..b. 137 ?;;L7 27
University Free State
'~II" '~'I'''IIII'~343II0'~0II0I~0I0ll"1121016"1"91l5""'111'm1 l'"" I~III
Universiteit Vrystaat
HIERDIE EKSEMPlAAR MAG ONDER
GEEN OMSTANDIGHEDE UIT DIE
BIBLIOTEEK VERWYDER WORD NIE

DISEASES OF ACACIA MEARNSII IN SOUTH AFRICA,
WITH PARTICULAR REFERENCE TO CERATOCYSTIS
WILT
By
]OLAN DA ROUX
Submitted in fulfilment of the requirements for the degree
Doctor of Philosophy
in the Faculty of Science, Department of Microbiology and Biochemistry,
University of the Orange Free State, South Africa
December 1998
Promoter: Prof MJ. Wingfield
Dedicated to my parents and friends
The only way of discovering the limits of the possible is to venture a little way
past them into the impossible.
Clarke's Second Law
CONTENTS
Acknowledgements I
Preface ill
Chapter One: Fungal diseases of plantation Acacia species, with special 1
reference to Acacia mearnsii in South Africa: A review
l.0 Introduction 3
2.0 Acacia auriculiformis 4
2.1 Root, butt and stem rots
2.2 Foliar diseases
3.0 Acacia catechu 5
4.0 Acacia dealbata 6
4. 1 Root, butt and stem rots
4.2 Stem diseases
4.3 Foliar diseases
5.0 Acacia decurrens 8
5.1 Root and butt rots
5.2 Stem diseases
5.3 Foliar diseases
5.4 Nursery diseaseslDamping-off
6.0 Acacia koa 9
7.0 Acacia mangium 10
7.1 Root, butt and stem rots
7.2 Stem diseases
7.3 Foliar diseases
7.4 Nursery diseaseslDamping-off
8.0 Acacia mearnsii 13
8.1 Root and butt rots
8.2 Stem diseases
8.3 Foliar diseases
8.1 Wilts
8.5 Nursery diseases
9.0 Health of A. mearnsii in South Africa 16
10.0 Conclusions 18
Il.O References 29
Chapter Two: Genetic variation in the wilt pathogen, Ceratocystis
albofundus, in South Africa 37
Abstract 38
Introduction 39
Materials & Methods 41
Results 46
Discussion 48
References 51
Chapter Three: Ceratocystis fimbriata and Chalara elegans, pathogenic
on Acacia mearnsii in South Africa 69
Abstract 70
Introduction 71
Materials &Methods 74
Results 76
Discussion 78
References 81
Chapter Four: A serious new wilt disease of Eucalyptus caused
by Ceratocystis fimbriata in West Africa 108
Abstract 109
Introduction 110
Materials & Methods 111
Results 114
Discussion 115
References 118
Chapter Five: Molecular comparison of a Seiridium species from
Acacia mearnsii with the cypress canker pathogens 139
Abstract 140
Introduction 141
Materials & Methods 142
Results 146
Discussion 148
References 152
Chapter Six: Endophytic fungi associated with Acacia mearnsii in
South Africa 170
Abstract 171
Introduction 172
Materials & Methods 174
Results 176
Discussion 177
References 182
Chapter Seven: Fusarium graminearum. a pathogen of the plantation
tree Acacia mearnsii 194
Abstract 195
Introduction 196
Materials & Methods 198
Results 201
Discussion 202
References 206
Summary 228
Opsomming 234
ACKNOWLEDGEMENTS
It is my wish to express my sincere gratitude towards the following people and
institutions. Without their assistance the completion of this study would not have been
possible. I cannot list each person by name, as there are too many who assisted me during
the past three years, but I am sincerely grateful to you all.
My Heavenly Father who gave me the strength to persist and who astounded me with his
wonderful creations.
Michael J. Wingfield for his guidance and support, for teaching me forest pathology, for
all the opportunities to learn more and become more. Also, for his never ending
enthusiasm about the wonderful world of fungi, science and life.
Teresa A. Coutinho, for her guidance, support, patience and above all, friendship.
Thomas C. Harrington for his valuable guidance and his enthusiasm on Ceratocystis. For
the opportunity to travel to the United States and spend nine weeks in his laboratory.
My FABI family in Pretoria and Bloemfontein - You cannot imagine how much I love
being part of this family of friends and colleagues. I would like to thank every one of you
for all of your help during the past three years and for your friendship.
Sarie Lock, who spent 18 months as my assistant and friend and who worked just as hard
on this thesis.
Joe Steimel for help with the population study and teaching me more about molecular
biology.
Rob Dunlop of the Institute for Commercial Forestry Research for providing trial sites and
trees.
My parents for their love and support. For accepting it when I was not there for them.
Dennis Wilson for proof-reading the endophyte chapter and his valuable suggestions and
infectious enthusiasm .
. The Foundation for Research Development for financial support.
The South African Forestry Industry, especially the South African Wattle Growers Union
for financial support and resources to undertake the field trials required in this study.
II
The Department of Microbiology and Biochemistry, University of the Orange Free State
for the facilities to undertake this study.
The University of Pretoria for facilities to complete this study.
All the sabbatical and other visitors to our group, for broadening my horizons.
Rosalie Safou for help during the survey of Eucalyptus diseases in the Republic of Congo
and UR2PI for partial funding of the survey.
Prof Kerry O'Donnell for the initial identification of the Fusarium sp. from A. mearnsii.
III
PREFACE
Acacia mearnsii (black wattle) production has become one of the most profitable
components of the South African forestry industry. It forms only the third largest portion
of this industry, but it has been the only sector to be consistent in the prices being received
for pulp and bark in recent years. Cultivation of A. mearnsii is especially popular amongst
private and small holder farmers since, for every ton of bark, approximately five tons of
utilizable timber can also be harvested.
Currently, black wattle wood is exported from South Africa to Japan and Norway for the
production of high quality pulp, used in the production of paper and viscose. The timber
is also used for charcoal production and building poles. The bark of A. mearnsii is
chipped and the extracts are used for the production of tanning extracts as well as
industrial adhesives for the manufacture of weather and boil proof particle board,
plywood, medium density fibre board and corrugated cardboard. These bark extract
products are exported to more than 50 countries world-wide.
Acacia mearnsii is a member. of the family Leguminosae and is capable of nitrogen
fixation. This makes it very attractive for planting in rotation with other forest species and
agricultural crops. With the increased pressure on International Forestry from
environmental agencies, this aspect of black wattle will be taken into consideration when
planning future plantings. Farmers who have been growing sugarcane in rotation with A.
mearnsii have, for example, reported considerable increase in yields.
Despite the fact that A. mearnsii has been grown commercially in South Africa for more
than a century, very little research has been conducted on the diseases affecting these
trees. Where Eucalyptus propagation in South Africa has benefited from intensive
. research into increased growth and disease resistance, very little work has been done with
A. mearnsii in this regard. This situation is changing as the importance of A. mearnsii is
realised by larger forestry companies, and as the demand for the higher quality wood
IV
increases. Attention is now being focused on breeding trees with higher quality wood,
shorter rotations and disease resistance.
Funding for research into A. mearnsii diseases was initiated in the 1990's, after a serious
wilt disease, caused by Ceratocystis albofundus, was identified in the KwaZulu-Natal
Midlands. The disease, known as wattle wilt (Ceratocystis wilt) is currently the most
serious disease affecting A. mearnsii, with the pathogen capable of killing infected trees
within a period of six weeks after inoculation. Discovery of Ceratocystis wilt also
prompted a survey of diseased A. mearnsii in South Africa and C. albofundus is now
known to occur throughout South Africa. A number of diseases have been reported to
affect A. mearnsii, and, in a comprehensive survey of diseased trees conducted from 1994-
1995, a number of new pathogens were also reported.
This thesis is a continuation of the research conducted in 1994/1995 and expands the
available knowledge regarding the diseases affecting A. mearnsii in South Africa. It also
aims to show the potential connection between pathogens occurring on different forestry
species, illustrating the importance of taking other crops and their pathogens into'
consideration as possible sources of pathogens. The primary focus of this thesis is,
however, on Ceratocystis wilt. Apart from Ceratocystis wilt it also investigates other
diseases of A. mearnsii and the connection to pathogens on Eucalyptus spp. which are
also grown extensively in South Africa. Each chapter has been written as an individual
entity, although a close interaction is found between research represented in each of these
units. Nevertheless, a degree of repetition between chapters has been unavoidable.
As an introduction, the thesis commences with a literature review on the diseases affecting
commercially grown Acacia spp., focusing on A. mearnsii and the South African situation.
A list of pathogens reported from Acacia spp. is provided at the end of Chapter one.
Information gained from this literature review can be used in the identification and
quarantine of plant material to prevent diseases of A. mearnsii, not yet occurring in South
Africa, from entering the country.
v
In Chapter two, I investigated the population diversity of the wattle wilt pathogen, C.
albofundus, in South Africa. The diversity of a pathogen population plays a role in the
success of potential control measures against the disease. It also provides data pertaining
to the mode of reproduction and the origin of the pathogen. The more diverse the
population, the more likely it is to overcome. disease tolerance in clones and the more
likely it is that it is native to the country. Ceratocystis albofundus is known only from
South Africa and the only other report of this fungus is from native Protea spp.
Very little is known about Ceratocystis sensu stricto in South Africa or the rest of Africa.
