmann, L., Wolnik, L., Ikenberg, H., Koldovsky, U., Schnürch, HG. & zur Hausen, H. (1983). 
Human papillomavirus types 6 and 11 DNA sequences in genital and laryngeal papillomas and in some 
cervical cancers. Proceedings of the National Academies of Science, 80, 560–563. DOI: 
10.1073/pnas.80.2.560 
Giuliano, AR., Botha, MH., Zeier, M., Abrahamsen, ME., Glashoff, RH., van der Laan, LE., Papenfuss, 
M., Engelbrecht, S., Schim van der Loeff, MF., Sudenga, SL., Torres, BN., Kipping, S. & Taylor, D. 
(2015). High HIV, HPV, and STI prevalence among young Western Cape, South African women: EVRI 
HIV prevention preparedness trial. Journal of Acquired Immune Deficiency Syndromes, 68(2), 227-35. 
DOI: 10.1097/qai.0000000000000425 
Godínez, JM., Nicolás-Párraga, S., Pimenoff, VN., Mengual-Chuliá, B., Muñoz, N., Bosch, FX., 
Sánchez, GI., McCloskey, J. & Bravo IG. (2014). Phylogenetically related, clinically different: Human 
papillomaviruses 6 and 11 variants distribution in genital warts and in laryngeal papillomatosis. Clinical 
Microbiology and Infection, 20(6), O406–O413. DOI: 10.1111/1469-0691.12420 
Graham, SV. & Faizo, A. (2017). Control of human papillomavirus gene expression by alternative 
splicing. Virus Research, 231, 83-95. DOI: 10.1016/j.virusres.2016.11.016 
Grasso, M., Remacle, M., Bachy, V., van der Vorst, S. & Lawson, G. (2014). Use of cidofovir in HPV 
patients with recurrent respiratory papillomatosis. European Archives of Oto-Rhino-Laryngology, 
271(11), 2983-2990. DOI: 10.1007/s00405-014-3055-x 
88 
Graupp, M., Gugatschka, M., Kiesler, K., Reckenzaun, E., Hammer, G. & Friedrich, G. (2013). 
Experience of 11 years use of cidofovir in recurrent respiratory papillomatosis. European Archives of 
Oto-Rhino-Laryngology, 270(2), 641-646. DOI: 10.1007/s00405-012-2221-2 
Hahn, HS., Kee, MK., Kim, HJ., Kim, MY., Kang, YS., Park, JS., Kim, TJ. (2013). Distribution of 
maternal and infant human papillomavirus: Risk factors associated with vertical transmission. European 
Journal of Obstetrics & Gynecology and Reproductive Biology, 169(2), 202–206. DOI: 
10.1016/j.ejogrb.2013.02.024 
Halavaty, KK., Regan, J., Mehta, K. & Laimins, L. (2014). Human papillomavirus E5 oncoproteins 
bind the A4 endoplasmic reticulum protein to regulate proliferative ability upon differentiation. 
Virology. 452, 223–30. DOI: 10.1016/j.virol.2014.01.013 
Hall, BG. (2013). Building phylogenetic trees from molecular data with MEGA. Molecular Biology 
and Evolution, 30(5), 1229–1235. DOI: 10.1093/molbev/mst012 
Harari, A., Chen, Z. & Burk, RD. (2014). Human papillomavirus genomics: Past, present and future. 
Current Problems in Dermatology, 45, 1-18. DOI: 10.1159/000355952 
Hariri, S., Schuler, MS., Naleway, AL., Daley, MF., Weinmann, S., Crane, B., Newcomer, SR., Tolsma, 
D. & Markowitz, LE. (2018). Human papillomavirus vaccine effectiveness against incident genital 
warts among female health-plan enrollees, United States. American Journal of Epidemiology, 187(2), 
298-305. DOI: 10.1093/aje/kwx253 
Heinzel, PA., Chan, SY., Ho, L., O’Connor, M., Balaram, P., Campo, MS., Fujinaga, K., Kiviat, N., 
Kuypers, J., Pfister, H., Steinberg, BM., Tay, SK., Villa, LL. & Bernard, HU. (1995). Variation of 
human papillomavirus type 6 (HPV-6) and HPV-11 genomes sampled throughout the world. Journal 
of Clinical Microbiology, 33, 1746–1754. DOI: 10.1128/jcm.33.7.1746-1754.1995  
Hemmat, N. & Baghi, HB. (2018). Human papillomavirus E5 protein, the undercover culprit of 
tumorigenesis. Infectious Agents and Cancer, 13, 31. DOI: 10.1186/s13027-018-0208-3 
Hirose, Y., Onuki, M., Tenjimbayashi, Y., Mori, S., Ishii, Y., Takeuchi, T., Tasaka, N., Satoh, T., 
Morisada, T., Iwata, T., Miyamoto, S., Matsumoto, K., Sekizawa, A. & Kukimoto, I. (2018). Within-
host variations of human papillomavirus reveal APOBEC signature mutagenesis in the viral 
genome. Journal of Virology, 92(12), e00017-18. DOI: 10.1128/jvi.00017-18 
Hoesli, RC., Wingo, ML., Richardson, BE. & Bastian, RW. (2020). Identification of 11 different HPV 
subtypes in adult patients with recurrent respiratory papillomatosis. Otolaryngology—Head and Neck 
Surgery, 163(4), 785-790. DOI: 10.1177/0194599820931817 
89 
Huebbers, CU., Preuss, SF., Kolligs, J., Vent, J., Stenner, M., Wieland, U., Silling, S., Drebber, U., 
Speel, EJM. & Klussmann, JP. (2013). Integration of HPV6 & downregulation of AKR1C3 expression 
mark malignant transformation in a patient with juvenile-onset laryngeal papillomatosis. PLOS One, 
8(2), e57207. DOI: 10.1371/journal.pone.0057207 
Intakorn, P. & Sonsuwan, N. (2014). Human papillomatosis genotyping and severity in patients with 
recurrent respiratory papillomatosis. Journal of the Medical Association of Thailand, 97 (6), S136–
S141 
International Committee on Taxonomy of Viruses. (2021). Taxonomy, viewed on 22 July 2021, 
<https://talk.ictvonline.org/taxonomy/> 
Ivancic, R., Iqbal, H., deSilva, B., Pan, Q. & Matrka, L. (2018). Current and future management of 
recurrent respiratory papillomatosis. Laryngoscope Investigative Otolaryngology, 3(1), 22-34. DOI: 
10.1002/lio2.132 
Ivancic, R., Iqbal, H., deSilva, B., Pan, Q. & Matrka, L. (2020). Immunological tolerance of low‐risk 
HPV in recurrent respiratory papillomatosis. Clinical and Experimental Immunology, 199(2), 131-142. 
DOI: 10.1111/cei.13387 
Jelen, MM., Chen, Z., Kocjan, BJ., Burt, FJ., Chan, PK., Chouhy, D., Combrinck, CE., Coutlée, F., 
Estrade, C., Ferenczy, A., Fiander, A., Franco, EL., Garland, SM., Giri, AA., González, JV., Gröning, 
A., Heidrich, K., Hibbitts, S., Hošnjak, L., Luk, TN., Marinic, K., Matsukura, T., Neumann, A., 
Oštrbenk, A., Picconi, MA., Richardson, H., Sagadin, M., Sahli, R., Seedat, RY., Seme, K., Severini, 
A., Sinchi, JL., Smahelova, J., Tabrizi, SN., Tachezy, R., Tohme, S., Uloza, V., Vitkauskiene, A., 
Wong, YW., Zidovec Lepej, S., Burk, RD. & Poljak, M. (2014). Global genomic diversity of human 
papillomavirus 6 based on 724 isolates and 190 complete genome sequences. Journal of Virology, 88, 
7307–7316. DOI: 10.1128/jvi.00621-14  
Jelen, MM., Chen, Z., Kocjan, BJ., Hošnjak, L., Burt, FJ., Chan, PK., Chouhy, D., Combrinck, CE., 
Estrade, C., Fiander, A., Garland, SM., Giri, AA., González, JV., Gröning, A., Hibbitts, S., Luk, TNM., 
Marinic, K., Matsukura, T., Neumann, A., Oštrbenk, A., Picconi, MA., Sagadin, M., Sahli, R., Seedat, 
RY., Seme, K., Severini, A., Sinchi, JL., Smahelova, J., Tabrizi, SN., Tachezy, R., Tohme Faybush, S., 
Uloza, V., Uloziene, I., Wong, YW., Židovec Lepej, S., Burk, RD. & Poljak, M. (2016). Global genomic 
diversity of human papillomavirus 11 based on 433 isolates and 78 complete genome sequences. 
Journal of Virology, 90(11), 5503-5513. DOI: 10.1128/jvi.03149-15 
90 
Kardani, K. & Bolhassani, A. (2018a). HPV proteins and their functions, in A, Bolhassani. HPV 
Infections: Diagnosis, Prevention and Treatment. Bentham Science Publishers, 8-20. DOI: 
10.2174/97816810861701180101 
Kardani, K. & Bolhassani, A. (2018b). Types of benign or malignant diseases associated with hpv 
infection, in A, Bolhassani. HPV Infections: Diagnosis, Prevention and Treatment. Bentham Science 
Publishers, 30-40. DOI: 10.2174/97816810861701180101 
Kardani, K., Naderi, N. & Bolhassani, A. (2018). The life cycle and transmission of hpv types, in N, 
Naderi; K, Kardani & Bolhassani. HPV Infections: Diagnosis, Prevention, and Treatment. Bentham 
Science Publishers, 44-52. DOI: 10.2174/97816810861701180101 
Klingelhutz, AJ. & Roman, A. (2012). Cellular transformation by human papillomaviruses: Lessons 
learned by comparing high-and low-risk viruses. Virology, 424(2), 77-98. DOI: 
10.1016/j.virol.2011.12.018 
Klug, A. & Finch, JT. (1965). Structure of viruses of the papilloma-polyoma type: I. Human wart virus. 
Journal of Molecular Biology, 11(2), 403-423. DOI: 10.1016/s0022-2836(65)80066-3 
Kocjan, BJ., Bzhalava, D., Forslund, O., Dillner, J. & Poljak, M. (2015). Molecular methods for 
identification and characterization of novel papillomaviruses. Clinical Microbiology and 
Infection, 21(9), 808–816. DOI: 10.1016/j.cmi.2015.05.011 
Kuhner, MK. & Felsenstein, J. (1994). A simulation comparison of phylogeny algorithms under equal 
and unequal evolutionary rates. Molecular Biology and Evolution, 11(3), 459-68. DOI: 
10.1093/oxfordjournals.molbev.a040126 
Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. (2018). MEGA X: Molecular evolutionary 
genetics analysis across computing platforms. Molecular Biology and Evolution, 35(6), 1547–1549. 
DOI: 10.1093/molbev/msy096 
Larkin, MA., Blackshields, G., Brown, NP., Chenna, R., McGettigan, PA., McWilliam, H., Valentin, 
F., Wallace, IM., Wilm, A., Lopez, R., Thompson, JD., Gibson, TJ. & Higgins, DG. (2007). Clustal W 
and Clustal X version 2.0. Bioinformatics, 23, 2947-2948. DOI: 10.1093/bioinformatics/btm404 
Lebeuf-Taylor, E., McCloskey, N., Bailey, SF., Hinz, A. & Kassen, R. (2019). The distribution of 
fitness effects among synonymous mutations in a gene under directional selection. eLife, 8, e45952. 
DOI: 10.7554/eLife.45952 
91 
Liu, X., Roberts, J., Dakic, A., Zhang, Y. & Schlegel, R. (2008). HPV E7 contributes to the telomerase 
activity of immortalized and tumorigenic cells and augments E6-induced hTERT promoter function. 
Virology, 375(2), 611-623. DOI: 10.1016/j.virol.2008.02.025 
Longworth, MS. & Laimins, LA. (2004). Pathogenesis of human papillomaviruses in differentiating 
epithelia. Microbiology and Molecular Biology Reviews, 68(2), 362-372. DOI: 
10.1128/mmbr.68.2.362-372.2004  
Madison, KC. (2003). Barrier function of the skin: “la raison d'etre” of the epidermis. Journal of 
Investigative Dermatology, 121(2), 231-241. DOI: 10.1046/j.1523-1747.2003.12359.x 
Makatsa, S. (2012). Detection of HPV-11 variants associated with recurrent laryngeal papillomatosis 
based on LCR-E6 sequence data, Southern Africa. BMedSc Hons mini dissertation. University of the 
Free State, Bloemfontein 
Mattoon, D., Gupta, K., Doyon, J., Loll, PJ. & DiMaio, D. (2001). Identification of the transmembrane 
dimer interface of the bovine papillomavirus E5 protein. Oncogene, 20(29) 3824-3834. DOI: 
10.1038/sj.onc.1204523 
Maver, PJ., Kocjan, BJ., Seme, K., Potocˇnik, M., Gale, N. & Poljak, M. (2011). Prevaccination 
genomic diversity of human papillomavirus genotype 11: A study on 63 clinical isolates and 10 full-
length genome sequences. Journal of Medical Virology, 83, 461–470. DOI: 10.1002/jmv.21994. 
Mbulawa, Z., Kularatne, R., Kufa-Chakezha, T. & Williamson, AL. (2017). Sentinel surveillance of 
human papillomavirus genotypes among patients attending public healthcare facilities in South Africa. 
16(2), 1-8. Retrieved from http://nicd.ac.za 
Mbulawa, ZZ., Van Schalkwyk, C., Hu, NC., Meiring, TL., Barnabas, S., Dabee, S., Heather Jaspan, 
H., Kriek, Z. Jaumdally, SZ., Muller, E., Bekker, LG., Lewis, DA., Dietrich, J., Gray, G., Passmore, 
JAS. & Williamson, AL. (2018). High human papillomavirus (HPV) prevalence in South African 
adolescents and young women encourages expanded HPV vaccination campaigns. PLOS One, 13(1), 
e0190166. DOI: 10.1371/journal.pone.0190166 
McBride, AA. (2017). Mechanisms and strategies of papillomavirus replication. Biological Chemistry, 
398(8), 919-927. DOI: 10.1515/hsz-2017-0113 
Miguel Rocha, M. & Ferreira, PG. (2018). Phylogenetic Analysis, in M, Miguel Rocha & PG, Ferreira. 
Bioinformatics Algorithms. Academic Press, 199-220  
Murahwa, AT., Nindo, F., Onywera, H., Meiring, TL., Martin, DP. & Williamson, AL. (2019). 
Evolutionary dynamics of ten novel Gamma-PVs: Insights from phylogenetic incongruence, 
92 
recombination and phylodynamic analyses. BMC Genomics, 20(1), 368. DOI: 10.1186/s12864-019-
5735-9 
Novakovic, D., Cheng, ATL., Zurynski, Y., Booy, R., Walker, PJ., Berkowitz, R., Harrison, H., Black, 
R., Perry, C., Vijayasekaran, S., Wabnitz, D., Burns, H., Tabrizi, SN., Garland, SM., Elliott, E. & 
Brotherton, JML. (2018). A prospective study of the incidence of juvenile-onset recurrent respiratory 
papillomatosis after implementation of a national HPV vaccination program. The Journal of Infectious 
Diseases, 217(2), 208-212. DOI: 10.1093/infdis/jix498 
Okonechnikov, K., Golosova, O., Fursov, M. & the UGENE team. (2012). Unipro UGENE: A unified 
bioinformatics toolkit. Bioinformatics, 28, 1166-1167. DOI: 10.1093/bioinformatics/bts091 
Omland, T., Akre, H., Lie, KA., Jebsen, P., Sandvik, L. & Brøndbo, K. (2014). Risk factors for 
aggressive recurrent respiratory papillomatosis in adults and juveniles. PLOS One, 9(11), e113584. 
DOI: 10.1371/journal.pone.0113584  
Pal, A. & Kundu, R. (2020). Human papillomavirus E6 and E7: The cervical cancer hallmarks and 
targets for therapy. Frontiers in Microbiology, 10, 3116. DOI: 
https://doi.org/10.3389/fmicb.2019.03116 
Parker, J. & Chen, J. (2017). Application of next generation sequencing for the detection of human viral 
pathogens in clinical specimens. Journal of Clinical Virology, 86, 20–26. DOI: 
10.1016/j.jcv.2016.11.010 
Pastrana, DV., Buck, CB., Pang, YY., Thompson, CD., Castle, PE., FitzGerald, PC., Krüger Kjaer, S., 
Lowy, DR. & Schiller, JT. (2004). Reactivity of human sera in a sensitive, high-throughput 
pseudovirus-based papillomavirus neutralization assay for HPV16 and HPV18. Virology, 321(2), 205–