Apart from C. albofundus and Chalara elegans (known to be an anamorph of
Ceratocystis), only a few superficial reports of fungi in this genus have been made on this
continent. Whether C. fimbriata occurs in South Africa has been questioned, since the
reports of C. fimbriata from Protea spp. and A. mearnsii were shown to be incorrect and
rather, to represent C. albofundus. During surveys of A. mearnsii diseases, two
previously unrecorded fungi in the genus Ceratocystis were isolated. In Chapter three, I
consider the identity of these two fungi and present the results of laboratory pathogenicity
tests that show that they are capable of causing disease of A. mearnsii seedlings.
In Chapter four, C. fimbriata is reported as a pathogen of Eucalyptus in the Republic of
the Congo for the first time. Isolates are compared with other C. fimbriata isolates,
including some from A. mearnsii in South Africa. It is also the first report of a true C.
fimbriata isolate, and not C. albofundus, from A. mearnsii. This chapter is the first report
of C. fimbriata causing a wilt disease of Eucalyptus in Africa and considers the
phylogenetic relationship between C. fimbriata from A. mearnsii and C. fimbriata from
Eucalyptus spp. in West Africa and Brazil. The data provide knowledge of the possible
origin of C. fimbriata in South Africa and the Congo and also of the taxonomy of C.
fimbriata.
VI
In a previous study, a species of Seiridium was reported from diseased A. mearnsii in
South Africa. In Chapter five, the phylogenetic relationship of this Se iridium sp. from A.
mearnsii is considered. This is done using morphological and molecular techniques,
comparing A. mearnsii isolates to Seiridium isolates responsible for cankers on Cupressus
spp. Molecular evidence is sought to support the identity of the A. mearnsii isolates and
to show their similarity to the Seiridium spp. that cause cypress canker. Pathogenicity
tests on A. mearnsii and Cupressus lusitanica are also conducted to support molecular
and morphological data.
Many plant pathogens can live as symptomless endophytes in their hosts for part or all of
their life cycle. These fungi are often activated to cause disease under unfavourable
environmental conditions, such as drought and frost. Previous disease surveys of A.
mearnsii have yielded a number of fungal species that may be capable of endophytic
growth. In Chapter six, I investigate the endophytes of A. mearnsii, with the aim of
identifying possible pathogens of this host. This would give an indication of the likelihood
of the appearance of disease on A. mearnsii under unfavourable climatic conditions and
provide the first list of endophytes of A. mearnsii.
The final chapter of this thesis deals with an unexpected and unusual report of Fusarium
graminearum from A. mearnsii. This fungus is best known as a pathogen of wheat and
maize but was shown to be capable of producing lesions on A. mearnsii. It was isolated
infrequently from stem cankers and branches showing die-back. In Chapter seven, I
consider the identity of this fungus, using molecular. techniques, and pathogenicity tests on
A. mearnsii.
This thesis represents a continuation of research previously undertaken on the fungal
diseases of A. mearnsii. It also expands our knowledge on these pathogens, especially the
economically important C. albofundus. It is my sincere hope that this research will
contribute towards an increased knowledge pertaining to pathogens such as Ceratocystis
spp. and also to the improvement of A. mearnsii propagation in South Africa.

2
1
FUNGAL DISEASES OF PLANTATION ACACIA SPECIES, WITH SPECIAL
REFERENCE TO ACACIA MEARNSII IN SOUTH AFRICA: A REVIEW
ABSTRACT
Plantations of fast growing exotic tree species have become the basis of an important industry in
many developing countries of the world. Among the most common trees planted are a number of
species in the genus Acacia. Acacia spp. possess excellent wood qualities for pulping and are also
widely used for firewood and construction. In the past, detailed studies on diseases affecting these
trees have been neglected in favour of the more widely planted Eucalyptus spp. Many diseases have,
however, now been reported on Acacia spp., and research aimed at a better understanding of them is
increasing. In South Africa, A. mearnsii is especially versatile in that both the wood and the bark are
used commercially. The industry has, however, experienced a number of disease problems, of which
the recently reported Ceratocystis wilt is the most serious. The aim of this chapter is to provide a
review of the diseases of the most widely planted plantation Acacia spp. of the world, but with
particular reference to A. mearnsii in South Africa.
3
1.0 INTRODUCTION
The genus Acacia resides within the family Leguminosae (= Fabaceae) and includes 1250 described
species. Acacia spp. form an important component of the natural shrub and wood vegetation in
many parts of the world (Carr, 1976; Ross, 1979; Davidson & Jeppe, 1981). In Africa, Acacia spp.
are considered important for grazing and are unrivalled as pioneer species (Bames, 'Filer & Milton,
1996). The genus is endemic to various countries, including countries in Asia (Barnes et al., 1996),
Australia (Larsen, Lombard & Hodges, 1985; Barnes et al., 1996), Hawaii (Hodges & Gardner,
1984; Larsen et al., 1985), New Guinea (Lee & Arentz, 1995), Indonesia (Lee & Arentz, 1995) and
various countries in Africa (Barnes et al., 1996).
Acacia spp. are extensively planted as exotics in plantations in many parts of the world. The
Australian species are most widely planted as exotics, because of their outstanding wood properties,
as well as for the high tannin contents of their bark (Sherry, 1971; Gibson, 1975; Bakshi, 1976;
Tumbull, 1991). These species include A. auriculiformis A. Cunn. ex Benth., A. decurrens Wend!.,
A. mangium Willd. and A. mearnsii de Wild. All four species are economically important to
countries such as Brazil, India, Malaysia and South Africa (Sherry, 1971; Bakshi, 1976; Floranee &
Balasundaran, 1991; Tumbull, 1991; Lee, 1993).
Where exotic plants are established as monocultures in plantations, they are more susceptible to
infection by pathogens. There are thus many reports of diseases affecting plantation trees (Gibson,
1964; Ahmad, 1987; Roux & Wingfield, 1997). During the last century, there have also been many
reports of disease problems on Acacia spp. Unfortunately, few of these diseases have been
investigated in any detail with the result that most disease situations are still unresolved. In some
instances, there are also contradictory reports regarding the cause of diseases. There is thus a need
for detailed study of the diseases of commercially planted Acacia spp., especially considering their
importance to forestry. This review is intended to provide a background on some of the more
serious diseases known to affect Acacia spp. A list of possible pathogens reported on plantation
Acacia spp. is also included.
4
2.0 Acacia auriculiformis
Acacia auriculiformis is widely planted in south east Asia, including Java and Madera, and Oceana,
as well as in Africa for fuel wood. It is planted in urban forests and in aforestation (Suharti, 1980;
Wiersum & Ramlan, 1982; Turnbull, 1991). The wood is used for furniture and farm tool
manufacture, and gives high pulp yields. This tree is often preferred to other Acacia spp., since it is
very fast growing and has proven to .be adaptable to extremes in temperature and moisture
availability (Wiersum & Ramlan, 1982; Supriana & Natawiria, 1987; Turnbull, 1991; Barari,
1993).
2.1 Root, butt and stem rots
Various root diseases of A. auriculiformis have been described from India. These pathogens include
an unidentified Ganoderma sp. which was reported to cause trunk rot of mature trees. The disease
is characterised by the defoliation of the trees and the eventual hollowing of the stems, due to decay.
The primary inoculum source was reported to be older stumps (Barari, 1993). Two species of
Ganoderma cause wood rot of A. auriculiformis. Ganoderma applanatum (pers.: Wallr.) Pat.
causes white mottled heart rot and G. lucidum (Leyss.: Fr.) Karst. causes white spongy rot (Browne,
1968; Lenné, 1992). Ganoderma lucidum was reported to cause root rot in an Acacia arboretum in
the Seoni district in central India. Ganoderma applanatum has also been reported from India where
it is considered to be the cause of mortalities of various Acacia spp. in an arboretum (Harsh, Soni &
Tiwari, 1993). Two other pathogens causing root disease in India are Macrophomina phaseolina
(Tassi.) G. Goid. and Lasiodiplodia theobromae (pat.) Griff. & Maubl. (Synonyms: Botryodiplodia
theobromae Pat.; Diplodia natalensis Pole Evans) (Lenné, 1992). Symptoms of the disease caused
by M phaseolina include die-back, gummosis and root death (Lenné, 1992). Another root disease
of note is caused by an unidentified species of Phellinus in Papua New Guinea (Lenné, 1992).
Phellinus noxius (Corner) G. H. Cunn. has been associated with rot and tree deaths in Malaysia (Lee
& Arentz, 1995), but it is not known if this species is also the cause of the rot in Papua New Guinea.
In Kerala, India, Corticium salmonicolor Berk. & Br. (Syn.: Phanerochaeta salmonicolor) causes a
severe disease, of which the first symptoms are wilting and die-back of the main stem. Other
symptoms include girdling of the stem and splitting of the bark, due to canker formation. Affected
5
areas are covered in a pink encrustation (Florence & Balasundaran, 1991). This pathogen was
reported to affect 2- to 3-year-old trees and is common in tropical areas with high rainfalls, with
mortalities of25 - 100 % (in Eucalyptus plantations) in Kerala (Florence & Balasundaran, 1991).
2.2 Foliar diseases
In India, Cylindrocladium quinqueseptatum Boedijn & Reitsma causes leaf spot and defoliation of
trees, while Rhizoctonia solani Kuhn causes web blight which leads to defoliation (Lenné, 1992). In
the same country Exserohilum rostratum (Drechsler) Leonard & Suggs. causes lesions on foliage of
young trees (Lenné, 1992). An unknown Oidium sp. has also been reported as the cause of seedling
disease in China (Wang & Fang, 1991).
There have been three reports of rusts on A. auriculiformis. In all three instances the causal agent
was described as a species of Uromyces. In India, U digitatus Winter reduced growth of plants in
nurseries and also of new transplants, while in Indonesia, an unidentified Uromyces sp. causes rust
(Lenné, 1992). In nurseries throughout Java and Madera, a rust causing the formation of galls,
chlorosis and stunted growth is commonly found. If left untreated the disease spreads into the field.
The complete taxonomy of this rust fungus is, however, still unresolved (Suharti, 1980; Supriana &
Natawiria, 1987). It was reported that A. auriculiformis is the primary host of this rust, since the
pycnial, uredial and telial phases of the fungus were found on it (Suharti, 1980).
It is, however, believed that the rust of Acacia in Indonesia is in fact not a species of Uromyces, but
a species of Atelocauda. Later reports of the rust from Java, reported by Suharti (1980) as a species
of Uromyces, is in fact as Atelocauda digitata (Wint.) Cumm. & Y. Hiratsuka (Gardner, 1991).
Teliospores of the Indonesian rust (demicyclic) are identical to A. digitata in Hawaii. It is speculated
that either the Hawaiian or the Indonesian rust represents a new species (Hodges, personal
communication) .
3.0 Acacia catechu (L.f.) Willd. - Khair/Cutch tree
Khair has been classified as one ofIndia's most important cash crops. Wood from these trees yields
cutch, which is used for dyeing and tanning, and also katha. The wood is also useful for cabinet
6
building (Howard, 1920; Bakshi, 1957; Karnik et al., 1971). The tree is considered very valuable
by having a good growth rate and by performing well under poor soil conditions (Rout, Samantary &
Das, 1995).
Most reports of diseases of A. catechu originate from India. Ganoderma lucidum has been reported
to cause heavy mortalities due to root rot (Bakshi, 1957; Gibson, 1975; Lenné, 1992). The fungus
forms white mycelium in the living roots and produces a white spongy rot (Gibson, 1975). Root rot
leading to death of trees may also be caused by Polyporus gilvus Schwein [Synonym: Phellinus
gilvus (Schw.) Pat.] (Bakshi, 1957). These pathogens infect trees when they are under stress and
affect the sapwood, causing a soft spongy rot (Bakshi, 1957).
Wood rot of A. catechu has been reported to be caused by Phellinus badius (Cooke) G.H. Cunn.
Losses of up to 50% have been reported in plantations after infection (Gibson, 1975). Polyporus
gilvus was said to infect both sapwood and heartwood (Gibson, 1975). Also in India, Fomes badius
[Syn.: Phellinus badius (Berkley) Cunningham] is reported as the cause of heart rot (Bakshi, 1957;
Ito & Nanis, 1997). This fungus infects the trees through wounds, rendering the heartwood
unusable. Fomes bad ius was described as a facultative wound parasite, only infecting heartwood
and not sapwood (Bakshi, 1957). Root and wood rots are, however, not the only diseases that have
been described on A. catechu. More recently, a wilt disease was reported to be caused by Fusarium
so/ani (Mart.) Sacc. (Lenné, 1992). Witches broom, caused by Ravenelia tandonii Syd., has also
been reported from India (patil & Date, 1980).
4.0 Acacia dealbata Link - Silver Wattle
Silver wattle is grown for its timbe,r and for the making of cask staves (Howard, 1920). Countries in
which it is grown commercially include China and many others (Wang & Fang, 1991). It is a very
frost hardy tree, but has, in many instances, been replaced by A. mearnsii because the latter has a
higher tannin yield (Bakshi, 1976). It is also very useful in being able to colonise very poor sites
(Wang & Fang, 1991).
7
4.1 Root, butt and stem rots
In Australia and New Zealand a number of root diseases caused by Basidiomycetes have been
reported on A. dealbata. Peniophora incarnata (Fr.) Karst., in Australia, and P. sacrata G.H. Cunn,
in New Zealand, for example, were reported as the cause of root diseases (Gibson, 1975; Bakshi,
1976). Other diseases are heart rot caused by Fomes mastoporus (Lev.) Cke in New Zealand, G.
applanatum and G. australe (Fr.) Pat. in Australia and New Zealand (Ito & Nanis, 1997), as well as
Trametes tawa G. H. Cunn. in Australia (Bakshi, 1976). Another root disease reported on A.
dealbata is said to be caused by Armillaria mellea (Fr.) Kummer sensu lato (Bakshi, 1976).
4.2 Stem diseases
Hypoxylon hypomiltum Mont. and H rubiginosum Fr. cause stem cankers on A. dealbata in
Australia (Bakshi, 1976). In Japan, Glomerella acaciae (K. Ito & Shibukawa) K. Ito cause
anthracnose and lesions on leaves, stems and petioles. During wet periods young shoots are girdled
and die. This disease was reported to be seed-borne (Hodges, 1964).
4.3 Foliar diseases
Calonectria indusiata Seaver (Syn. Calonectria theae Loos) (Bakshi, 1976) and its anamorph
Cylindrocladium theae (petch) Subramanian (Syn. Cercosporella theae Petch) cause leaf spots and
lesions on twigs in Sri Lanka (Gibson, 1975; Crous & Wingfield, 1994). In severe cases, C.
indusiata can cause complete defoliation (Bakshi, 197.6). In Australia, Uromyces phyllodiorum
(Berk. & Br.) McAlpine and Uromycladium alpinum McAlpine cause phyllode and leaf rust, while
Uromycladium acaciae (Cke.) Syd. (syn. U. bisporum McAlpine) causes powdery leaf spots and
swellings on branches. This latter disease also occurs in New Zealand (Bakshi, 1976; Dick, 1985).
Uromycladium notabile causes galls on branches, phyllodes and pods in Australia and New Zealand
(Bakshi, 1976; Dick, 1985).
In Japan, Glomerella cingulata (Stonem.) Spauld. & Schrenk. (Syn: Physalospora acaciae K. Ito &
Shibukawa) has been reported as a serious pathogen, affecting both the leaves and the stems. The
disease first starts as spots· on seedlings during moist weather, and these will lead to leaf drop and the
eventual girdling of the stems as the disease worsens. Cylindrocladium scoparium Morgan and
8
Fusarium oxysporum Schlecht. were often associated with this disease as secondary pathogens
(Gibson, 1975).
5.0 Acacia decurrens - Green wattle
This tree is grown for its timber and tannin in Indonesia, South Africa and Brazil '(Ribeiro et al.,
1988; Tumbull, 1991; Evans, 1992). It is rated second only to black wattle (A. mearnsii) in the
quality of its bark and it is also more frost hardy (Bakshi, 1976).
5.1 Root, butt and stem rots
Reports of root disease of A, decurrens include pathogens such as A, mellea sensu lato and A.
fuscipes Petch. in India (Bakshi, 1976), Fomes lamaoensis (MUIT.) Sacc. & Trott. in Indonesia and
Poria albobrunnea Petch. in Sri Lanka (Bakshi, 1976). In the East Indies Rosse/inia acruata Petch
and R. bunodes (Berk. & Br.) Sacc. cause black root rot (Gibson, 1975).
Root rot, caused by Ganoderma lucidum, has resulted in severe losses to arboretum trees in India
(Harsh et al., 1993). Mortality of these trees was noticed within the first year after planting, with
infection originating from previously colonised stumps. After infection of living trees from stumps,
infection was also reported to spread through root contacts within plantation blocks (Harsh et al.,
1993).
5.2 Stem diseases
Stem diseases of A. dealbata are known to be caused by three pathogens that result in cankers on
stems and twigs. Corticium salmonicolor in Mauritius, South Africa and Formosa causes pink
disease (Gibson, 1975; Bakshi, 1976), while in South Africa Physalospora abdita (Berk. & Curt.)
N.E .. Stevens has been reported to cause stem cankers (Bakshi, 1976). A serious wilt and canker
disease, accompanied by gummosis, of A. dealbata occurs in Brazil. The causal agent of this disease
has been identified as Ceratocystis fimbriata Ell. & Halst. (Ribeiro et al., 1988).
9
5.3 Foliar diseases
Calonectria indusiata causes dark brown to black spots on leaves in Sri Lanka, Indonesia and India.
The disease was reported to be very serious in some of these areas, leading to complete defoliation
of trees. Calonectria indusiata was also reported to be capable of causing cankers on young plants
in Sri Lanka (Bakshi, 1976). Other leaf spot diseases have also been reported to be caused by
Camptomerris albizziae (petch) Mason and C. verruculosa (Syd.) Bessey in South Africa (Bakshi,
1976). In India and Sri Lanka C. theae causes leaf spots and lesions on twigs (Gibson, 1975).
Uromycladium notabile causes galls on branches, stems, seed pods, leaves and petioles. In addition
it causes die-back of the branches beyond the galls and may lead to the death of young trees (Dick,
1985). The galls restrict water conduction within the branches, resulting in the die-back of the
affected parts (Dick, 1985). This disease has been reported from Australia, where A. decurrens is
native, as well as in New Zealand (Bakshi, 1976; Dick, 1985).