216. DOI: 10.1016/j.virol.2003.12.027 
Peñaloza-Plascencia, M., Montoya-Fuentes, H., Flores-Martínez, SE., Fierro-Velasco, FJ., Peñaloza-
González, JM. & Sánchez-Corona, J. (2000). Molecular identification of 7 human papillomavirus types 
in recurrent respiratory papillomatosis. Archives of Otolaryngology–Head and Neck Surgery, 126(9), 
1119–1123. DOI: 10.1001/archotol.126.9.1119 
Pinidis, P., Tsikouras, P., Iatrakis, G., Zervoudis, S., Koukouli, Z., Bothou, A., Galazios, G. & 
Vladareanu, S. (2016). Human papilloma virus’ life cycle and carcinogenesis. Maedica, 11(1), 48-54. 
Retrieved from https://www.maedica.ro/ 
93 
Reidy, PM., Dedo, HH., Rabah, R., Field, JB., Mathog, RH., Gregoire, L. & Lancaster, WD. (2004). 
Integration of human papillomavirus type 11 in recurrent respiratory papilloma-associated cancer. The 
Laryngoscope, 114(11), 1906–1909. DOI: 10.1097/01.mlg.0000147918.81733.49 
Ribeiro, AL., Caodaglio, AS. & Sichero, L. (2018). Regulation of HPV transcription. Clinics, 73(suppl 
1), e486s. DOI: 10.6061/clinics/2018/e486s 
Rintala, MA., Grénman, SE., Puranen, MH., Isolauri, E., Ekblad, U., Kero, PO. & Syrjänen, SM. 
(2005). Transmission of high-risk human papillomavirus (HPV) between parents and infant: A 
prospective study of HPV in families in Finland. Journal of Clinical Microbiology, 43(1), 376-381. 
DOI: 10.1128/jcm.43.1.376-381.2005 
Rodier, C., Lapointe, A., Coutlée, F., Mayrand, M. H., Dal Soglio, D., Roger, M. & Trottier, H. (2013). 
Juvenile respiratory papillomatosis: Risk factors for severity. Journal of Medical Virology, 85(8), 
1447–1458. DOI: 10.1002/jmv.23615  
Rodríguez-Álvarez, MI., Gómez-Urquiza, JL., Husein-El Ahmed, H., Albendín-García, L., Gómez-
Salgado, J. & Cañadas-De la Fuente, GA. (2018). Prevalence and risk factors of human papillomavirus 
in male patients: A systematic review and meta-analysis. International Journal of Environmental 
Research and Public Health, 15(10), 2210. DOI: 10.3390/ijerph15102210 
Rosenberg, T., Philipsen, BB., Mehlum, CS., Dyrvig, AK., Wehberg, S., Chirilǎ, M. & Godballe, C. 
(2019). Therapeutic use of the human papillomavirus vaccine on recurrent respiratory papillomatosis: 
A systematic review and meta-analysis. The Journal of Infectious Diseases, 219(7), 1016–1025. DOI: 
10.1093/infdis/jiy616 
Rous, P. & Beard, JW. (1935). The progression to carcinoma of virus-induced rabbit papillomas 
(Shope). The Journal of Experimental Medicine, 62(4), 523-48. DOI: 10.1084/jem.62.4.523 
Rusinko, J. & McPartlon, M. (2017). Species tree estimation using Neighbor Joining. Journal of 
Theoretical Biology, 414, 5–7. DOI: 10.1016/j.jtbi.2016.11.005 
Sabeena, S., Bhat, P., Kamath, V. & Arunkumar, G. (2017). Possible non‐sexual modes of transmission 
of human papilloma virus. Journal of Obstetrics and Gynaecology Research, 43(3), 429–435. DOI: 
10.1111/jog.13248 
Saitou, N. & Nei, M. (1987). The Neighbor-Joining method: A new method for reconstructing 
phylogenetic trees. Molecular Biology and Evolution, 4(4), 406-425. DOI: 
10.1093/oxfordjournals.molbev.a040454 
94 
Sanger, F., Nicklen, S. & Coulson, AR. (1977). DNA sequencing with chain-terminating inhibitors. 
Proceedings of the National Academy of Sciences of the United States of America, 74(12), 5463–5467. 
DOI: 10.1073/pnas.74.12.5463 
Seedat, RY. & Schall, R. (2018). Age of diagnosis, incidence and prevalence of recurrent respiratory 
papillomatosis—A South African perspective. Clinical Otolaryngology, 43, 533– 537. DOI: 
10.1111/coa.13016 
Seedat, RY. (2020). Juvenile-onset recurrent respiratory papillomatosis diagnosis and management - A 
developing country review. Pediatric Health, Medicine and Therapeutics, 11, 39–46. DOI: 
10.2147/phmt.s200186 
Seedat, RY., Combrinck, CE. & Burt, FJ. (2013). HPV associated with recurrent respiratory 
papillomatosis. Future Virology, 8(5), 477–492. DOI: 10.2217/fvl.13.31 
Serdoz, S., Egri-Nagy, A., Sumner, J., Holland, BR., Jarvis, PD., Tanaka, MM. & Francis, AR. (2017). 
Maximum likelihood estimates of pairwise rearrangement distances. Journal of Theoretical 
Biology, 423, 31–40. DOI: 10.1016/j.jtbi.2017.04.015 
Shope, RE. & Hurst, EW. (1933). Infectious papillomatosis of rabbits: With a note on the 
histopathology. The Journal of Experimental Medicine, 58(5), 607-24. DOI: 10.1084/jem.58.5.607 
Siqueira, JD., Alves, BM., Prellwitz, IM., Furtado, C., Meyrelles, ÂR., Machado, ES., Seuánez, HN., 
Soares, MA. & Soares, EA. (2016). Identification of novel human papillomavirus lineages and 
sublineages in HIV/HPV-coinfected pregnant women by next-generation sequencing. Virology, 493, 
202–208. DOI: 10.1016/j.virol.2016.03.027 
Smith, EM., Parker, MA., Rubenstein, LM., Haugen, TH., Hamsikova, E. & Turek, LP. (2010). 
Evidence for vertical transmission of HPV from mothers to infants. Infectious Diseases in Obstetrics 
and Gynecology, 2010, 326369. DOI: 10.1155/2010/326369 
So, KA., Lee, IH., Kim, TJ. & Lee, KH. (2019). Risk factors of persistent HPV infection after treatment 
for high-grade squamous intraepithelial lesion. Archives of Gynecology and Obstetrics, 299, 223–227. 
DOI: 10.1007/s00404-018-4936-9 
Sridhar, S., To, KK., Chan, JF., Lau, SK., Woo, PC. & Yuen, KY. (2015). A systematic approach to 
novel virus discovery in emerging infectious disease outbreaks. The Journal of Molecular 
Diagnostics, 17(3), 230–241. DOI: 10.1016/j.jmoldx.2014.12.002 
95 
Stanley, MA. (2020). Epithelial cell responses to infection with human papillomavirus. Clinical 
Microbiology Reviews, 25(2), 215–222. DOI: 10.1128/cmr.05028-11 
Stenlund, A. (2003). Initiation of DNA replication: Lessons from viral initiator proteins. Nature 
Reviews Molecular Cell Biology, 4, 777–785. DOI: 10.1038/nrm1226 
Sterling, JC., Handfield‐Jones, S. & Hudson, PM. (2001). Guidelines for the management of cutaneous 
warts. British Journal of Dermatology, 144(1), 4-11. DOI: 10.1046/j.1365-2133.2001.04066.x 
Stoler, MH., Wolinsky, SM., Whitbeck, A., Broker, TR. & Chow, LT. (1989). Differentiation-linked 
human papillomavirus types 6 and 11 transcription in genital condylomata revealed by in situ 
hybridization with message-specific RNA probes. Virology, 172(1), 331–340. DOI: 10.1016/0042-
6822(89)90135-9 
Strauss, MJ., Shaw, EW., Bunting, H. & Melnick, JL. (1949). “Crystalline” virus-like particles from 
skin papillomas characterized by intranuclear inclusion bodies. Sage Journals, 72(1), 46-50. DOI: 
10.3181/00379727-72-17328 
Swain, SK., Das, A., Sahoo, L., Debta, P. (2020). Pediatric laryngeal papillomatosis: A review. Annals 
of Indian Academy of Otorhinolaryngology Head and Neck Surgery, 4(2), 19-23. DOI: 
10.4103/aiao.aiao_11_19 
Taku, O., Businge, CB., Mdaka, ML., Phohlo, K., Basera, W., Garcia-Jardon, M., Meiring, TL., 
Gyllensten, U., Williamson, AL. & Mbulawa, Z. (2020). Human papillomavirus prevalence and risk 
factors among HIV-negative and HIV-positive women residing in rural Eastern Cape, South 
Africa. International Journal of Infectious Diseases, 95, 176–182. DOI: 10.1016/j.ijid.2020.02.051 
The International HPV Reference Centre. (2021). Human Reference clones, viewed on 22 July 2021, 
<https://www.hpvcenter.se/human_reference_clones> 
Tjon Pian Gi, RE., Dietz, A., Djukic, V., Eckel, HE., Friedrich, G., Golusinski, W., Hantzakos, A., 
Lawson, G., Remacle, M., Rihkanen, H. & Dikkers, FG. (2012). Treatment of recurrent respiratory 
papillomatosis and adverse reactions following off-label use of cidofovir (Vistide®). European 
archives of Otorhino-Laryngology, 269(2), 361–362. DOI: 10.1007/s00405-011-1804-7  
Trifinopoulos, J., Nguyen, LT., von Haeseler, A. & Minh, BQ. (2016) W-IQ-TREE: A fast online 
phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research, 44, W232-W235. DOI: 
10.1093/nar/gkw256 
96 
Tseng, CJ., Liang, CC., Soong, YK. & Pao, CC. (1998). Perinatal transmission of human papillomavirus 
in infants: Relationship between infection rate and mode of delivery. Obstetrics & Gynecology, 91(1), 
92-96. DOI: 10.1016/S0029-7844(97)00594-2 
Tseng, CJ., Lin, CY., Wang, RL., Chen, LJ., Chang, YL., Hsieh, TT. & Pao, CC. (1992). Possible 
transplacental transmission of human papillomaviruses. American Journal of Obstetrics and 
Gynecology, 166(1 Pt 1), 35–40. DOI: 10.1016/0002-9378(92)91825-u 
Tuna, M. & Amos, CI. (2017). Next generation sequencing and its applications in HPV-associated 
cancers. Oncotarget, 8(5), 8877–8889. DOI: 10.18632/oncotarget.12830 
van Doorslaer, K. (2013). Evolution of the Papillomaviridae. Virology, 445,11–20. DOI: 
10.1016/j.virol.2013.05.012 
van Regenmortel, MHV., Fauquet, CM., Bishop, DHL., Calisher, CH., Carsten, EB., Estes, MK., 
Lemon, SM., Maniloff, J., Mayo, MA., McGeoch, DJ., Pringle, CR. & Wickner, RB. (2002). Virus 
Taxonomy. Seventh Report of the International Committee for the Taxonomy of Viruses. Academic 
Press, New-York 
Venuti, A., Paolini, F., Nasir, L., Corteggio, A., Roperto, S., Campo, MS. & Borzacchiello, G. (2011). 
Papillomavirus E5: the smallest oncoprotein with many functions. Molecular Cancer, 10, 140. DOI: 
10.1186/1476-4598-10-140 
Wallace, NA. & Galloway, DA. (2014). Manipulation of cellular DNA damage repair machinery 
facilitates propagation of human papillomaviruses. Seminars in Cancer Biology, 26, 30–42. DOI: 
10.1016/j.semcancer.2013.12.003 
Wang, JW. & Roden, RB. (2013). L2, the minor capsid protein of papillomavirus. Virology, 445(1-2), 
175–186. DOI: 10.1016/j.virol.2013.04.017 
Watts, DH., Koutsky, LA., Holmes, KK., Goldman, D., Kuypers, J., Kiviat, NB. & Galloway, DA. 
(1998). Low risk of perinatal transmission of human papillomavirus: Results from a prospective cohort 
study. American Journal of Obstetrics and Gynecology, 178(2), 365–373. DOI: 10.1016/s0002-
9378(98)80027-6 
Welschmeyer, A. & Berke, G. (2021). An updated review of the epidemiological factors associated with 
recurrent respiratory papillomatosis. Laryngoscope Investigative Otolaryngology. 6. DOI: 
10.1002/lio2.521.  
97 
Wilcox, LJ., Hull, BP., Baldassari, CM. & Derkay, CS. (2014). Diagnosis and management of recurrent 
respiratory papillomatosis. The Pediatric Infectious Disease Journal, 33(12), 1283–1284. DOI: 
10.1097/inf.0000000000000551 
Wu, X., Zhang, C., Feng, S., Liu, C., Li, Y., Yang, Y., Gao, J., Li, H., Meng, S., Li, L., Zhang, Y., Hu, 
X., Wu, X., Lin, L., Li, X. & Wang, Y. (2009). Detection of HPV types and neutralizing antibodies in 
Gansu province, China. Journal of Medical Virology, 81, 693–702. DOI: 10.1002/jmv.21435 
Yajid, AI., Zakariah, MA., Mat Zin, AA. & Othman, NH. (2017). Potential role of E4 protein in human 
papillomavirus screening: A review. Asian Pacific Journal of Cancer Prevention, 18(2), 315–319. DOI: 
10.22034/apjcp.2017.18.2.315 
Zahreddine, M., Mayrand, MH., Therrien, C., Trevisan, A., Dagenais, C., Monnier, P., Laporte, L., 
Niyibizi, J., Deshaies, C., Carceller, AM., Fraser, W., Brassard, P., Lacroix, J., Bédard, MJ., Girard, I., 
Audibert, F., Coutlée, F. & Trottier, H. (2020). Antibodies to human papillomavirus types 6, 11, 16 and 
18: Vertical transmission and clearance in children up to two years of age. EClinicalMedicine, 21, 
100334. DOI: 10.1016/j.eclinm.2020.100334  
Zhang, J., Zhang, S., Wang, M., Ding, X., Wen, Q., Chen, Z., Cao, M., Jing, Y. & Zhang, S. (2018). 
Genetic variability in E5, E6, E7 and L1 genes of human papillomavirus type 31. Molecular Medicine 
Reports, 17(4), 5498–5507. DOI: 10.3892/mmr.2018.8500 
Zouridis, A., Kalampokas, T., Panoulis, K., Salakos, N. & Deligeoroglou, E. (2018). Intrauterine HPV 
transmission: A systematic review of the literature. Archives of Gynecology and Obstetrics, 298(1), 35-
44. DOI: 10.1007/s00404-018-4787-4 
zur Hausen, H. (2002). Papillomaviruses and cancer: From basic studies to clinical application. Nature 
Reviews Cancer, 2, 342–350. DOI: 10.1038/nrc798 
zur Hausen, H., Gissmann, L., Steiner, W., Dippold, W. & Dreger, I. (1975). Human papilloma viruses 
and cancer. Bibliotheca Haematologica. 43, 569-71. DOI: 0.1159/000399220
98 
Appendices 
Appendix 1: Human papillomavirus type 11 positive patient sample information 
Date of Birth Sex Diagnosis VBD number 
2014/06/19 F 2018/03/14 114/18 
2014/01/07 F 2018/02/27  12/18* 
2014/07/03 F 2018/02/15 113/18 
2013/03/31 M 2017/07/26 23/17* 
1970/03/03 M 2017/06/21 47/17 
1985/08/22 M 2017/06/13 21/17 
1985/05/16 M 2016/12/05 68/16* 
2012/03/13 M 2016/10/28 48/16* 
2009/07/23 M 2016/08/17 33/16* 
2002/11/12 M 2016/01/24 17/16 
2012/01/08 F 2015/11/18 68/15* 
1992/03/28 F 2015/10/23 70/15 
2007/06/04 F 2015/09/16 49/15* 
2009/03/04 M 2015/09/16 50/15 
1990/05/18 M 2015/09/08 41/15* 
2013/04/23 F 2015/09/01 44/15* 
2011/09/01 M 2015/08/19 43/15 
2013/10/28 M 2015/05/06 16/15* 
1949/01/05 M 2015/04/15  08/15 
2013/07/24 F 2015/04/03 14/15* 
2011/05/29 M 2014/08/02 41/14* 
2010/01/28 M 2014/07/25 38/14 
1971/03/08 F 2014/07/23 36/14 
2009/03/29 M 2014/06/26 28/14* 
2011/03/17 M 2014/05/27 17/14* 
2000/07/05 M 2014/05/26 22/14* 
2007/11/12 M 2014/03/18 29/14* 
2006/01/01 F 2013/12/09 55/13* 
2011/09/07 F 2013/10/19 37/13 
2011/04/24 M 2013/08/02 29/13* 
Continued...  
I 
Date of Birth Sex Diagnosis VBD number 
2010/06/11 F 2013/01/25  08/13* 
2010/08/07 M 2012/10/07  48/12* 
2008/01/27 M 2012/09/26  47/12* 
2011/07/08 M 2012/07/31  39/12* 
2003/10/21 F 2012/06/12  37/12* 
   
14/14 
2008/12/25 M 2012/01/03  09/12* 
1992/03/25 F 2011/11/30  61/11* 
   
 62/11* 
1999/08/08 M 2011/11/02  58/11* 
2011/01/30 M 2011/09/19  52/11* 
1968/12/21 M 2011/08/15  41/11* 
2009/11/11 M 2011/07/25  37/11* 
2010/04/15 F 2011/07/04  35/11* 
2008/02/20 M 2011/06/14  49/12* 
2008/05/16 M 2011/05/23  30/11* 
2008/06/06 M 2011/03/07  34/11* 
2010/08/11 F 2011/02/26  14/11* 
   
18/14 
2008/08/30 F 2010/12/29  04/11* 
2000/10/29 F 2010/12/10 20/16 
2008/10/26 M 2010/10/13  48/10* 
2009/05/06 M 2010/08/18  33/10* 
   
 63/11* 
   
 01/12 
   
 02/12* 
   
 03/12 
   
 04/12* 
1999/03/30 F 2010/07/26  26/10* 
2008/04/23 F 2010/06/30  21/10* 
2003/02/11 M 2010/06/11  23/10* 
2007/01/04 M 2010/01/06  01/10* 
   
 07/10* 
Continued... 
II 
Date of Birth Sex Diagnosis VBD number 
   
 17/10* 
   
 34/10* 
1975/06/26 M 2009/11/23  79/09* 
2007/06/27 M 2009/10/23  74/09* 
   
 15/10* 
1967/12/22 M 2009/06/09  59/09* 
   
 63/09* 
      69/15* 
2000/07/28 M 2008/08/05  55/08* 
2000/10/14 M 2008/01/14  34/08* 
1981/04/23 F 2006/12/13  01/08 
2004/07/01 F 2005/11/28  04/08 
       37/08* 
       08/09* 
       14/09* 
2003/03/22 F 2005/10/27  41/12* 
2001/11/12 F 2003/10/01  17/09* 
1997/09/29 M 2001/10/09  49/08* 
       59/08* 
       69/09* 
       16/10* 
1997/02/23 M 2000/06/19  16/09* 
       52/09* 
       37/10* 
1964/06/08 F 1997/06/30  33/11* 
1993/09/13 M 1997/04/29  05/08 
       45/08* 
       13/10* 
1977/05/01 F 1990/07/15 69/16 
1979/08/04 F 1988/08/05  54/08* 
1979/11/18 F 1984/11/18  77/09 
*Human papillomavirus type 11 samples included in this study 
 
  
III 
Appendix 2: Human papillomavirus type 11 isolates retrieved from GenBank and 
accession numbers 
 
Isolate name on GenBank GenBank Length of 
Accession number complete 
genome 
M14119.1 Human papillomavirus type 11 (HPV-11) complete M14119.1  7934bp 
genome 
LN833187.1 Human papillomavirus type 11 complete genome, LN833187.1  7934bp 
isolate 27 
LN833185.1 Human papillomavirus type 11 complete genome, LN833185.1  7934bp 
isolate 25 
LN833184.1 Human papillomavirus type 11 complete genome, LN833184.1  7934bp 
isolate 24 
LN833183.1 Human papillomavirus type 11 complete genome, LN833183.1  7948bp 
isolate 23 
LN833169.1 Human papillomavirus type 11 complete genome, LN833169.1  7934bp 
isolate 9 
LN833165.1 Human papillomavirus type 11 complete genome, LN833165.1  7934bp 
isolate 5 
LN833161.1 Human papillomavirus type 11 complete genome, LN833161.1  7934bp 
isolate 1 
KU298879.1 Human papillomavirus type 11 isolate 83A.11, KU298879.1  7932bp 
complete genome 
JQ773412.1 Human papillomavirus type 11 strain CU20, complete JQ773412.1  7934bp 
genome 
JQ773411.1 Human papillomavirus type 11 strain CU19, complete JQ773411.1  7934bp 
genome 
JQ773409.1 Human papillomavirus type 11 strain CU17, complete JQ773409.1  7934bp 
genome 
JQ773408.1 Human papillomavirus type 11 strain CU16, complete JQ773408.1  7934bp 
genome 
JN644141.1 Human papillomavirus type 11 isolate GUMC-AJ, JN644141.1  7934bp 
complete genome 
HE611263.1 Human papillomavirus type 11 complete genome, HE611263.1  7934bp 
isolate LP220 
HE574702.1 Human papillomavirus type 11 complete genome, HE574702.1  7934bp 
isolate JO-RRP_2 
IV 
FR872717.1 Human papillomavirus type 11 complete genome FR872717.1  7934bp 
Continued…  
Isolate name on GenBank GenBank Length of 
Accession number complete 
genome 
FN907963.1 Human papillomavirus type 11 complete genome, FN907963.1  7943bp 
isolate CS20 
FN907962.1 Human papillomavirus type 11 complete genome, FN907962.1  7934bp 
isolate CAC86 
FN870021.1 Human papillomavirus type 11 complete genome, FN870021.1  7934bp 
isolate A86 
EU918768.1 Human papillomavirus type 11 isolate LZod45-11, EU918768.1  7934bp 
complete genome 
MN788368.1 Human papillomavirus type 11 isolate JO-RRP10, MN788368.1  7934bp 
complete genome 
MK463921.1 Human papillomavirus type 11 isolate HPV11-gw- MK463921.1  7932bp 
1110, complete genome 
MK463916.1 Human papillomavirus type 11 isolate HPV11-gw- MK463916.1  7932bp 
1105, complete genome 
MK463914.1 Human papillomavirus type 11 isolate HPV11-gw- MK463914.1  7934bp 
1103, complete genome 
MK313767.1 Human papillomavirus type 11 isolate MK313767.1  7934bp 
CAC1/HPV11, complete genome 
MK313765.1 Human papillomavirus type 11 isolate JO- MK313765.1  7934bp 
RRP8/HPV11, complete genome 
MK313763.1 Human papillomavirus type 11 isolate JO- MK313763.1  7934bp 
RRP2/HPV11, complete genome 
 
  
V 
Appendix 3: Health Sciences Research Ethics Committee approval document 
 
 
  