5.4 Nursery diseaseslDamping-off
A number of nursery diseases, including damping-off, have been recorded on A. dealbata. The
pathogens include fungi such as C. scoparium and F. oxysporum, associated with post-emergence
damping-off (Bakshi, 1976). In Japan, G. cingulata has been described as the cause of brown to
dark brown lesions on above ground parts of seedlings. In wet weather, these lesions develop
rapidly, leading to girdling and death of the affected seedlings. The fungus is reported to be seed
borne, with mycelium found on the seed surface, in the parenchyma and in the embryos (Bakshi,
1976).
6.0 Acacia koa Gray - Koa
The koa tree is a tropical timber tree, native to the Hawaiian islands and grown for the production of
hardwood furniture on these islands (Gardner, 1978; Stein, 1983). Diseases affecting A. koa are
mostly rusts, caused by a number of different genera and species. A number of other diseases have,
however, also been documented.
10
The rusts reported on A. koa include several species previously placed in the genus Uromyces. All
the pacific rusts of Acacia have, however, been transferred to the genus Atelocauda (Hodges &
Gardner, 1984; Chen, Gardner & Webb, 1996). Atelocauda koae (Arthur) Cummins & Hiratsuka
(=Uromyces koae Arthur) infects mainly young trees, leading to the distortion of leaves and small
branches. In severe cases, entire stems are deformed (Gardner, 1978; Hodges & Gardner, 1984;
Chen et al., 1996). Atelocauda digitata (Wint.) Cumm. & Y. Hirat. (=Uromyces digitatus Winter)
may produce witches brooms on affected trees and it also causes hypertrophy of leaves, shoots,
flowers and seed pods. Both a macro- and micro cyclic form of A. digitata has been found on the
Hawaiian islands (Hodges & Gardner, 1984). Other rust genera reported from Koa include
Endoraecium acaciae Hodges & Gardner, E. hawaiiense Hodges & Gardner (Hodges & Gardner,
1984) andA. angustiphylloda Gardner (Gardner, 1991).
Diseases reported from A. koa also include the reduction of seed production caused by
Colletotrichum gloeosporioides Penz. (Stein, 1983). A number of heart and root rot fungi also
occur on A. koa. These include A. mellea sensu lato, Laetiporus sulphureus (Bull.:Fr.) Bond. &
Sing., Phaeolus schweinitzii (Fr.) Pat., Pleurotus ostreatus (Jacq.:Fr.) Quél, a species of Ganoderma
and Phellinus kawakamii Larsen, Lombard & Hodges (Bega, 1979; Larsen et al., 1985). Phellinus
kawakamii causes a white pocket rot of A. koa, leading to wood decay in the basal part of the trees
(Larsen et al., 1985).
7.0 Acacia mangium
Malaysia and Indonesia are the main countries in which A. mangium is planted as a forest plantation
tree (Nixon, 1995). It is, however, also planted widely throughout tropical Asia, the Pacific Islands,
West Africa and the Americas (Tumbull, 1991; Barari, 1993; Ito & Nanis, 1997). The wood is
used mainly for pulp, particle board and timber, although in Zaire it is also planted for fuel wood
(Logan & Balodis, 1982; Zakaria, 1990; Clark et al., 1991; Nixon, 1995; Ito & Nanis, 1997).
Acacia mangium is used extensively in the reforestation of degraded grasslands and logged forests
and grows well on poorer, acid soil types (Logan & Balodis, 1982; Lee & Arentz, 1995; Kapp,
Beer & Lujan, 1997). It also readily forms hybrids with A. auriculiformis, producing progeny that
are taller than either of the parents (Logan & Balodis, 1982).
11
7.1 Root, butt and stem rots
Phellinus noxius causes brown root disease and a Macrophomina sp., charcoal root disease of A.
mangium in Malaysia (Ahmad, 1987). Characteristic symptoms of P. noxius is the formation of a
continuous fungal "skin", covering the surface of the affected roots, and the presence of brown lines
in the infected roots (Ahmad, 1987). This wood rotting fungus is known to cause a rot called
honeycomb rot (pocket rot) (Lee & Arentz, 1995). Macrophomina spp. infect the root tips, killing
the entire root system, which leads to the stunting and death of seedlings (Ahmad, 1987; Lenné,
1992). Other root pathogens reported to cause disease of A. mangium, are L. theobromae in India
(Lenné, 1992) and an Armillaria sp. in Malaysia (M. J. Wingfield, unpublished).
There are a number of reports of heart rot caused by Ganoderma spp. In Bengal an unidentified
Ganoderma sp. cause trunk rots accompanied by defoliation and the hollowing of trees. Fruiting
bodies of a Ganoderma sp. were found at the base of affected trees, but the fungus species was not
identified (Barari, 1993). In Malaysia, a species of Ganoderma causes red rot disease of A.
mangium, while P. noxius causes brown root disease, killing seedlings (Lenné, 1992). Brown root
disease is characterised by the decay of woody tissue and the yellowing and death of the foliage
(Lenné, 1992).
Heart rot in the tropics, especially in Malaysia, Indonesia and Papua New Guinea, cause volume loss,
reduction in the quality of wood and it leads to death of many trees (Lee, 1995; Ito & Nanis, 1997).
Rot types reported include honeycomb rot caused by P. noxius, spongy rots, fibrous rots, brittle rot,
pink pocket rot (Lee & Arentz, 1995) and white rot (Ito & Nanis, 1997). A number of possible
wood rot fungi have been isolated from infected wood, but no single fungus has been identified as
the primary, or sole cause of rot. Infections occur through wounds, especially branch stubs, and the
severity of the disease increases with the age of trees. A direct correlation between the number and
size of the side branches and the occurrence of heart rot has also been found. The more side
branches and the thicker the side branches, the higher the incidence of disease. It is recommended
that side branches be pruned at any early age, so as to produce only small wounds that can heal
rapidly, thereby reducing the occurrence of heart rot (Lee, 1993; Ito & Nanis, 1997).
12
7.2 Stem diseases
In Malaysia, Corticium salmonicolor causes pink disease that results in serious damage to stems
(Ahmad, 1987). Corticium salmonicolor predominantly infects young trees, causing death by
girdling of the sterns and branches (Ahmad, 1987). Trametes corrugata (Pers.) Bres. has not been
shown to cause disease in Malaysia, but is found to be commonly associated with trees suffering
from die-back. This disease is especially prevalent on soils that are low in nutrients (Ahmad, 1987).
A number of fungi are reported to cause twig die-back. In the Philippines T. corrugata and a
Diplodia sp. cause die-back (Lenné, 1992). In the Solomon Islands, the same problem is thought to
be caused by Neetria pseudotricha (Lenné, 1992). A Neetria sp. is also reported to cause extensive
canker formation of up to 3 meters on A. mangium in Central America. This pathogen is capable of
killing trees when it girdles the main stems (Kapp et aI., 1997)
7.3 Foliar diseases
Minor leaf spots of A. mangium, caused by G. cingu/ata, Phyllostictina sp., Phomopsis sp. and
Pesta/otiopsis sp. have been reported from Malaysia (Ahmad, 1987; Zakaria, 1990). A more
serious problem occurs in India, where C. quinqueseptatum causes leaf spot and defoliation of trees
(Lenné, 1992). In Malaysia, Cylindrocladium theae causes dark spots on leaves and sunken lesions
on green twigs (Lenné, 1992), while in Malaysia, India and Thailand, sooty mold caused by a
Meliola sp. is reported to be a serious problem on young trees (Lenné, 1992).
7.4 Nursery diseaseslDamping-ofT
Damping-off diseases of nursery seedlings are very common, especially among seedlings that have
been planted too densely, and where soils are damp. In Malaysia, the most common fungi associated
with damping-off are species of Fusarium, Pythium and Rhizoctonia (Ahmad, 1987; Zakaria, 1990).
In Malaysia, F. so/ani and in Sabah, R. so/ani are the cause of damping-off of seedlings (Zakaria,
1990). Apart from damping-off, a number of nursery diseases affecting the foliage of A. mangium
also occur. Powdery mildew caused by an unidentified species of Oidium has led to mortalities as
high as 75 % in Thailand nurseries and has also caused problems in Australia and China.(Wang &
Fang, 1991; Lenné, 1992). The problem also occurs in nurseries in Malaysia and may lead to
13
premature defoliation (Zakaria, 1990). In Indonesia and Papua New Guinea, G. cingulata causes
seedling blights characterised by dark elliptical to irregular lesions on phyllodes as well as defoliation
and death under humid conditions (Lenné, 1992).
8.0 Acacia mearnsii - Black wattle
In South Africa A. mearnsii is planted commercially for both its wood and bark. Tannins in the bark
are used for the production of wood adhesives and flotation agents, as well as for leather tanning
(Saayman & Oatley, 1976; Tumbull, 1991). The wood is used to produce paper, pulp and rayon
and also for charcoal (Sherry, 1971; Tumbull, 1991; Evans, 1992; Anonymous, 1997). Acacia
mearnsii is planted extensively in China, India, Japan, Kenya, Tanzania, Uganda, Brazil, Uruguay
and Argentina (Boucher, 1978; Kihiyo & Kowero, 1986; Tumbull, 1991) and was also planted
widely in Sri Lanka, Kenya and Zimbabwe (Sherry, 1971; Bakshi, 1976).