VI 
Appendix 4: Design of E2 segment primers 
 
Forward primer 5’-ACAGTGCAGCTACGCCTATA-3’ (Blue)  
Reverse primer 5’-TTGTACAGGCACTACCTCCATAC-3’ (Green) 
>M14119.1 Human papillomavirus type 11 (HPV-11) complete genome 
ACAGTGCAGCTACGCCTATAGTGCAACTGCAAGGTGATTCCAATTGTTTAAAATGTTTTAGATATAGACTGA
ATGACAAATATAAACATTTGTTTGAATTAGCATCTTCAACGTGGCATTGGGCCTCACCTGAGGCACCACATAA
AAATGCAATTGTAACATTAACATATAGCAGTGAGGAACAACGTCAGCAATTTTTAAACAGTGTAAAAATACCA
CCCACCATTAGGCATAAGGTGGGGTTTATGTCATTACATTTATTGTAACCATTACACCTGTATATATGTATATG
TGTACATAACATACGTGTATGGAGGTAGTGCCTGTACAA 
 
>JN644141.1 Human papillomavirus type 11 isolate GUMC-AJ, complete genome 
ACAGTGCAGCTACGCCTATAGTGCAACTGCAAGGTGATTCCAATTGTTTAAAATGTTTTAGATATCGACTGA
ATGACAAATATAGACATTTGTTTGAATTAGCATCTTCAACGTGGCATTGGGCCTCACCTGAGGCACCACATAA
AAATGCAATTGTAACATTAACATATAGCAGTGAGGAACAACGTCAGCAATTTTTAAACAGTGTAAAAATACCA
CCCACCATTAGGCATAAGGTGGGGTTTATGTCATTACATTTATTGTAACCATTGCACCTGTATATATGTATATG
TGTACATAACATACGTGTATGGAGGTAGTGCCTGTACAA 
 
>JQ773408.1 Human papillomavirus type 11 strain CU16, complete genome 
ACAGTGCAGCTACGCCTATAGTGCAACTGCAAGGTGATTCCAATTGTTTAAAATGTTTTAGATATCGACTGA
ATGACAAATATAAACATTTGTTTGAATTAGCATCTTCAACGTGGCATTGGGCCTCACCTGAGGCACCACATAA
AAATGCAATTGTAACATTAACCTATAGCAGTGAGGAACAACGTCAGCAATTTTTAAACAGTGTAAAAATACCA
CCCACCATTAGGCATAAGGTGGGGTTTATGTCATTACATTTATTGTAACCATTGCACCTGTATATATGTATATG
TGTACATAACATACGTGTATGGAGGTAGTGCCTGTACAA 
 
>MN788368.1 Human papillomavirus type 11 isolate JO-RRP10, complete genome 
ACAGTGCAGCTACGCCTATAGTGCAACTGCAAGGTGATTCCAATTGTTTAAAATGTTTTAGATATCGACTGA
ATGACAAATATAGACATTTGTTTGAATTAGCATCTTCAACGTGGCATTGGGCCTCACCTGAGGCACCACATAA
AAATGCAATTGTAACATTAACATATAGCAGTGAGGAACAACGTCAGCAATTTTTAAACAGTGTAAAAATACCA
CCCACCTTAGGCATAAGGTGGGGTTTATGTCATTACATTTATTGTAACCATTGCACCTGTATATATGTATATGT
GTACATAACATACGTGTATGGAGGTAGTGCCTGTACAA 
 
>LN833187.1 Human papillomavirus type 11 complete genome, isolate 27 
ACAGTGCAGCTACGCCTATAGTGCAACTGCAAGGTGATTCCAATTGTTTAAAATGTTTTAGATATAGACTGA
ATGACAAATATAGACATTTGTTTGAATTAGCATCTTCAACGTGGCATTGGGCCTCACCTGAGGCACCACATAA
AAATGCAATTGTAACATTAACATATAGCAGTGAKGAACAACGTCAGCAATTTTTAAACAGTGTAAAAATACC
ACCCACCATTAGGCATAAGGTGGGGTTTATGTCATTACATTTATTGTAACCATTGTACCTGTATATATGTATAT
GTGTACATAACATACGTGTATGGAGGTAGTGCCTGTACAA 
VII 
Appendix 5: Specificity of E2 segment primers 
 
 
  
VIII 
Appendix 6: 1x TAE preparation 
 
TAE Buffer 50x Stock Recipe 
▪ 242 g tris base in double-distilled H2O 
▪ 57.1 ml glacial acetic acid 
▪ 100 ml 0.5 M EDTA solution (pH 8.0) 
To make the 1x TAE working buffer, add 49 parts of dH2O to 1 part of 50x TAE buffer 
 
Appendix 7: Agarose gel preparation 
 
1% Agarose gel 
40ml 1%TAE 0.4g agarose powder 
50ml 1%TAE 0.5g agarose powder 
100ml 1%TAE 1.0g agarose powder 
200ml 1%TAE 2.0g agarose powder 
 
Appendix 8: GelRed stain preparation 
 
To make 50ml GelRed stain: 
▪ 10ul 10 000x GelRed® Nucleic Acid Gel Stain (Biotum) + 45ml dH20 + 5ml 0.1M NaCl 
▪ Only use 2 – 3 times before preparing a new GelRed stain  
▪ Store GelRed stain in the dark 
 
  
IX 
Appendix 9: Amino acid codon chart 
 SECOND BASE IN CODON   
 T C A G 
T TTT Phenylalanine F TCT Serine S TAT Tyrosine Y TG Cysteine C T 
T 
TTC TCC TAC TG C 
C 
TTA Leucine L TCA TAA STOP TG STOP A 
A 
TTG TCG TAG TG Tryptophan W G 
G 
C CTT Leucine L CCT Proline P CAT Histidine H CG Arginine R T 
T 
CTC CCC CAC CG C 
C 
CT CC CA Glutamine Q CG A 
A A A A 
CT CC CA CG G 
G G G G 
A ATT Isoleucine I ACT Threonine T AAT Asparagine N AG Serine S T 
T 
AT AC AA AG C 
C C C C 
AT AC AA Lysine K AG Arginine R A 
A A A A 
AT Methionine M AC AA AG G 
G G G G 
G GTT Valine V GCT Alanine A GAT Aspartic D GG Glycine G T 
acid T 
GT GC GA GG C 
C C C C 
GT GC GA Glutamic E GG A 
A A A acid A 
GT GC GA GG G 
G G G G 
 
  
X 
FIRST BASE IN CODON THIRD BASE IN CODON 
 
Appendix 10: Pairwise analysis of percentage divergence of nucleotides using the 
human papillomavirus type 11 concatenated E5a/b-L1-URR data set 
 
 
 
 
 
  
XI 
VBD01-10 VBD02-12 VBD04-12 VBD07-10 VBD08-09 VBD08-13 VBD09-12 VBD12-18 VBD13-10 VBD14-09 VBD14-11 VBD14-15 VBD15-10 VBD16-09 VBD16-10 VBD16-15 VBD17-09 VBD17-10 VBD17-14 VBD21-10 VBD22-14 VBD23-10 VBD23-17 VBD26-10 VBD28-14 VBD29-13
VBD01-10
VBD02-12 0,118
VBD04-12 0,118 0,000
VBD07-10 0,000 0,118 0,118
VBD08-09 0,118 0,000 0,000 0,118
VBD08-13 0,118 0,000 0,000 0,118 0,000
VBD09-12 0,118 0,000 0,000 0,118 0,000 0,000
VBD12-18 0,118 0,000 0,000 0,118 0,000 0,000 0,000
VBD13-10 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000
VBD14-09 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000
VBD14-11 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000
VBD14-15 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD15-10 0,128 0,119 0,119 0,128 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,119
VBD16-09 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120
VBD16-10 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000
VBD16-15 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000
VBD17-09 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000
VBD17-10 0,000 0,118 0,118 0,000 0,118 0,118 0,118 0,118 0,118 0,118 0,118 0,118 0,128 0,119 0,118 0,118 0,118
VBD17-14 0,000 0,118 0,118 0,000 0,118 0,118 0,118 0,118 0,118 0,118 0,118 0,118 0,128 0,119 0,118 0,118 0,118 0,000
VBD21-10 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118
VBD22-14 0,000 0,118 0,118 0,000 0,118 0,118 0,118 0,118 0,118 0,118 0,118 0,118 0,128 0,119 0,118 0,118 0,118 0,000 0,000 0,118
VBD23-10 0,128 0,120 0,120 0,128 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,001 0,120 0,120 0,120 0,120 0,128 0,128 0,120 0,128
VBD23-17 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120
VBD26-10 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000
VBD28-14 0,164 0,161 0,161 0,164 0,161 0,161 0,161 0,161 0,161 0,161 0,161 0,161 0,164 0,161 0,161 0,161 0,161 0,164 0,164 0,161 0,164 0,165 0,161 0,161
VBD29-13 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161
VBD29-14 0,128 0,119 0,119 0,128 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,000 0,120 0,119 0,119 0,119 0,128 0,128 0,119 0,128 0,001 0,119 0,119 0,164 0,119
VBD30-11 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD33-10 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD33-11 0,000 0,118 0,118 0,000 0,118 0,118 0,118 0,118 0,118 0,118 0,118 0,118 0,128 0,119 0,118 0,118 0,118 0,000 0,000 0,118 0,000 0,128 0,118 0,118 0,164 0,118
VBD33-16 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
VBD34-08 0,156 0,165 0,165 0,156 0,165 0,165 0,165 0,165 0,165 0,165 0,165 0,165 0,162 0,166 0,165 0,165 0,165 0,156 0,156 0,165 0,156 0,163 0,165 0,165 0,116 0,165
VBD34-10 0,000 0,118 0,118 0,000 0,118 0,118 0,118 0,118 0,118 0,118 0,118 0,118 0,128 0,119 0,118 0,118 0,118 0,000 0,000 0,118 0,000 0,128 0,118 0,118 0,164 0,118
VBD34-11 0,128 0,119 0,119 0,128 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,000 0,120 0,119 0,119 0,119 0,128 0,128 0,119 0,128 0,001 0,119 0,119 0,164 0,119
VBD35-11 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
VBD37-08 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD37-10 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
VBD37-11 0,128 0,119 0,119 0,128 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,000 0,120 0,119 0,119 0,119 0,128 0,128 0,119 0,128 0,001 0,119 0,119 0,164 0,119
VBD37-12 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD39-12 0,128 0,119 0,119 0,128 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,000 0,120 0,119 0,119 0,119 0,128 0,128 0,119 0,128 0,001 0,119 0,119 0,164 0,119
VBD41-11 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD41-12 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD41-14 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
VBD41-15 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
VBD44-15 0,128 0,119 0,119 0,128 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,000 0,120 0,119 0,119 0,119 0,128 0,128 0,119 0,128 0,001 0,119 0,119 0,164 0,119
VBD47-12 0,128 0,119 0,119 0,128 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,000 0,120 0,119 0,119 0,119 0,128 0,128 0,119 0,128 0,001 0,119 0,119 0,164 0,119
VBD48-10 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,001 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
VBD48-12 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD48-16 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD49-08 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD49-12 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD49-15 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD52-09 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
VBD52-11 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD55-13 0,128 0,119 0,119 0,128 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,000 0,120 0,119 0,119 0,119 0,128 0,128 0,119 0,128 0,001 0,119 0,119 0,164 0,119
VBD58-11 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD59-08 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD59-09 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
VBD61-11 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD62-11 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD63-09 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
VBD63-11 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD68-15 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
VBD68-16 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,001 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
VBD69-09 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD74-09 0,128 0,119 0,119 0,128 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,119 0,000 0,120 0,119 0,119 0,119 0,128 0,128 0,119 0,128 0,001 0,119 0,119 0,164 0,119
LN833187.1 0,148 0,028 0,028 0,148 0,028 0,028 0,028 0,028 0,028 0,028 0,028 0,028 0,148 0,028 0,028 0,028 0,028 0,148 0,148 0,028 0,148 0,149 0,028 0,028 0,156 0,028
EU918768.1 0,145 0,023 0,023 0,145 0,023 0,023 0,023 0,023 0,023 0,023 0,023 0,023 0,145 0,023 0,023 0,023 0,023 0,145 0,145 0,023 0,145 0,146 0,023 0,023 0,154 0,023
FN870021.1 0,153 0,051 0,051 0,153 0,051 0,051 0,051 0,051 0,051 0,051 0,051 0,051 0,150 0,052 0,051 0,051 0,051 0,153 0,153 0,051 0,153 0,151 0,051 0,051 0,158 0,051
FN907962.1 0,001 0,120 0,120 0,001 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,129 0,120 0,120 0,120 0,120 0,001 0,001 0,120 0,001 0,129 0,120 0,120 0,165 0,120
FN907963.1 0,022 0,144 0,144 0,022 0,144 0,144 0,144 0,144 0,144 0,144 0,144 0,144 0,152 0,144 0,144 0,144 0,144 0,022 0,022 0,144 0,022 0,153 0,144 0,144 0,156 0,144
FR872717.1 0,120 0,002 0,002 0,120 0,002 0,002 0,002 0,002 0,002 0,002 0,002 0,002 0,120 0,002 0,002 0,002 0,002 0,120 0,120 0,002 0,120 0,120 0,002 0,002 0,162 0,002
HE574702.1 0,119 0,001 0,001 0,119 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,120 0,001 0,001 0,001 0,001 0,119 0,119 0,001 0,119 0,121 0,001 0,001 0,161 0,001
HE611263.1 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
JN644141.1 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
JQ773408.1 0,120 0,001 0,001 0,120 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,120 0,002 0,001 0,001 0,001 0,120 0,120 0,001 0,120 0,121 0,001 0,001 0,161 0,001
JQ773409.1 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
JQ773411.1 0,120 0,001 0,001 0,120 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,119 0,002 0,001 0,001 0,001 0,120 0,120 0,001 0,120 0,120 0,001 0,001 0,162 0,001
JQ773412.1 0,120 0,001 0,001 0,120 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,119 0,002 0,001 0,001 0,001 0,120 0,120 0,001 0,120 0,120 0,001 0,001 0,162 0,001
KU298879.1 0,129 0,123 0,123 0,129 0,123 0,123 0,123 0,123 0,123 0,123 0,123 0,123 0,027 0,124 0,123 0,123 0,123 0,129 0,129 0,123 0,129 0,028 0,123 0,123 0,163 0,123
LN833161.1 0,119 0,001 0,001 0,119 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,120 0,001 0,001 0,001 0,001 0,119 0,119 0,001 0,119 0,121 0,001 0,001 0,162 0,001
LN833165.1 0,146 0,025 0,025 0,146 0,025 0,025 0,025 0,025 0,025 0,025 0,025 0,025 0,147 0,025 0,025 0,025 0,025 0,146 0,146 0,025 0,146 0,148 0,025 0,025 0,154 0,025
LN833169.1 0,145 0,025 0,025 0,145 0,025 0,025 0,025 0,025 0,025 0,025 0,025 0,025 0,146 0,025 0,025 0,025 0,025 0,145 0,145 0,025 0,145 0,147 0,025 0,025 0,153 0,025
LN833183.1 0,156 0,165 0,165 0,156 0,165 0,165 0,165 0,165 0,165 0,165 0,165 0,165 0,162 0,166 0,165 0,165 0,165 0,156 0,156 0,165 0,156 0,163 0,165 0,165 0,116 0,165
LN833184.1 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
LN833185.1 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,001 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
M14119.1 0,153 0,111 0,111 0,153 0,111 0,111 0,111 0,111 0,111 0,111 0,111 0,111 0,143 0,111 0,111 0,111 0,111 0,153 0,153 0,111 0,153 0,144 0,111 0,111 0,152 0,111
MK313763.1 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
MK313765.1 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,001 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
MK313767.1 0,119 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,120 0,001 0,000 0,000 0,000 0,119 0,119 0,000 0,119 0,120 0,000 0,000 0,161 0,000
MK463914.1 0,120 0,001 0,001 0,120 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,120 0,001 0,001 0,001 0,001 0,120 0,120 0,001 0,120 0,120 0,001 0,001 0,161 0,001
MK463916.1 0,129 0,120 0,120 0,129 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,002 0,120 0,120 0,120 0,120 0,129 0,129 0,120 0,129 0,003 0,120 0,120 0,165 0,120
MK463921.1 0,128 0,120 0,120 0,128 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,002 0,120 0,120 0,120 0,120 0,128 0,128 0,120 0,128 0,003 0,120 0,120 0,165 0,120
MN788368.1 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
VBD79-09 0,118 0,000 0,000 0,118 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,000 0,000 0,000 0,000 0,118 0,118 0,000 0,118 0,120 0,000 0,000 0,161 0,000
 
 
Continued... 
 
 
 
XII 
VBD29-14 VBD30-11 VBD33-10 VBD33-11 VBD33-16 VBD34-08 VBD34-10 VBD34-11 VBD35-11 VBD37-08 VBD37-10 VBD37-11 VBD37-12 VBD39-12 VBD41-11 VBD41-12 VBD41-14 VBD41-15 VBD44-15 VBD47-12 VBD48-10 VBD48-12 VBD48-16 VBD49-08 VBD49-12 VBD49-15 VBD52-09
VBD01-10
VBD02-12
VBD04-12
VBD07-10
VBD08-09
VBD08-13
VBD09-12
VBD12-18
VBD13-10
VBD14-09
VBD14-11
VBD14-15
VBD15-10
VBD16-09
VBD16-10
VBD16-15
VBD17-09
VBD17-10
VBD17-14
VBD21-10
VBD22-14
VBD23-10
VBD23-17
VBD26-10
VBD28-14
VBD29-13
VBD29-14
VBD30-11 0,119
VBD33-10 0,119 0,000
VBD33-11 0,128 0,118 0,118
VBD33-16 0,120 0,000 0,000 0,119
VBD34-08 0,162 0,165 0,165 0,156 0,166
VBD34-10 0,128 0,118 0,118 0,000 0,119 0,156
VBD34-11 0,000 0,119 0,119 0,128 0,120 0,162 0,128
VBD35-11 0,120 0,000 0,000 0,119 0,000 0,166 0,119 0,120
VBD37-08 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000
VBD37-10 0,120 0,000 0,000 0,119 0,000 0,166 0,119 0,120 0,000 0,000
VBD37-11 0,000 0,119 0,119 0,128 0,120 0,162 0,128 0,000 0,120 0,119 0,120
VBD37-12 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119
VBD39-12 0,000 0,119 0,119 0,128 0,120 0,162 0,128 0,000 0,120 0,119 0,120 0,000 0,119
VBD41-11 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119
VBD41-12 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000
VBD41-14 0,120 0,000 0,000 0,119 0,000 0,166 0,119 0,120 0,000 0,000 0,000 0,120 0,000 0,120 0,000 0,000
VBD41-15 0,120 0,000 0,000 0,119 0,000 0,166 0,119 0,120 0,000 0,000 0,000 0,120 0,000 0,120 0,000 0,000 0,000
VBD44-15 0,000 0,119 0,119 0,128 0,120 0,162 0,128 0,000 0,120 0,119 0,120 0,000 0,119 0,000 0,119 0,119 0,120 0,120
VBD47-12 0,000 0,119 0,119 0,128 0,120 0,162 0,128 0,000 0,120 0,119 0,120 0,000 0,119 0,000 0,119 0,119 0,120 0,120 0,000
VBD48-10 0,120 0,000 0,000 0,119 0,001 0,166 0,119 0,120 0,001 0,000 0,001 0,120 0,000 0,120 0,000 0,000 0,001 0,001 0,120 0,120
VBD48-12 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000
VBD48-16 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000
VBD49-08 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000
VBD49-12 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000
VBD49-15 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000
VBD52-09 0,120 0,000 0,000 0,119 0,000 0,166 0,119 0,120 0,000 0,000 0,000 0,120 0,000 0,120 0,000 0,000 0,000 0,000 0,120 0,120 0,001 0,000 0,000 0,000 0,000 0,000
VBD52-11 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD55-13 0,000 0,119 0,119 0,128 0,120 0,162 0,128 0,000 0,120 0,119 0,120 0,000 0,119 0,000 0,119 0,119 0,120 0,120 0,000 0,000 0,120 0,119 0,119 0,119 0,119 0,119 0,120
VBD58-11 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD59-08 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD59-09 0,120 0,000 0,000 0,119 0,000 0,166 0,119 0,120 0,000 0,000 0,000 0,120 0,000 0,120 0,000 0,000 0,000 0,000 0,120 0,120 0,001 0,000 0,000 0,000 0,000 0,000 0,000
VBD61-11 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD62-11 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD63-09 0,120 0,000 0,000 0,119 0,000 0,166 0,119 0,120 0,000 0,000 0,000 0,120 0,000 0,120 0,000 0,000 0,000 0,000 0,120 0,120 0,001 0,000 0,000 0,000 0,000 0,000 0,000
VBD63-11 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD68-15 0,120 0,000 0,000 0,119 0,000 0,166 0,119 0,120 0,000 0,000 0,000 0,120 0,000 0,120 0,000 0,000 0,000 0,000 0,120 0,120 0,001 0,000 0,000 0,000 0,000 0,000 0,000
VBD68-16 0,120 0,000 0,000 0,119 0,001 0,166 0,119 0,120 0,001 0,000 0,001 0,120 0,000 0,120 0,000 0,000 0,001 0,001 0,120 0,120 0,001 0,000 0,000 0,000 0,000 0,000 0,001
VBD69-09 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD74-09 0,000 0,119 0,119 0,128 0,120 0,162 0,128 0,000 0,120 0,119 0,120 0,000 0,119 0,000 0,119 0,119 0,120 0,120 0,000 0,000 0,120 0,119 0,119 0,119 0,119 0,119 0,120
LN833187.1 0,148 0,028 0,028 0,148 0,028 0,159 0,148 0,148 0,028 0,028 0,028 0,148 0,028 0,148 0,028 0,028 0,028 0,028 0,148 0,148 0,028 0,028 0,028 0,028 0,028 0,028 0,028
EU918768.1 0,145 0,023 0,023 0,145 0,023 0,158 0,145 0,145 0,023 0,023 0,023 0,145 0,023 0,145 0,023 0,023 0,023 0,023 0,145 0,145 0,023 0,023 0,023 0,023 0,023 0,023 0,023
FN870021.1 0,150 0,051 0,051 0,153 0,052 0,162 0,153 0,150 0,052 0,051 0,052 0,150 0,051 0,150 0,051 0,051 0,052 0,052 0,150 0,150 0,052 0,051 0,051 0,051 0,051 0,051 0,052
FN907962.1 0,129 0,120 0,120 0,001 0,120 0,157 0,001 0,129 0,120 0,120 0,120 0,129 0,120 0,129 0,120 0,120 0,120 0,120 0,129 0,129 0,120 0,120 0,120 0,120 0,120 0,120 0,120
FN907963.1 0,152 0,144 0,144 0,022 0,144 0,148 0,022 0,152 0,144 0,144 0,144 0,152 0,144 0,152 0,144 0,144 0,144 0,144 0,152 0,152 0,144 0,144 0,144 0,144 0,144 0,144 0,144
FR872717.1 0,120 0,002 0,002 0,120 0,002 0,166 0,120 0,120 0,002 0,002 0,002 0,120 0,002 0,120 0,002 0,002 0,002 0,002 0,120 0,120 0,002 0,002 0,002 0,002 0,002 0,002 0,002
HE574702.1 0,120 0,001 0,001 0,119 0,001 0,165 0,119 0,120 0,001 0,001 0,001 0,120 0,001 0,120 0,001 0,001 0,001 0,001 0,120 0,120 0,001 0,001 0,001 0,001 0,001 0,001 0,001
HE611263.1 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000
JN644141.1 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000
JQ773408.1 0,120 0,001 0,001 0,120 0,002 0,166 0,120 0,120 0,002 0,001 0,002 0,120 0,001 0,120 0,001 0,001 0,002 0,002 0,120 0,120 0,002 0,001 0,001 0,001 0,001 0,001 0,002
JQ773409.1 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000
JQ773411.1 0,119 0,001 0,001 0,120 0,002 0,166 0,120 0,119 0,002 0,001 0,002 0,119 0,001 0,119 0,001 0,001 0,002 0,002 0,119 0,119 0,002 0,001 0,001 0,001 0,001 0,001 0,002
JQ773412.1 0,119 0,001 0,001 0,120 0,002 0,166 0,120 0,119 0,002 0,001 0,002 0,119 0,001 0,119 0,001 0,001 0,002 0,002 0,119 0,119 0,002 0,001 0,001 0,001 0,001 0,001 0,002
KU298879.1 0,027 0,123 0,123 0,129 0,124 0,164 0,129 0,027 0,124 0,123 0,124 0,027 0,123 0,027 0,123 0,123 0,124 0,124 0,027 0,027 0,124 0,123 0,123 0,123 0,123 0,123 0,124
LN833161.1 0,120 0,001 0,001 0,119 0,001 0,166 0,119 0,120 0,001 0,001 0,001 0,120 0,001 0,120 0,001 0,001 0,001 0,001 0,120 0,120 0,001 0,001 0,001 0,001 0,001 0,001 0,001
LN833165.1 0,147 0,025 0,025 0,146 0,025 0,158 0,146 0,147 0,025 0,025 0,025 0,147 0,025 0,147 0,025 0,025 0,025 0,025 0,147 0,147 0,026 0,025 0,025 0,025 0,025 0,025 0,025
LN833169.1 0,146 0,025 0,025 0,145 0,025 0,158 0,145 0,146 0,025 0,025 0,025 0,146 0,025 0,146 0,025 0,025 0,025 0,025 0,146 0,146 0,025 0,025 0,025 0,025 0,025 0,025 0,025
LN833183.1 0,162 0,165 0,165 0,156 0,166 0,000 0,156 0,162 0,166 0,165 0,166 0,162 0,165 0,162 0,165 0,165 0,166 0,166 0,162 0,162 0,166 0,165 0,165 0,165 0,165 0,165 0,166
LN833184.1 0,120 0,000 0,000 0,119 0,000 0,166 0,119 0,120 0,000 0,000 0,000 0,120 0,000 0,120 0,000 0,000 0,000 0,000 0,120 0,120 0,001 0,000 0,000 0,000 0,000 0,000 0,000
LN833185.1 0,120 0,000 0,000 0,119 0,001 0,166 0,119 0,120 0,001 0,000 0,001 0,120 0,000 0,120 0,000 0,000 0,001 0,001 0,120 0,120 0,000 0,000 0,000 0,000 0,000 0,000 0,001
M14119.1 0,143 0,111 0,111 0,153 0,111 0,154 0,153 0,143 0,111 0,111 0,111 0,143 0,111 0,143 0,111 0,111 0,111 0,111 0,143 0,143 0,111 0,111 0,111 0,111 0,111 0,111 0,111
MK313763.1 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000
MK313765.1 0,120 0,000 0,000 0,119 0,001 0,166 0,119 0,120 0,001 0,000 0,001 0,120 0,000 0,120 0,000 0,000 0,001 0,001 0,120 0,120 0,001 0,000 0,000 0,000 0,000 0,000 0,001
MK313767.1 0,120 0,000 0,000 0,119 0,001 0,166 0,119 0,120 0,001 0,000 0,001 0,120 0,000 0,120 0,000 0,000 0,001 0,001 0,120 0,120 0,001 0,000 0,000 0,000 0,000 0,000 0,001
MK463914.1 0,120 0,001 0,001 0,120 0,001 0,166 0,120 0,120 0,001 0,001 0,001 0,120 0,001 0,120 0,001 0,001 0,001 0,001 0,120 0,120 0,001 0,001 0,001 0,001 0,001 0,001 0,001
MK463916.1 0,002 0,120 0,120 0,129 0,120 0,163 0,129 0,002 0,120 0,120 0,120 0,002 0,120 0,002 0,120 0,120 0,120 0,120 0,002 0,002 0,120 0,120 0,120 0,120 0,120 0,120 0,120
MK463921.1 0,002 0,120 0,120 0,128 0,120 0,162 0,128 0,002 0,120 0,120 0,120 0,002 0,120 0,002 0,120 0,120 0,120 0,120 0,002 0,002 0,120 0,120 0,120 0,120 0,120 0,120 0,120
MN788368.1 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD79-09 0,119 0,000 0,000 0,118 0,000 0,165 0,118 0,119 0,000 0,000 0,000 0,119 0,000 0,119 0,000 0,000 0,000 0,000 0,119 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000
 