8.1 Root and butt rots
Various root and butt rots have been described on A. mearnsii. One of the most common root
pathogens, M phaseolina, has been reported as the cause of a root disease in Sri Lanka and South
Africa (Gibson, 1975; Bakshi, 1976). Armillaria mellea sensu lato and G. lucidum are reported to
cause root disease in South Africa (Bakshi, 1976; Gorter, 1977). Ganoderma applanatum is also
reported from Sri Lanka and South Africa, where it causes heart rot (Bakshi, 1976). Collar rot in
South Africa has also been ascribed to G. rugosum Blume & Nees, suggesting that three species of
Ganoderma are responsible for root and collar rots of 4. mearnsii in South Africa (Gibson, 1964;
Luckhoff, 1964).
The best described disease of A. mearnsii in South Africa is black butt, caused by Phytophthora
parasitica (Dastur) Waterhouse (= P. nicotianiae) (Zeijlemaker, 1971). It was originally believed
that this pathogen causes two types of symptoms on trees, depending on the prevailing
environmental conditions. Zeijlemaker (1971) described both mottled lesions (under cool
conditions) and black to brown "tongues" of dead bark extending up the stem of the tree (warmer
temperatures, ea. 30°C).
14
A number of reports of L. theobromae have originated from South Africa. Reports of collar rot
from the Eastern Cape and throughout plantations in KwaZulu-Natal in the 1930's were ascribed to
this pathogen. The rot was reported to start in the roots and lead to trees being blown over by the
wind (Stephens & Goldschmidt, 1938). In KwaZulu-Natal and Mpumalanga whole root systems
were affected and infection spread up stems to form black cankers. The affected roots were all
stained a dark colour (Laughton, 1937). In the Eastern Cape Province, a Rhizoctoma sp. was also
reported to cause infection of trees, leading to epidemic occurrences of root disease (Kotzé, 1935;
Laughton, 1937).
8.2 Stem diseases
A number of stem diseases have been reported in South Africa. Schizophyllum commune Fries was
reported as an opportunistic wound parasite, leading to the death of trees, and the rotting of the
wood. Pruning wounds, especially seemed to be sites of infection for this opportunistic parasite
(Ledeboer, 1940). Two other stem canker pathogens in South Africa include Physalospora abdita
(Bakshi, 1976) and Botryosphaeria dothidea (Moug.) Ces. Et de Not. causing wood discolouration,
die-back and canker of trees (Roux & Wingfield, 1997; Roux et al., 1997).
In Malaysia and Mauritius C. salmonicolor was reported to cause stem and twig cankers (Gibson,
1975; Bakshi, 1976). Anthracnose, caused by Glomerella acaciae, has been problematic in Japan
(Hodges, 1964), and in the Lower Pulneys, stem canker caused by Dothiorella pithyophilla Sacc.
caused large scale losses (panneerselvam et al., 1975). Heart rot has been reported from a number
of countries on various Acacia hosts, with G. applanatum causing white mottled heart rot and G.
lucidum white spongy rot (Lenné, 1992).
8.3 Foliar diseases
Calonectria indusiata causes dark brown to black spots on leaves of A. mearnsii in Sri Lanka and
India (Bakshi, 1976). This fungus can also cause sunken lesions on twigs and result in defoliation of
trees (Gibson, 1975; Lenné, 1992). Another leaf disease occurring in India is caused by R. solani,
which causes web blight, also resulting in defoliation (Lenné, 1992). In South Africa, leaf spots are
caused by Camptomerris albizziae (Wingfield & Kemp, 1993) and C. verruculosa (Bakshi, 1976).
15
The disease is, however, not considered to be serious, usually being associated with leaf drop during
fall (Wingfield & Kemp, 1993).
Various rusts have been reported from A. mearnsii. In Australia and New Zealand, U acaciae
causes powdery leaf spot and swellings on branches (Bakshi, 1976; Dick, 1985), while U
tepperianum (Sacc.) McAlpine causes galls on the phyllodes and branches (Bakshi, 1976). This
report has been questioned, since U tepperianum was not found in subsequent studies. The fungus
deposited as U tepperianum was later found to be U notabile (Morris & Wingfield, 1988). The
report of U acaciae on A. mearnsii has also been questioned (Morris & Wingfield, 1988).
Uromycladium notabile causes galls on branches, stems, seed pods, leaves and petioles (Sherry,
1971; Dick, 1985). The first and only rust described thus far from A. mearnsii in South Africa is
caused by U alpinum (Morris & Wingfield, 1988). The disease was described in areas ranging from
the Western Cape Province to Swaziland in the East, causing severe leaf drop of the lower leaves
(Morris & Wingfield, 1988).
8.4 Wilts
Wilt and die-back diseases of A. mearnsii have been reported regularly since the beginning of the
century. In South Africa a serious disease was known as Albert Falls disease (Stephens &
Goldschmidt, 1938). The causal agent was, however, never found although a range of fungi were
isolated from diseased tissue (Stephens & Goldschmidt, 1938). Some authors reported Rhizoctonia
lamellifera Small. to be the cause of Albert Falls disease (Gibson, 1964; Luckhoff, 1964), but this
was never proven.
In 1989, a serious die-back and wilt disease of black wattle was ascribed to Ceratocystis fimbriata
(Morris, Wingfield & de Beer, 1993). The disease is characterised by the rapid wilting and die-back
of trees, gumrnosis, stem and wood lesions (Morris et aI., 1993). Since this report the disease has
continued to be the focal point of disease research of black wattle in South Africa. The causal agent
has more recently been described as a new species of Ceratocystis, known as C. albofundus de Beer,
Wingfield & Morris (Wingfield et al., 1996). "
A die-back disease, caused by Phoma herbarum Westend. has been reported from Kenya. The
fungus was described to be a wound associated pathogen only. Spores of P. herbarum could not
16
infect healthy bark, although it was found that mycelium of the fungus could infect both wounded
and healthy bark (Olembo, 1972).
8.5 Nursery diseases
Cylindrocladium scoparium Morgan is reported to be the cause of post emergence damping-off
(Bakshi, 1976). It is, however, suggested that all South African isolates of C. scoparium may in fact
reside in another species. It is suggested that all previous reports are in fact of C. candelabrum
Viégas and not of C. scoparium (Crous & Wingfield, 1994). An undetermined species of Oidium
regularly causes powdery mildew of seedlings (Sherry, 1971).
9.0 HEALTH OF A. MEARNSIIIN SOUTH AFRICA
In South Africa, A. mearnsii (black wattle) trees provide tannin for the production of Bondtite
products such as water resistant glues, while the wood is used in the production of pulp
(Anonymous, 1997). The tannins, extracted from the bark, are also used in the leather tanning
industry (Anonymous, 1997). The pulp is used for t~e manufacture of high quality paper as well as
rayon. Apart from this, A. mearnsii wood is used for chipboard, plywood and charcoal manufacture
(Anonymous, 1997). The A. mearnsii industry is the third largest forestry industry in the country,
and has shown itself to be invaluable to the success of the industry (Anonymous, 1992; Anonymous,
1996). Diseases of A. mearnsii are thus of great concern. Black wattle is fast growing, relatively
drought tolerant and versatile. An added benefit is also their ability to fix nitrogen (Sherry, 1971).
Between the period 1994-1995 a comprehensive survey of diseases of A. mearnsii was conducted
(Roux & Wingfield, 1997). This survey resulted in the identification of a number of fungi that had
not previously been reported from A. mearnsii in South Africa. A number of new pathogens were
also identified during this survey (Roux & Wingfield, 1997). Currently, diseases are common on A.
mearnsii in South Africa. Black butt is found in many plantations. The typical black discolouration
of the bark may either be restricted to the basal parts of the stems, but it often spreads and eventually
covers the entire length of the trees (Roux & Wingfield, 1997). In severe cases the disease often
leads to tree death. If trees survive, bark can be of a very low quality and is mostly unsaleable
(Haigh, 1993).
17
Initially, the most serious disease of A. mearnsii in South Africa, was considered to be Ceratocystis
wilt. This disease is of great concern to the industry, since it usually leads to tree death (Morris et
aI., 1993). During the recent surveys, however, very few isolates of C. albofundus were collected
from symptomatic trees (Roux & Wingfield, 1997). This was probably a result of the difficulty with
which this pathogen is isolated, and not because it is uncommon in plantations. Symptoms of the
disease are reportedly abundant (Roux & Wingfield, 1997), but many questions regarding the
etiology of this disease and the origin of the pathogen remain unresolved.
A number of previously unreported fungal taxa were isolated from diseased A. mearnsii during these
surveys. These included the probable pathogens, Phytophthora boehmeriae Sawada,
Botryosphaeria dothidea [=B. ribis (Tode.:Fr.) Grosenb. & Drugger], a Sphaeropsis sp. and a
Fusarium sp. (Roux & Wingfield, 1997; Roux et al., 1997). A study of the role of these fungi, as
well as a detailed study of Ceratocystis wilt, is now a priority.
Phytophthora boehmeriae has been shown to be capable of producing lesions similar in size to those
produced by P. parasitica on A. mearnsii seedlings, both in glass house and in field inoculations
(Roux & Wingfield, 1997). During the 1994-1995 surveys a number of oomycetous fungi were
isolated from diseased material. These fungi included P. meadii McRae, which was shown to be
capable of producing significant lesions on A. mearnsii seedlings in glass house and field trials
(Roux, 1996; Roux & Wingfield, 1997). It is clear that more than one Phytophthora species might
be involved in diseases of A. meamsii. A study of these fungi, their distribution and etiology is
needed.