Continued... 
 
 
 
XIII 
VBD52-11 VBD55-13 VBD58-11 VBD59-08 VBD59-09 VBD61-11 VBD62-11 VBD63-09 VBD63-11 VBD68-15 VBD68-16 VBD69-09 VBD74-09 LN833187.1 EU918768.1 FN870021.1 FN907962.1 FN907963.1 FR872717.1 HE574702.1 HE611263.1 JN644141.1 JQ773408.1 JQ773409.1 JQ773411.1 JQ773412.1 KU298879.1
VBD01-10
VBD02-12
VBD04-12
VBD07-10
VBD08-09
VBD08-13
VBD09-12
VBD12-18
VBD13-10
VBD14-09
VBD14-11
VBD14-15
VBD15-10
VBD16-09
VBD16-10
VBD16-15
VBD17-09
VBD17-10
VBD17-14
VBD21-10
VBD22-14
VBD23-10
VBD23-17
VBD26-10
VBD28-14
VBD29-13
VBD29-14
VBD30-11
VBD33-10
VBD33-11
VBD33-16
VBD34-08
VBD34-10
VBD34-11
VBD35-11
VBD37-08
VBD37-10
VBD37-11
VBD37-12
VBD39-12
VBD41-11
VBD41-12
VBD41-14
VBD41-15
VBD44-15
VBD47-12
VBD48-10
VBD48-12
VBD48-16
VBD49-08
VBD49-12
VBD49-15
VBD52-09
VBD52-11
VBD55-13 0,119
VBD58-11 0,000 0,119
VBD59-08 0,000 0,119 0,000
VBD59-09 0,000 0,120 0,000 0,000
VBD61-11 0,000 0,119 0,000 0,000 0,000
VBD62-11 0,000 0,119 0,000 0,000 0,000 0,000
VBD63-09 0,000 0,120 0,000 0,000 0,000 0,000 0,000
VBD63-11 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000
VBD68-15 0,000 0,120 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD68-16 0,000 0,120 0,000 0,000 0,001 0,000 0,000 0,001 0,000 0,001
VBD69-09 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD74-09 0,119 0,000 0,119 0,119 0,120 0,119 0,119 0,120 0,119 0,120 0,120 0,119
LN833187.1 0,028 0,148 0,028 0,028 0,028 0,028 0,028 0,028 0,028 0,028 0,028 0,028 0,148
EU918768.1 0,023 0,145 0,023 0,023 0,023 0,023 0,023 0,023 0,023 0,023 0,023 0,023 0,145 0,009
FN870021.1 0,051 0,150 0,051 0,051 0,052 0,051 0,051 0,052 0,051 0,052 0,052 0,051 0,150 0,037 0,030
FN907962.1 0,120 0,129 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,121 0,120 0,129 0,149 0,146 0,154
FN907963.1 0,144 0,152 0,144 0,144 0,144 0,144 0,144 0,144 0,144 0,144 0,144 0,144 0,152 0,125 0,120 0,127 0,022
FR872717.1 0,002 0,120 0,002 0,002 0,002 0,002 0,002 0,002 0,002 0,002 0,002 0,002 0,120 0,029 0,024 0,053 0,121 0,145
HE574702.1 0,001 0,120 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,120 0,029 0,024 0,052 0,121 0,145 0,003
HE611263.1 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,028 0,023 0,051 0,120 0,144 0,002 0,001
JN644141.1 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,028 0,023 0,051 0,120 0,144 0,002 0,001 0,000
JQ773408.1 0,001 0,120 0,001 0,001 0,002 0,001 0,001 0,002 0,001 0,002 0,002 0,001 0,120 0,028 0,023 0,052 0,120 0,144 0,002 0,002 0,001 0,001
JQ773409.1 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,028 0,023 0,051 0,120 0,144 0,002 0,001 0,000 0,000 0,001
JQ773411.1 0,001 0,119 0,001 0,001 0,002 0,001 0,001 0,002 0,001 0,002 0,002 0,001 0,119 0,028 0,024 0,052 0,120 0,145 0,000 0,002 0,001 0,001 0,001 0,001
JQ773412.1 0,001 0,119 0,001 0,001 0,002 0,001 0,001 0,002 0,001 0,002 0,002 0,001 0,119 0,028 0,024 0,052 0,120 0,145 0,000 0,002 0,001 0,001 0,001 0,001 0,000
KU298879.1 0,123 0,027 0,123 0,123 0,124 0,123 0,123 0,124 0,123 0,124 0,124 0,123 0,027 0,154 0,150 0,149 0,131 0,155 0,125 0,124 0,123 0,123 0,125 0,123 0,124 0,124
LN833161.1 0,001 0,120 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,120 0,029 0,024 0,052 0,121 0,145 0,003 0,001 0,001 0,001 0,002 0,001 0,002 0,002 0,124
LN833165.1 0,025 0,147 0,025 0,025 0,025 0,025 0,025 0,025 0,025 0,025 0,026 0,025 0,147 0,005 0,006 0,034 0,147 0,122 0,026 0,026 0,025 0,025 0,026 0,025 0,026 0,026 0,152
LN833169.1 0,025 0,146 0,025 0,025 0,025 0,025 0,025 0,025 0,025 0,025 0,025 0,025 0,146 0,005 0,005 0,033 0,146 0,121 0,026 0,026 0,025 0,025 0,025 0,025 0,025 0,025 0,152
LN833183.1 0,165 0,162 0,165 0,165 0,166 0,165 0,165 0,166 0,165 0,166 0,166 0,165 0,162 0,159 0,158 0,162 0,157 0,148 0,166 0,165 0,165 0,165 0,166 0,165 0,166 0,166 0,164
LN833184.1 0,000 0,120 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,001 0,000 0,120 0,028 0,023 0,052 0,120 0,144 0,002 0,001 0,000 0,000 0,002 0,000 0,002 0,002 0,124
LN833185.1 0,000 0,120 0,000 0,000 0,001 0,000 0,000 0,001 0,000 0,001 0,001 0,000 0,120 0,028 0,023 0,052 0,120 0,144 0,002 0,001 0,000 0,000 0,002 0,000 0,002 0,002 0,124
M14119.1 0,111 0,143 0,111 0,111 0,111 0,111 0,111 0,111 0,111 0,111 0,111 0,111 0,143 0,092 0,088 0,087 0,154 0,127 0,112 0,112 0,111 0,111 0,111 0,111 0,111 0,111 0,149
MK313763.1 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,028 0,023 0,051 0,120 0,144 0,002 0,001 0,000 0,000 0,001 0,000 0,001 0,001 0,123
MK313765.1 0,000 0,120 0,000 0,000 0,001 0,000 0,000 0,001 0,000 0,001 0,001 0,000 0,120 0,028 0,023 0,052 0,120 0,144 0,002 0,001 0,000 0,000 0,002 0,000 0,002 0,002 0,124
MK313767.1 0,000 0,120 0,000 0,000 0,001 0,000 0,000 0,001 0,000 0,001 0,001 0,000 0,120 0,028 0,023 0,052 0,120 0,144 0,002 0,001 0,000 0,000 0,002 0,000 0,002 0,002 0,124
MK463914.1 0,001 0,120 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,001 0,120 0,028 0,023 0,052 0,120 0,144 0,001 0,002 0,001 0,001 0,001 0,001 0,001 0,001 0,125
MK463916.1 0,120 0,002 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,002 0,149 0,146 0,151 0,129 0,153 0,120 0,121 0,120 0,120 0,120 0,120 0,119 0,119 0,029
MK463921.1 0,120 0,002 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,120 0,002 0,149 0,145 0,150 0,128 0,153 0,119 0,120 0,120 0,120 0,120 0,120 0,119 0,119 0,028
MN788368.1 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,028 0,023 0,051 0,120 0,144 0,002 0,001 0,000 0,000 0,001 0,000 0,001 0,001 0,123
VBD79-09 0,000 0,119 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,119 0,028 0,023 0,051 0,120 0,144 0,002 0,001 0,000 0,000 0,001 0,000 0,001 0,001 0,123
 
 Continued... 
 
 
 
 
 
 
 
 
 
 
 
XIV 
LN833161.1 LN833165.1 LN833169.1 LN833183.1 LN833184.1 LN833185.1 M14119.1 MK313763.1 MK313765.1 MK313767.1 MK463914.1 MK463916.1 MK463921.1 MN788368.1 VBD79-09
VBD01-10
VBD02-12
VBD04-12
VBD07-10
VBD08-09
VBD08-13
VBD09-12
VBD12-18
VBD13-10
VBD14-09
VBD14-11
VBD14-15
VBD15-10
VBD16-09
VBD16-10
VBD16-15
VBD17-09
VBD17-10
VBD17-14
VBD21-10
VBD22-14
VBD23-10
VBD23-17
VBD26-10
VBD28-14
VBD29-13
VBD29-14
VBD30-11
VBD33-10
VBD33-11
VBD33-16
VBD34-08
VBD34-10
VBD34-11
VBD35-11
VBD37-08
VBD37-10
VBD37-11
VBD37-12
VBD39-12
VBD41-11
VBD41-12
VBD41-14
VBD41-15
VBD44-15
VBD47-12
VBD48-10
VBD48-12
VBD48-16
VBD49-08
VBD49-12
VBD49-15
VBD52-09
VBD52-11
VBD55-13
VBD58-11
VBD59-08
VBD59-09
VBD61-11
VBD62-11
VBD63-09
VBD63-11
VBD68-15
VBD68-16
VBD69-09
VBD74-09
LN833187.1
EU918768.1
FN870021.1
FN907962.1
FN907963.1
FR872717.1
HE574702.1
HE611263.1
JN644141.1
JQ773408.1
JQ773409.1
JQ773411.1
JQ773412.1
KU298879.1
LN833161.1
LN833165.1 0,026
LN833169.1 0,026 0,000
LN833183.1 0,166 0,158 0,158
LN833184.1 0,001 0,025 0,025 0,166
LN833185.1 0,001 0,026 0,025 0,166 0,001
M14119.1 0,112 0,090 0,090 0,154 0,111 0,111
MK313763.1 0,001 0,025 0,025 0,165 0,000 0,000 0,111
MK313765.1 0,001 0,026 0,025 0,166 0,001 0,001 0,111 0,000
MK313767.1 0,001 0,026 0,025 0,166 0,001 0,001 0,111 0,000 0,000
MK463914.1 0,002 0,026 0,025 0,166 0,001 0,001 0,111 0,001 0,001 0,001
MK463916.1 0,121 0,148 0,147 0,163 0,120 0,120 0,145 0,120 0,120 0,120 0,120
MK463921.1 0,120 0,147 0,147 0,162 0,120 0,120 0,144 0,120 0,120 0,120 0,119 0,000
MN788368.1 0,001 0,025 0,025 0,165 0,000 0,000 0,111 0,000 0,000 0,000 0,001 0,120 0,120
VBD79-09 0,001 0,025 0,025 0,165 0,000 0,000 0,111 0,000 0,000 0,000 0,001 0,120 0,120 0,000
Appendix 11: Pairwise analysis of percentage divergence of nucleotides using the 
208bp human papillomavirus type 11 E2 segment data set 
 
  
XV 
VBD01-10 VBD02-12 VBD04-12 VBD07-10 VBD08-09 VBD08-13 VBD09-12 VBD12-18 VBD13-10 VBD14-09 VBD14-11 VBD14-15 VBD15-10 VBD16-09 VBD16-10 VBD16-15 VBD17-09 VBD17-10 VBD17-14 VBD21-10 VBD22-14 VBD23-10
VBD01-10
VBD02-12 0,000
VBD04-12 0,000 0,000
VBD07-10 0,000 0,000 0,000
VBD08-09 0,000 0,000 0,000 0,000
VBD08-13 0,000 0,000 0,000 0,000 0,000
VBD09-12 0,000 0,000 0,000 0,000 0,000 0,000
VBD12-18 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD13-10 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD14-09 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD14-11 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
VBD14-15 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005
VBD15-10 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000
VBD16-09 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000
VBD16-10 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000
VBD16-15 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000
VBD17-09 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000
VBD17-10 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000
VBD17-14 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD21-10 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD22-14 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD23-10 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD23-17 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD26-10 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD28-14 0,020 0,020 0,020 0,020 0,020 0,020 0,020 0,020 0,020 0,020 0,025 0,020 0,020 0,020 0,020 0,020 0,020 0,020 0,020 0,020 0,020 0,020
VBD29-13 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD29-14 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,010 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
VBD30-11 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD33-10 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD33-11 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD33-16 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD34-08 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,029 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024
VBD34-10 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD34-11 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD35-11 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD37-08 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD37-10 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD37-11 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD37-12 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD39-12 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD41-11 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD41-12 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD41-14 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD41-15 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD44-15 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD47-12 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD48-10 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD48-12 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD48-16 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD49-08 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD49-12 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD49-15 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD52-09 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD52-11 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD55-13 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD58-11 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD59-08 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD59-09 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD61-11 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,010 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
VBD62-11 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,010 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
VBD63-09 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD63-11 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD68-15 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD68-16 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD69-09 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD69-15 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD74-09 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,010 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
VBD79-09 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
EU918768.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
FN870021.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
FN907962.1 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,010 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
FN907963.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
FR872717.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
HE574702.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
HE611263.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
JN644141.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
JQ773408.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
JQ773409.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
JQ773411.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
JQ773412.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
KU298879.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
LN833161.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
LN833165.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
LN833169.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
LN833183.1 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,029 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024
LN833184.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
LN833185.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
LN833187.1_(1) 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,010 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
LN833187.1_(2) 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
M14119.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
MK313763.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
MK313765.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
MK313767.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
MK463914.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
MK463916.1 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,010 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
MK463921.1 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,010 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
MN788368.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
 Continued...  
XVI 
VBD23-17 VBD26-10 VBD28-14 VBD29-13 VBD29-14 VBD30-11 VBD33-10 VBD33-11 VBD33-16 VBD34-08 VBD34-10 VBD34-11 VBD35-11 VBD37-08 VBD37-10 VBD37-11 VBD37-12 VBD39-12 VBD41-11 VBD41-12 VBD41-14 VBD41-15
VBD01-10
VBD02-12
VBD04-12
VBD07-10
VBD08-09
VBD08-13
VBD09-12
VBD12-18
VBD13-10
VBD14-09
VBD14-11
VBD14-15
VBD15-10
VBD16-09
VBD16-10
VBD16-15
VBD17-09
VBD17-10
VBD17-14
VBD21-10
VBD22-14
VBD23-10
VBD23-17
VBD26-10 0,000
VBD28-14 0,020 0,020
VBD29-13 0,000 0,000 0,020
VBD29-14 0,005 0,005 0,025 0,005
VBD30-11 0,000 0,000 0,020 0,000 0,005
VBD33-10 0,000 0,000 0,020 0,000 0,005 0,000
VBD33-11 0,000 0,000 0,020 0,000 0,005 0,000 0,000
VBD33-16 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000
VBD34-08 0,024 0,024 0,005 0,024 0,029 0,024 0,024 0,024 0,024
VBD34-10 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024
VBD34-11 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000
VBD35-11 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000
VBD37-08 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000
VBD37-10 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000
VBD37-11 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000
VBD37-12 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000
VBD39-12 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD41-11 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD41-12 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD41-14 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD41-15 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD44-15 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD47-12 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD48-10 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD48-12 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD48-16 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD49-08 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD49-12 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD49-15 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD52-09 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD52-11 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD55-13 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD58-11 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD59-08 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD59-09 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD61-11 0,005 0,005 0,025 0,005 0,010 0,005 0,005 0,005 0,005 0,029 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
VBD62-11 0,005 0,005 0,025 0,005 0,010 0,005 0,005 0,005 0,005 0,029 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
VBD63-09 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD63-11 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD68-15 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD68-16 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD69-09 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD69-15 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD74-09 0,005 0,005 0,025 0,005 0,010 0,005 0,005 0,005 0,005 0,029 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
VBD79-09 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
EU918768.1 0,010 0,010 0,020 0,010 0,015 0,010 0,010 0,010 0,010 0,024 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
FN870021.1 0,010 0,010 0,020 0,010 0,015 0,010 0,010 0,010 0,010 0,024 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
FN907962.1 0,005 0,005 0,025 0,005 0,010 0,005 0,005 0,005 0,005 0,029 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
FN907963.1 0,010 0,010 0,020 0,010 0,015 0,010 0,010 0,010 0,010 0,024 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
FR872717.1 0,010 0,010 0,029 0,010 0,015 0,010 0,010 0,010 0,010 0,034 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
HE574702.1 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
HE611263.1 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
JN644141.1 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
JQ773408.1 0,010 0,010 0,029 0,010 0,015 0,010 0,010 0,010 0,010 0,034 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
JQ773409.1 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
JQ773411.1 0,010 0,010 0,029 0,010 0,015 0,010 0,010 0,010 0,010 0,034 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
JQ773412.1 0,010 0,010 0,029 0,010 0,015 0,010 0,010 0,010 0,010 0,034 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
KU298879.1 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
LN833161.1 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
LN833165.1 0,010 0,010 0,020 0,010 0,015 0,010 0,010 0,010 0,010 0,024 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
LN833169.1 0,010 0,010 0,020 0,010 0,015 0,010 0,010 0,010 0,010 0,024 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
LN833183.1 0,024 0,024 0,005 0,024 0,029 0,024 0,024 0,024 0,024 0,000 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024
LN833184.1 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
LN833185.1 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
LN833187.1_(1) 0,005 0,005 0,015 0,005 0,010 0,005 0,005 0,005 0,005 0,020 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
LN833187.1_(2) 0,010 0,010 0,020 0,010 0,015 0,010 0,010 0,010 0,010 0,024 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
M14119.1 0,010 0,010 0,020 0,010 0,015 0,010 0,010 0,010 0,010 0,024 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
MK313763.1 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
MK313765.1 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
MK313767.1 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
MK463914.1 0,010 0,010 0,029 0,010 0,015 0,010 0,010 0,010 0,010 0,034 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010
MK463916.1 0,005 0,005 0,025 0,005 0,010 0,005 0,005 0,005 0,005 0,029 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
MK463921.1 0,005 0,005 0,025 0,005 0,010 0,005 0,005 0,005 0,005 0,029 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
MN788368.1 0,000 0,000 0,020 0,000 0,005 0,000 0,000 0,000 0,000 0,024 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
 Continued...  
XVII 
VBD44-15 VBD47-12 VBD48-10 VBD48-12 VBD48-16 VBD49-08 VBD49-12 VBD49-15 VBD52-09 VBD52-11 VBD55-13 VBD58-11 VBD59-08 VBD59-09 VBD61-11 VBD62-11 VBD63-09 VBD63-11 VBD68-15 VBD68-16 VBD69-09 VBD69-15
VBD01-10
VBD02-12
VBD04-12
VBD07-10
VBD08-09
VBD08-13
VBD09-12
VBD12-18
VBD13-10
VBD14-09
VBD14-11
VBD14-15
VBD15-10
VBD16-09
VBD16-10
VBD16-15
VBD17-09
VBD17-10
VBD17-14
VBD21-10
VBD22-14
VBD23-10
VBD23-17
VBD26-10
VBD28-14
VBD29-13
VBD29-14
VBD30-11
VBD33-10
VBD33-11
VBD33-16
VBD34-08
VBD34-10
VBD34-11
VBD35-11
VBD37-08
VBD37-10
VBD37-11
VBD37-12
VBD39-12
VBD41-11
VBD41-12
VBD41-14
VBD41-15
VBD44-15
VBD47-12 0,000
VBD48-10 0,000 0,000
VBD48-12 0,000 0,000 0,000
VBD48-16 0,000 0,000 0,000 0,000
VBD49-08 0,000 0,000 0,000 0,000 0,000
VBD49-12 0,000 0,000 0,000 0,000 0,000 0,000
VBD49-15 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD52-09 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD52-11 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD55-13 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD58-11 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD59-08 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD59-09 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000
VBD61-11 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005
VBD62-11 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,000
VBD63-09 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005
VBD63-11 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000
VBD68-15 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000
VBD68-16 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000
VBD69-09 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000
VBD69-15 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000
VBD74-09 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,010 0,010 0,005 0,005 0,005 0,005 0,005 0,005
VBD79-09 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000 0,000
EU918768.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,015 0,010 0,010 0,010 0,010 0,010 0,010
FN870021.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,015 0,010 0,010 0,010 0,010 0,010 0,010
FN907962.1 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,010 0,010 0,005 0,005 0,005 0,005 0,005 0,005
FN907963.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,015 0,010 0,010 0,010 0,010 0,010 0,010
FR872717.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,015 0,010 0,010 0,010 0,010 0,010 0,010
HE574702.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000 0,000
HE611263.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000 0,000
JN644141.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000 0,000
JQ773408.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,015 0,010 0,010 0,010 0,010 0,010 0,010
JQ773409.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000 0,000
JQ773411.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,015 0,010 0,010 0,010 0,010 0,010 0,010
JQ773412.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,015 0,010 0,010 0,010 0,010 0,010 0,010
KU298879.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000 0,000
LN833161.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000 0,000
LN833165.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,015 0,010 0,010 0,010 0,010 0,010 0,010
LN833169.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,015 0,010 0,010 0,010 0,010 0,010 0,010
LN833183.1 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,024 0,029 0,029 0,024 0,024 0,024 0,024 0,024 0,024
LN833184.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000 0,000
LN833185.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000 0,000
LN833187.1_(1) 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,010 0,010 0,005 0,005 0,005 0,005 0,005 0,005
LN833187.1_(2) 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,015 0,010 0,010 0,010 0,010 0,010 0,010
M14119.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,015 0,010 0,010 0,010 0,010 0,010 0,010
MK313763.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000 0,000
MK313765.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000 0,000
MK313767.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000 0,000
MK463914.1 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,015 0,015 0,010 0,010 0,010 0,010 0,010 0,010
MK463916.1 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,010 0,010 0,005 0,005 0,005 0,005 0,005 0,005
MK463921.1 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,010 0,010 0,005 0,005 0,005 0,005 0,005 0,005
MN788368.1 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,000 0,005 0,005 0,000 0,000 0,000 0,000 0,000 0,000
 Continued...  
XVIII 
VBD74-09 VBD79-09 EU918768.1 FN870021.1 FN907962.1 FN907963.1 FR872717.1 HE574702.1 HE611263.1 JN644141.1 JQ773408.1 JQ773409.1 JQ773411.1 JQ773412.1 KU298879.1 LN833161.1 LN833165.1 LN833169.1 LN833183.1 LN833184.1 LN833185.1 LN833187.1_(1)
VBD01-10
VBD02-12
VBD04-12
VBD07-10
VBD08-09
VBD08-13
VBD09-12
VBD12-18
VBD13-10
VBD14-09
VBD14-11
VBD14-15
VBD15-10
VBD16-09
VBD16-10
VBD16-15
VBD17-09
VBD17-10
VBD17-14
VBD21-10
VBD22-14
VBD23-10
VBD23-17
VBD26-10
VBD28-14
VBD29-13
VBD29-14
VBD30-11
VBD33-10
VBD33-11
VBD33-16
VBD34-08
VBD34-10
VBD34-11
VBD35-11
VBD37-08
VBD37-10
VBD37-11
VBD37-12
VBD39-12
VBD41-11
VBD41-12
VBD41-14
VBD41-15
VBD44-15
VBD47-12
VBD48-10
VBD48-12
VBD48-16
VBD49-08
VBD49-12
VBD49-15
VBD52-09
VBD52-11
VBD55-13
VBD58-11
VBD59-08
VBD59-09
VBD61-11
VBD62-11
VBD63-09
VBD63-11
VBD68-15
VBD68-16
VBD69-09
VBD69-15
VBD74-09
VBD79-09 0,005
EU918768.1 0,015 0,010
FN870021.1 0,015 0,010 0,000
FN907962.1 0,010 0,005 0,015 0,015
FN907963.1 0,015 0,010 0,000 0,000 0,015
FR872717.1 0,015 0,010 0,010 0,010 0,005 0,010
HE574702.1 0,005 0,000 0,010 0,010 0,005 0,010 0,010
HE611263.1 0,005 0,000 0,010 0,010 0,005 0,010 0,010 0,000
JN644141.1 0,005 0,000 0,010 0,010 0,005 0,010 0,010 0,000 0,000
JQ773408.1 0,015 0,010 0,010 0,010 0,005 0,010 0,000 0,010 0,010 0,010
JQ773409.1 0,005 0,000 0,010 0,010 0,005 0,010 0,010 0,000 0,000 0,000 0,010
JQ773411.1 0,015 0,010 0,010 0,010 0,005 0,010 0,000 0,010 0,010 0,010 0,000 0,010
JQ773412.1 0,015 0,010 0,010 0,010 0,005 0,010 0,000 0,010 0,010 0,010 0,000 0,010 0,000
KU298879.1 0,005 0,000 0,010 0,010 0,005 0,010 0,010 0,000 0,000 0,000 0,010 0,000 0,010 0,010
LN833161.1 0,005 0,000 0,010 0,010 0,005 0,010 0,010 0,000 0,000 0,000 0,010 0,000 0,010 0,010 0,000
LN833165.1 0,015 0,010 0,010 0,010 0,015 0,010 0,020 0,010 0,010 0,010 0,020 0,010 0,020 0,020 0,010 0,010
LN833169.1 0,015 0,010 0,010 0,010 0,015 0,010 0,020 0,010 0,010 0,010 0,020 0,010 0,020 0,020 0,010 0,010 0,000
LN833183.1 0,029 0,024 0,024 0,024 0,029 0,024 0,034 0,024 0,024 0,024 0,034 0,024 0,034 0,034 0,024 0,024 0,024 0,024
LN833184.1 0,005 0,000 0,010 0,010 0,005 0,010 0,010 0,000 0,000 0,000 0,010 0,000 0,010 0,010 0,000 0,000 0,010 0,010 0,024
LN833185.1 0,005 0,000 0,010 0,010 0,005 0,010 0,010 0,000 0,000 0,000 0,010 0,000 0,010 0,010 0,000 0,000 0,010 0,010 0,024 0,000
LN833187.1_(1) 0,010 0,005 0,005 0,005 0,010 0,005 0,015 0,005 0,005 0,005 0,015 0,005 0,015 0,015 0,005 0,005 0,005 0,005 0,020 0,005 0,005
LN833187.1_(2) 0,015 0,010 0,010 0,010 0,015 0,010 0,020 0,010 0,010 0,010 0,020 0,010 0,020 0,020 0,010 0,010 0,010 0,010 0,024 0,010 0,010 0,005
M14119.1 0,015 0,010 0,000 0,000 0,015 0,000 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,010 0,024 0,010 0,010 0,005
MK313763.1 0,005 0,000 0,010 0,010 0,005 0,010 0,010 0,000 0,000 0,000 0,010 0,000 0,010 0,010 0,000 0,000 0,010 0,010 0,024 0,000 0,000 0,005
MK313765.1 0,005 0,000 0,010 0,010 0,005 0,010 0,010 0,000 0,000 0,000 0,010 0,000 0,010 0,010 0,000 0,000 0,010 0,010 0,024 0,000 0,000 0,005
MK313767.1 0,005 0,000 0,010 0,010 0,005 0,010 0,010 0,000 0,000 0,000 0,010 0,000 0,010 0,010 0,000 0,000 0,010 0,010 0,024 0,000 0,000 0,005
MK463914.1 0,015 0,010 0,010 0,010 0,005 0,010 0,000 0,010 0,010 0,010 0,000 0,010 0,000 0,000 0,010 0,010 0,020 0,020 0,034 0,010 0,010 0,015
MK463916.1 0,010 0,005 0,015 0,015 0,000 0,015 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,015 0,015 0,029 0,005 0,005 0,010
MK463921.1 0,010 0,005 0,015 0,015 0,000 0,015 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,005 0,015 0,015 0,029 0,005 0,005 0,010
MN788368.1 0,005 0,000 0,010 0,010 0,005 0,010 0,010 0,000 0,000 0,000 0,010 0,000 0,010 0,010 0,000 0,000 0,010 0,010 0,024 0,000 0,000 0,005
 Continued... 
 