Botryosphaeria dothidea and Sphaeropsis sapinea (Fr. :Fr.) Dyko & B. Sutton are serious stress
related pathogens of Eucalyptus and Pinus spp. in South Africa and other parts of the world (Swart,
Wingfield & Knox-Davies, 1987; Shearer, Tippett & Bartle, 1987; Smith, Kemp & Wingfield,
1994). Both pathogens are known as endophytes on various plants (Fisher et al., 1993; Smith et al.,
1996a; Smith, Wingfield & Petrini, 1996). These fungi can infect healthy trees through wounds or
stomata and live asymptomatically within the host tissues until the host tree is stressed or weakened.
These endophytic fungi can then become aggressive pathogens, capable of killing mature trees
(Carroll, 1988; Stone & White, 1997). Sphaeropsis sapinea has been shown to be especially
aggressive after hail damage to Pinus spp. Trees that would normally have recovered from the hail
18
damage are killed within a few weeks (Swart et al., 1987; Zwolinski, Swart & Wingfield, 1990).
The same has been found with B. dothidea and frost damage on Eucalyptus spp. (Smith et al.,
1994). The isolation of B. dothidea and a Sphaeropsis sp. from diseased A. mearnsii suggests that
these fungi may be endophytes on this tree, and thus play the same role in disease development as
they do on other trees.
10.0 CONCLUSIONS
10.1 It is clear that there are many diseases affecting the planting of Acacia spp. in plantations.
Many of these diseases can be controlled with management practices and sound breeding
programmes. The most common disease problems are infection by wood rot fungi. It is clear
that there is great room for improvement, especially in the breeding aspects of Acacia forestry.
Although expensive, it is possible to control nursery diseases with chemicals. Once the trees
have been taken to the plantation this option becomes impractical and uneconomical. This is
especially true when considering that many of the countries planting Acacia spp. are in fact
developing countries with limited financial resources.
10.2 Although considerable progress have been made with the identification of disease problems on
A. mearnsii in South Africa, a number of questions remain to be answered. The most pressing of
these regards the etiology of C. alboJundus and the development of disease tolerant clones for
future planting. With profits from A. mearnsii increasing, the industry will continue to grow in
importance. Disease problems should thus be clarified and controlled as early as possible, so as
to ensure the success of the industry in South Africa and in other countries.
10.3 Many of the disease problems reported on plantation Acacia spp. are wound and stress related.
Reducing the number of wounds to trees would thus greatly reduce disease problems. Basic
silvicultural practices combined with improved genetic stock will ensure that the Acacia industry
maintains a strong position in international forestry. Acacia spp. are fast growing and yield high
quality products. Unlike Eucalyptus and Pinus spp., Acacia spp. also provide nitrogen to the
soil and many may be a source of food and feed, an important consideration for developing
countries. There is great potential for using Acacia forestry in rotations with other forestry
19
genera as a way of reducing soil depletion due to nutrient losses. These trees thus deserve a
concerted research effort into maximising their performance and yield.
20
Table 1: List of pathogens reported from plantation Acacia species of the world.
Acacia species Fungal taxon Associated References
disease/symptoms
A. auriculiformis Corticium salmonicolor Pink disease Florence & Balasundaran,
1991
Cylindrocladium Leaf spot, defoliation Lenné,1992
quinqueseptatum
Exserohilum rostratum Leaf spot "
Ganoderma applanatum Root and butt rot Browne, 1968; Lenné,
1992
G. lucidum Root rot & white spongy Browne, 1968
rot
Ganoderma sp. Wood rot Barari, 1993
Lasiodiplodia theobromae Root rot Lenné, 1992
Macrophomina phaseolina Root rot, wilt, gummosis "
Phellinus noxius Wood rot Lee & Arentz, 1995
Phellinus spp. Wood rot Lenné, 1992
Rhizoctonia solani Web blight, defoliation "
Uromyces digitatus Rust "
A. catechu Colletogloeum acaciicola Sutton & Swart, 1986
Erysiphe acaciae Blumer Browne, 1968
Fomes badius Heart· rot Bakshi, 1957; Browne,
1968; Ito & Nanis, 1997
F. fastuosus [Syn.: Browne, 1968
Phellinus fastuosus
(Leveille) Cunningham]
F. senex [Syn.: Phellinus "
senex (Nees ex. Montagne)
Imazeki]
Fusarium solani Wilt Lenné, 1992
21
Acacia species Fungal taxon Associated References
disease/symptoms
A. catechu Glomerel/a cingulata Anthracnose Gibson, 1975
Ganoderma applanatum Root rot Browne, 1968
G. lucidum Root rot Bakshi, 1957; Browne,
1968; Lenné, 1992
Microstroma acaciae Browne, 1968
Phellinus badius Wood rot Gibson, 1975
P. gilvus Root rot Bakshi, 1957
Ravenelia tandonii Browne, 1968; Patil &
Date, 1980
A. dealbata Armillaria mel/ea Root rot Bakshi, 1976
Calonectria indusiata Leaf spot Browne, 1968; Bakshi,
[Imperfect = 1976; Crous &
Cylindrocladium theae] Wingfield, 1994
Cylindrocladium scoparium Leaf drop, stem disease, Bakshi, 1976
damping-off
C. floridanum Sobers & Leaf spot, root rot Crous et al., 1991
Seymour
Daldinia concentrica (Bolt. Browne, 1968
ex Fr.) Ces. & De Not.
Fomes endapalus "
F. mastoporus (Lev.) Cke. Heart rot Browne, 1968; Bakshi,
1976
Fusarium oxysporum Leaf drop, stem disease, Bakshi, 1976
damping-off
Ganoderma applanatum Heart rot Browne, 1968; Bakshi,
1976; Ito & Nanis, 1997
G. australe Heart rot Browne, 1968; Bakshi,
1976
Glomerella acaciae Anthracnose Hodges, 1964
22
Acacia species Fungal taxon Associated References
disease/symptoms
A. dealbata Glomerella cingulata Leaf drop, stem disease Bakshi, 1976
(Imperfect: Colletotrichum
acaciae K. Ito &
Shibukawa)
Hypoxylon hypomiltum Stem cankers Browne, 1968; Bakshi,
1976
H. rubiginosum Stem cankers Browne, 1968; Bakshi,
1976
Peniophora incarnata Root rot Browne, 1968; Bakshi,
1976
P. sacrata Root rot Browne, 1968
Polyporus laevigatus [Syn.: Browne, 1968
Phellinus laevigatus (Fries)
Bourdot et Galzin]
P. zonatus Fr. Browne, 1968
Trametes tawa Heart rot Browne, 1968; Bakshi,
1976
Uromyces phyllodiorum Phyllode and leaf rust Browne, 1968; Bakshi,
1976
Uromycladium acaciae Leaf spot, branch and stem Browne, 1968; Bakshi,
distortions 1976; Dick, 1985
U. alpinum Phyllode and leaf rust Browne, 1968; Bakshi,
1976
U. notabile Galls, die-back Browne, 1968; Dick,
1985
A. decurrens Armillaria mellea Root rot Bakshi, 1976
A. fuscipes Petch. Root rot "
Calonectria indusiata Leaf spot, defoliation Bakshi, 1976; Crous &
Wingfield, 1994
23
Acacia species Fungal taxon Associated References
disease/symptoms
A. decurrens Camptomeris albizziae Leaf spot Bakshi, 1976
C. verruculosa Leaf spot "
Ceratocystis fimbriata Wilt and die-back, stem Ribeiro et al., 1988
cankers
Corticium salmonicolor Pink disease Bakshi, 1976
Cylindrocladium scoparium Damping-off "
C. theae Leaf spot Gibson, 1975
Fomes lamaoensis Root rot "
Fusarium oxysporum Damping-off "
Ganoderma lucidum Root rot Harsh et al., 1993
Glomerella cingulata Stem canker Bakshi, 1976
Irpex subvinosus (B. & Br.) Bertus, 1961
Petch.
Macrophomina phaseolina Root rot Gibson, 1975
Physalospora abdita Stem cankers Bakshi, 1976
Poria albobrunnea Root rot Bertus, 1961; Bakshi,
1976
Rosellinia acruata Black root rot Gibson, 1975
R. bunodes Black root rot "
Trametes mollis Fr. Bertus, 1961
Uromycladium acaciae Leaf spot, branch and stem Dick, 1985
distortions
U. notabile Galls, die-back Bakshi, 1976; Dick,
1985
U. tepperianum Browne, 1968
A. koa Armillaria meIlea Root rot Larsen et al., 1985
Atelocauda angustiphylloda Rust Gardner, 1991
A. digitata Rust Hodges & Gardner, 1984
A. koae Rust Gardner, 1978
24
Acacia species Fungal taxon Associated References
disease/symptoms
A. koa Colletoctrichum Seed rot Stein, 1983
gloeosporioides
Cylindrocladium Collar rot Gibson, 1975
parasiticum Crous, Wingf Crous &Wingfield, 1994
& Alfenas (Syn: Calonectria
crotalariae (Loos) Bell &
Sobers)
Endoraecium acaciae Rust Hodges & Gardner, 1984
E. hawaiiense Rust "
Ganoderma sp. Root rot Bega, 1979
Ganoderma lucidum Root rot Harsh et aI., 1993
Laetiiporus sulphureus Wood rot Larsen et al., 1985
Phaeolus schweinitzii Wood rot, brown cubical "
rot
Phellinus kawakamii White pocket rot "
Pleurotus ostreatus Wood rotI white rot "
Polyporus sulphureus Bull Brown cubical rot Bega, 1979
ex. Fr.
A. mangium Armillaria sp. Root rot Wingfield, unpublished
Colletotrichum Leaf spot Lee, 1993
gloeosporioides
Corticium salmonicolor Pink disease Ahmad, 1987; Lee, 1993
Corynespora sp. Leaf spot Lee, Lenné, 1993
Cylindrocladium theae Leaf spot, lesions Lenné, 1992; Crous &
Wingfield, 1994
Cylindrocladium Leaf spot, defoliation Lenné, 1992
quinqueseptatum
Cylindroc/adium sp. Damping-off Lee, 1993
25
Acacia species Fungal taxon Associated References
disease/symptoms
A. koa Diplodia sp. Die-back Lenné, 1992
Fusarium solani Damping-off Zakaria, 1990; Lee, 1993
Fusarium sp. Damping-off Ahmad, 1987; Lee, 1993
Ganoderma sp. Heart rot Lee,' 1993
G. lucidum Root rot Harsh et al., 1993
A. mangium G. weberianum (Bresadola Root rot Lee, 1993
et Hennings) Steyaert
Gloeosporium sp. Leaf spot Lee, 1993
Glomerella cingulata Leaf spot, seedling blight Ahmad, 1987; Lenné,
1992; Lee, 1993
Lasiodiplodia theobromae Root disease, leaf spot Lenné, 1992; Lee, 1993
Macrophomina sp. Charcoal root disease Ahmad, 1987; Lenné,
1992; Lee, 1993
Meliola sp. Sooty mold Lenné, 1992
Neetria pseudotricha Die-back Lenné, 1992
Neetria sp. Stem cankers Kapp et al., 1997
Oidium sp. Powdery mildew Lenné, 1992; Lee, 1993
Phellinus noxius Brown root disease, Ahmad, 1987; Lenné,
honeycomb rot 1992; Lee, 1993
Phialophora sp. Heart rot !to & Nanis, 1997
Phomopsis sp. Leaf spot Ahmad, 1987
Phyllostictina sp. Leaf spot Ahmad, 1987
Phytophthora sp. Damping-off Lee, 1993
Pythium sp. Damping-off Ahmad, 1987; Lee, 1993
Rhizoctonia solani Damping-off Zakaria, 1990; Lee, 1993
Rhizoctonia sp. Damping-off Ahmad, 1987
Rosellinia sp. Root disease, die-back Kapp et al., 1997
Trametes corrugata Die-back Lenné,1992
A. mearnsii Armillaria mellea Root rot Browne, 1968; Bakshi,
1976
26
Acacia species Fungal taxon Associated References
disease/symptoms
A. mearnsii Amauroderma rude (Berk.) Root rot Doidge et al., 1953;
G. H. Cunn. Roberts, 1957
Botryosphaeria dothidea Stem canker Roux et al., 1997a, b
Calonectria indusiata Leaf spot Browne, 1968; Bakshi,
1976
Camptomeris albizziae Leaf spot Bakshi, 1976
C. verruculosa Leaf spot "
Ceratocystis albofundus Wilt, die-back, gummosis, Wingfield et al., 1996
stem cankers (Ceratocystis
wilt)
Cylindrocladium theae Leaf spot, cankers Lenné, 1992; Crous &
Wingfield, 1994
Coniophora arida (Fr.) Sherry, 1971
Karst.
Corticium salmonicolor Pink disease Roberts, 1957; Browne,
1968; Bakshi, 1976;
Lenné, 1992
Cylindrocladium Damping-off, stem cankers Roux &Wingfield, 1997
candelabrum
C. scoparium Root disease Doidge et al., 1953;
Browne, 1968; Bakshi,
1976; Crous et al., 1991
Dothiorella pithyophilla Stem canker Panneerselvam et al.,
Sacc. 1975
Ganoderma applanatum White mottled heart rot Browne, 1968; Bakshi,
1976
C. scoparium Root disease Doidge et al., 1953;
Browne, 1968; Bakshi,
1976; Crous et al., 1991
27
Acacia species Fungal taxon Associated References
disease/symptoms
A. mearnsii Dothiorella pithyophilla Stem canker Panneerselvam et al.,
Sacc. 1975
Ganoderma applanatum White mottled heart rot Browne, 1968; Bakshi,
1976
G. lucidum Root rot, white spongy rot Browne, 1968; Sherry,
1971; Bakshi, 1976;
Gorter, 1977
G. rugosum Collar rot Luckhoff, 1964;
Gibson, 1964
Glomerella acaciae Anthracnose Hodges, 1964
Hydnum henningsii Bres. Wood rot Roberts, 1957
Irpex subvinosus Browne, 1968
Lasiodiplodia theobromae Collar rot Stephens &
Goldschmidt, 1938;
Lenné, 1992
Macrophomina phaseolina Root rot Browne, 1968; Bakshi,
1976
Oidium sp. Powdery mildew Sherry, 1971
Phoma herbarum Wilt and die-back Olembo, 1972
Phytophthora nicotianiae Black butt/root rot Zeijlemaker, 1971
Physalospora abdita Die-back, stem canker Browne, 1968; Bakshi,
1976
Polystictus hirsutus Fr. Roberts, 1957
Poria albobrunnea Browne, 1968
Rhizoctonia lamellifera Wilt & die-back (Albert Gibson, 1964;
Falls Disease), root rot Luckhoff, 1964
R. solani Web blight, defoliation Lenné, 1992
28
Acacia species Fungal taxon Associated References
disease/symptoms
A. mearnsii Schizophyllum commune Wood rot Ledeboer, 1946
Stereum ostrea (Fr.) Fr. Heart rot Browne, 1968; Bakshi,
1976
Stigmina verrucuiosa Syd. Leaf spot Doidge et al, 1953
Uromyciadium acaciae Leaf spot, branch and stem Browne, 1968; Bakshi,
distortions 1976; Dick, 1985
U aipinum Rust Morris & Wingfield,
1988
U notabiie Galls, leaf drop, die-back Browne, 1968; Dick,
1985
U tepperianum Galls Browne, 1968; Bakshi,
1976
29
11.0 REFERENCES
Ahmad, N. (1987). Current potentially dangerous diseases of plantation trees and ornamental trees
in Malaysia. Forest Pests and Diseases in Southeast Asia. Biotrop Special Publication No. 26.
Anonymous. (1992). Forestry in South Africa. The Promotion Committee, Forestry Council,
Pretoria, South Africa.
Anonymous. (1996). Tree Talk. SA Forestry, July/August, 5.
Anonymous. (1997). South African wattle extract, a natural product. Wattle Industry Centre,
Pietermaritzburg and Union Co-operative Limited, Dalton, South Africa.
Bakshi, B.K (1957). Fungal diseases of Khair (Acacia catechu Willd.) and their prevention. Indian
Forester 85,41-46.
Bakshi, B.K (1976). Wattles - Acacia spp. In Forest Pathology: Principles and practice in
forestry. F.KI. Press., pp 191-194, Forest Research Institute and Colleges, Dehra Dun, India.
Barari, S. (1993). Attack of Ganoderma on Acacia auriculiformis and Acacia mangium. Indian
Forester 119, 765.
Barnes, R.D., Filer, D.L. & Milton, S.J. (1996). Acacia karroo - Monographs and annotated
bibliography. Oxford Forestry Institute, Department of Plant Sciences. University of Oxford.
England.
Bega, R.V. (1979). Heart and root rot fungi associated with deterioration of Acacia koa on the
island of Hawaii. Plant Disease Reporter 63, 682-684.
Bertus, A.L. (1961). Fungi recorded on the leaves, stems, flowers and fruits of forest trees in
Ceylon. Ceylon Forester N S. 5, 101-113.
30
Boucher, C. (I978). Black wattle. In Plant invaders, beautiful but dangerous (ed. C.H. Stirton),
pp. 48-51. The Department of Nature and Environmental Conservation of the Cape Provincial
Administration, Cape Town.
Browne, F.G. (1968). Pests and diseases offorest plantation trees. Clarendon Press, Oxford.
Carr, lD. (1976). The South African Acacias. 323pp. Johannesburg Conservation Press.
Carroll, G. (1988). Fungal endophytes in stems and leaves: from latent pathogen to mutualistic
symbiont. Ecology 69,2-9.
Chen, W., Gardner, D.E. & Webb, D.T. (1996). Biology and life cycle of Atelocauda 'koae, an
unusual demicyclic rust. Mycoscience 37, 91-98.
Clark, N.B., Balodis, v., Fang G. & Wang J. (1991). Pulping properties of tropical Acacias.
AC/AR Proceedings No. 35, 138-144.
Crous, P.W. & Wingfield, MJ. (1994). A monograph of Cylindrocladium, including anamorphs of
Calonectria. Mycotaxon LI, 341-435.
Crous, P.W., Phillips, A.lL. & Wingfield, M.l (1991). The genera Cylindrocladium and
Cylindrocladiella in South Africa, with special reference to forest nurseries. South African Forestry
Journal 157, 69-85.
Davidson, L. & Jeppe, B. (1981). Acacias: A .field guide to the identification of the species of
Southern Africa. 121pp. Centaur Press, Johannesburg.