 
  
XIX 
LN833187.1_(2)M14119.1 MK313763.1 MK313765.1 MK313767.1 MK463914.1 MK463916.1 MK463921.1 MN788368.1
VBD01-10
VBD02-12
VBD04-12
VBD07-10
VBD08-09
VBD08-13
VBD09-12
VBD12-18
VBD13-10
VBD14-09
VBD14-11
VBD14-15
VBD15-10
VBD16-09
VBD16-10
VBD16-15
VBD17-09
VBD17-10
VBD17-14
VBD21-10
VBD22-14
VBD23-10
VBD23-17
VBD26-10
VBD28-14
VBD29-13
VBD29-14
VBD30-11
VBD33-10
VBD33-11
VBD33-16
VBD34-08
VBD34-10
VBD34-11
VBD35-11
VBD37-08
VBD37-10
VBD37-11
VBD37-12
VBD39-12
VBD41-11
VBD41-12
VBD41-14
VBD41-15
VBD44-15
VBD47-12
VBD48-10
VBD48-12
VBD48-16
VBD49-08
VBD49-12
VBD49-15
VBD52-09
VBD52-11
VBD55-13
VBD58-11
VBD59-08
VBD59-09
VBD61-11
VBD62-11
VBD63-09
VBD63-11
VBD68-15
VBD68-16
VBD69-09
VBD69-15
VBD74-09
VBD79-09
EU918768.1
FN870021.1
FN907962.1
FN907963.1
FR872717.1
HE574702.1
HE611263.1
JN644141.1
JQ773408.1
JQ773409.1
JQ773411.1
JQ773412.1
KU298879.1
LN833161.1
LN833165.1
LN833169.1
LN833183.1
LN833184.1
LN833185.1
LN833187.1_(1)
LN833187.1_(2)
M14119.1 0,010
MK313763.1 0,010 0,010
MK313765.1 0,010 0,010 0,000
MK313767.1 0,010 0,010 0,000 0,000
MK463914.1 0,020 0,010 0,010 0,010 0,010
MK463916.1 0,015 0,015 0,005 0,005 0,005 0,005
MK463921.1 0,015 0,015 0,005 0,005 0,005 0,005 0,000
MN788368.1 0,010 0,010 0,000 0,000 0,000 0,010 0,005 0,005
Appendix 12: Pairwise analysis of percentage divergence of nucleotides using the 
human papillomavirus type 11 complete genomes 
 
XX 
M14119.1 01-10 15-10 28-14 74-09 LN833183.1 FN870021.1 FR872717.1 FN907962.1 JN644141.1 JQ773408.1 LN833169.1 LN833187.1 EU918768.1 HE574702.1
M14119.1
01-10 0,00316
15-10 0,00329 0,00139
28-14 0,01198 0,01185 0,01198
74-09 0,00329 0,00139 0,00000 0,01198
LN833183.1 0,01224 0,01211 0,01224 0,00051 0,01224
FN870021.1 0,00076 0,00291 0,00304 0,01172 0,00304 0,01198
FR872717.1 0,00304 0,00139 0,00152 0,01198 0,00152 0,01223 0,00278
FN907962.1 0,00393 0,00202 0,00215 0,01236 0,00215 0,01262 0,00367 0,00164
JN644141.1 0,00316 0,00025 0,00139 0,01185 0,00139 0,01211 0,00291 0,00139 0,00202
JQ773408.1 0,00329 0,00164 0,00177 0,01223 0,00177 0,01249 0,00304 0,00101 0,00190 0,00164
LN833169.1 0,00558 0,00520 0,00558 0,01249 0,00558 0,01275 0,00532 0,00545 0,00622 0,00520 0,00583
LN833187.1 0,00596 0,00571 0,00584 0,01249 0,00584 0,01275 0,00571 0,00571 0,00622 0,00571 0,00609 0,00584
EU918768.1 0,00139 0,00354 0,00367 0,01210 0,00367 0,01236 0,00114 0,00342 0,00431 0,00354 0,00367 0,00596 0,00634
HE574702.1 0,00329 0,00063 0,00177 0,01198 0,00177 0,01224 0,00304 0,00177 0,00240 0,00063 0,00202 0,00558 0,00609 0,00367
HE611263.1 0,00304 0,00013 0,00126 0,01172 0,00126 0,01198 0,00278 0,00126 0,00190 0,00013 0,00152 0,00507 0,00558 0,00342 0,00051
JQ773409.1 0,00304 0,00013 0,00126 0,01172 0,00126 0,01198 0,00278 0,00126 0,00190 0,00013 0,00152 0,00507 0,00558 0,00342 0,00051
JQ773411.1 0,00316 0,00152 0,00164 0,01210 0,00164 0,01236 0,00291 0,00013 0,00177 0,00152 0,00114 0,00558 0,00583 0,00354 0,00190
JQ773412.1 0,00316 0,00152 0,00164 0,01210 0,00164 0,01236 0,00291 0,00013 0,00177 0,00152 0,00114 0,00558 0,00583 0,00354 0,00190
KU298879.1 0,00304 0,00038 0,00126 0,01172 0,00126 0,01198 0,00278 0,00126 0,00190 0,00038 0,00152 0,00507 0,00558 0,00342 0,00076
LN833161.1 0,00329 0,00038 0,00152 0,01198 0,00152 0,01224 0,00304 0,00152 0,00215 0,00038 0,00177 0,00533 0,00583 0,00367 0,00076
LN833165.1 0,00494 0,00482 0,00494 0,01185 0,00494 0,01211 0,00469 0,00482 0,00558 0,00482 0,00520 0,00139 0,00507 0,00532 0,00520
LN833184.1 0,00316 0,00025 0,00139 0,01185 0,00139 0,01211 0,00291 0,00139 0,00202 0,00025 0,00164 0,00520 0,00558 0,00354 0,00063
LN833185.1 0,00329 0,00038 0,00152 0,01198 0,00152 0,01224 0,00304 0,00152 0,00215 0,00038 0,00177 0,00533 0,00584 0,00367 0,00051
MK313763.1 0,00304 0,00038 0,00152 0,01198 0,00152 0,01224 0,00278 0,00152 0,00215 0,00038 0,00177 0,00533 0,00583 0,00342 0,00025
MK313765.1 0,00316 0,00025 0,00139 0,01185 0,00139 0,01211 0,00291 0,00139 0,00202 0,00025 0,00164 0,00520 0,00571 0,00354 0,00063
MK313767.1 0,00316 0,00025 0,00139 0,01185 0,00139 0,01211 0,00291 0,00139 0,00202 0,00025 0,00164 0,00520 0,00571 0,00354 0,00063
MK463914.1 0,00291 0,00126 0,00139 0,01185 0,00139 0,01211 0,00266 0,00063 0,00152 0,00126 0,00088 0,00520 0,00571 0,00329 0,00164
MK463916.1 0,00354 0,00164 0,00177 0,01224 0,00177 0,01249 0,00329 0,00126 0,00190 0,00164 0,00152 0,00584 0,00609 0,00392 0,00202
MK463921.1 0,00342 0,00152 0,00164 0,01211 0,00164 0,01236 0,00316 0,00114 0,00177 0,00152 0,00139 0,00571 0,00596 0,00380 0,00190
MN788368.1 0,00316 0,00025 0,00139 0,01185 0,00139 0,01211 0,00291 0,00139 0,00202 0,00025 0,00164 0,00520 0,00571 0,00354 0,00063
FN907963.1 0,00038 0,00278 0,00291 0,01159 0,00291 0,01185 0,00038 0,00266 0,00354 0,00278 0,00291 0,00520 0,00558 0,00101 0,00291
Continued... 
 
 
XXI 
MK313763. MK313765. MK313767. MK463914. MK463916. MK463921.
HE611263.1 JQ773409.1 JQ773411.1 JQ773412.1 KU298879.1 LN833161.1 LN833165.1 LN833184.1 LN833185.1 1 1 1 1 1 1 MN788368.1 FN907963.1
0,00000
0,00139 0,00139
0,00139 0,00139 0,00000
0,00025 0,00025 0,00139 0,00139
0,00025 0,00025 0,00164 0,00164 0,00051
0,00469 0,00469 0,00494 0,00494 0,00469 0,00494
0,00013 0,00013 0,00152 0,00152 0,00038 0,00038 0,00469
0,00025 0,00025 0,00164 0,00164 0,00051 0,00051 0,00494 0,00038
0,00025 0,00025 0,00164 0,00164 0,00051 0,00051 0,00494 0,00038 0,00025
0,00013 0,00013 0,00152 0,00152 0,00038 0,00038 0,00482 0,00025 0,00038 0,00038
0,00013 0,00013 0,00152 0,00152 0,00038 0,00038 0,00482 0,00025 0,00038 0,00038 0,00000
0,00114 0,00114 0,00076 0,00076 0,00114 0,00139 0,00456 0,00126 0,00139 0,00139 0,00126 0,00126
0,00152 0,00152 0,00139 0,00139 0,00152 0,00177 0,00520 0,00164 0,00177 0,00177 0,00164 0,00164 0,00114
0,00139 0,00139 0,00126 0,00126 0,00139 0,00164 0,00507 0,00152 0,00164 0,00164 0,00152 0,00152 0,00101 0,00063
0,00013 0,00013 0,00152 0,00152 0,00038 0,00038 0,00482 0,00025 0,00038 0,00038 0,00025 0,00025 0,00126 0,00164 0,00152
0,00266 0,00266 0,00278 0,00278 0,00266 0,00291 0,00456 0,00278 0,00291 0,00266 0,00278 0,00278 0,00253 0,00316 0,00304 0,00278