Dick, M. (1985). Uromycladium rusts of Acacia. Forest Pathology in New Zealand. (ed. P.D.
Gadgil), Forest Research Institute, Rotorua, No. 15.
Doidge, E.M., Bottomley, A.M., van der Plank, lE. & Pauer, G.D. (1953). A revised list of plant
diseases in South Africa. Department of Agriculture, South Africa. Science Bulletin no. 346
31
Evans, J. (1992). Plantationforestry in the Tropics. Clarenden Press, Oxford.
Fisher, P.l, Petrini, O. & Sutton, B.C. (1993). A comparative study of the fungal endophytes in
leaves, xylem and bark of Eucalyptus nitens in Australia and England. Sydowia 45, 338-345.
Florence, E.lM. & Balasundaran, M. (1991). Occurrence of pink disease on Acacia auriculiformis
in Kerala. Indian Forester 117, 494-496.
Gardner, D.E. (1978). Koa rust, caused by Uromyces koae, in Hawaii volcanoes national park.
Plant Disease Reporter 62,957-961.
Gardner, D.E. (1991). Atelocauda angustiphylloda N. SP., a microcyclic rust on Acacia koa in
Hawaii. Mycologia 83,650-653.
Gibson, LAS. (1964). The impact of disease on forest production in Africa. FAO/IUFRO
Symposium on Internationally Dangerous Forest Diseases and Insects, Oxford, July 1964.
Gibson, LAS. (1975). The Leguminosae. In Diseases of forest trees widely planted as exotics in
the tropics and Southern Hemisphere. Part I. Important members of the Myrtaceae, Leguminosae,
Verbenaceae and Meliaceae (ed. LAS. Gibson), pp. 21-34, Commonwealth Forestry Institute,
University of Oxford: Oxford.
Gorter, G.lA (1977). Index of plant pathogens and the diseases they cause in cultivated plants in
South Africa. Department of Agricultural Technical Services, South Africa. Science Bulletin 392.
Haigh, H. (1993). Growing black wattle. Forestry Development, Department of Water Affairs and
Forestry, Pretoria. Extension Leaflet 1/93 (15).
Harsh, N.S.K., Soni, K.K. & Tiwari, C.K. (1993). Ganoderma root-rot in an Acacia arboretum.
European Journal of Forest Pathology 23,252-254.
32
Hodges, G.S. (1964). Seed and seedling diseases of forest trees of the world. FAO/IUFRO
Symposium on Internationally Dangerous Forest Diseases and Insects, Oxford, July 1964.
Hodges, C.S. & Gardner, D.E. (1984). Hawaiian forest fungi. IV. Rusts on endemic Acacia
species. Mycologia 76,332-349.
Howard, A.L. (1920). Timbers of the world. Macmillan and Co. (Ltd.), St. Martin's Street,
London.
Ito, S. & Nams, L.H. (1997). Survey of heart rot on Acacia mangium in Sabah, Malaysia. Japan
International Research Center for Agricultural Sciences. JARQ 31, 65-71.
Kapp, G.B., Beer, J. & Lujan, R. (1997). Species and site selection for timber production on farm
boundaries in the humid Atlantic lowlands of Costa Rica and Panama. Agroforestry Systems 35,
139-154.
Karnik, M.G., Bhatia, K., Dev, I. & Lal, J. (1971). Acacia catechu (Khair) sap wood: lts possible
commercial utilization. Indian Forester 97, 537-541.
Kihiyo, V.B. & Kowero, G.S. (1986). Some economic aspects of the wattle industry in Tanzania.
Journal of World Forest Resource Management 2, 57-62.
Kotzé, JJ. (1935). Forest fungi: The position in South Africa. British Empire Forestry
Conference, South Africa, 1935. The Goverment Printer, Pretoria.
Larsen, M.l, Lombard, F.F. & Hodges, C.S. (1985). Hawaiian forest fungi V. A new species of
Phellinus (Hymenochaetaceae) causing decay of Casuarina and Acacia. Mycologia 77, 345-352.
Laughton, E.M. (1937). The incidence of fungal disease on timber trees in South Africa. South
African Journal of Science, xxxm, 377-382.
Ledeboer, M.S.l (1940): Schizophyllum commune as a wound parasite: A warning to wattle
growers. Journal of the South African Forestry Association 13, 39-40.
33
Lee S.S. (1993). Diseases. In Acacia mangium. Growing and Utilization. (eds. K Awang & D.
Taylor), pp. 203-223. Winrock International and The Food and Agricultural Organization of the
United Nations, Bangkok: Thailand.
Lee S.S. & Arentz, F. (1995). A possible link between rainfall and heart rot incidence in Acacia
mangium Willd. IUFRO.xx World Congress, Tampere, Finland.
Lenné, LM. (1992). Diseases of multipurpose woody legumes in the tropics: A Review. Nitrogen
Fixing Tree Research Reports 10, 13-16.
Logan, A.F. & Balodis, V. (1982). Pulping and paper making characteristics of plantation-grown
Acacia mangium from Sabah. Malaysian Forester 45,217-236.
Luckhoff, H.A. (1964). Diseases of exotic plantation trees in the Republic of South Africa.
FAO/IUFRO Symposium on Internationally Dangerous Forest Diseases and Insects, OXford, July
1964.
Morris, M.l & Wingfield, M.l (1988). First record of a rust on Acacia mearnsii in Southern
Africa. Transactions of the British Mycological Society 90, 324-327.
Morris, M.l, Wingfield, M.l & de Beer, C. (1993). Gummosis and wilt of Acacia mearnsii in
South Africa caused by Ceratocystisfimbriata. Plant Pathology 42,814-817.
Nixon, KM. (1995). Acacia mangium Willd. A brief overview. Report to Mondi Forests Zululand.
September 1995.
Olembo, T.W. (1972). Phoma herbarum Westend.: A pathogen of Acacia mearnsii de Wild. in
Kenya. East African Agricultural and Forestry Journal Oct., 201-206.
Panneerselvam, S., Subramanian, C.L., Kandaswamy, T.K & Kondas, S. (1975). Dothiorella Stem
canker on Acacia meamsii De Wild. Current Science 44, 788-789.
34
Patil, S.D. & Date, K.G. (1980). Teliospore germination and nuclear behaviour in Ravenelia
tandonii Syd. on Acacia catechu Willd. Current Science 50, 546-547.
Roberts, K. (1957). A list of fungi collected in wattle plantations. Report of the Wattle Research
Institutefor 1956-1957,26-28.
Ribeiro, I.J.A., Ito, M.F., Filho, O.P. & De Castro, J.L. (1988). Gomose da Acácia-negra eausada
por Ceratocystisfimbriata Ell. & Halst. Bragantia Campinas 47, 71-74.
Ross, lH. (1979). A conspectus of the African Acacia species. (ed. D.J.B. Killick). Department of
Agricultural Technical Services, Botanical Research Institute, Pretoria.
Rout, G.R., Samantaray, S. & Das, P. (1995). Somatic embryogenesis and plant regeneration from
callus culture of Acacia catechu - a multipurpose leguminous tree. Plant Cell, Tissue and Organ
Culture 42, 283-285.
Roux, J. (1996). A preliminary study of the diseases of Acacia mearnsii de Wild. in South Africa.
M.Sc. thesis. University of the Orange Free State, Bloemfontein, South Africa.
Roux, J. & Wingfield, MJ. (1997). Survey and virulence of fungi occurring on diseased Acacia
mearnsii in South Africa. Forest Ecology and Management 99, 327-336.
Roux, J, Wingfield, MJ. & Morris, M.l (1997). Botryosphaeria dothidea as a pathogen of Acacia
mearnsii in South Africa. South African Journal of Science 93, xii.
Saayman, H.M. & Oatley, lA. (1976). Wood adhesives from wattle bark extract. Forest Products
JournaI26,27-33.
Shearer, B.L., Tippett, LT. & Bartle, lR. (1987). Botryosphaeria ribis infection associated with
death of Eucalyptus radiata in species selection trials. Plant Disease 71, 140-145.
35
Sherry, S.P. (1971). The Black Wattle (Acacia mearnsii de Wild.) University of Natal Press,
Pietermaritzburg, South Africa.
Smith, H., Kemp, G,HJ. & Wingfield, MJ. (1994). Canker and die-back of Eucalyptus in South
Africa caused by Botryosphaeria dothidea. Plant Pathology 43, 1031-1034.
Smith, H., Wingfield, MJ. & Petrini, O. (1996). Botryosphaeria dothidea endophytic in Eucalyptus
grand is and Eucalyptus nitens in South Africa. Forest Ecology and Management 89, 189-195.
Smith, H., Wingfield, MJ., Crous, P.W. & Coutinho, T.A. (1996). Sphaeropsis sapinea and
Botryosphaeria dothidea endophytic in Pinus spp. and Eucalyptus spp. in South Africa. South
African Journal of Botany 62, 86-88.
Stephens, RP. & Goldschmidt, W.B. (1938). A preliminary report on some aspects of wattle
pathology. Journal of the South African Forestry Association 2,30-43.
Stein, ID. (1983). Insects associated with Acacia koa seed in Hawaii. Environmental Entomology
12, 299-302.
Stone, IK. & White, IF. (1997). Biodiversity of endophytic fungi. In Measuring and monitoring
biological diversity: standard methods for fungi (eds. G.M. Mueller, G.F. Bills, A.Y. Rossman &
H.R. Burdsall). Smithsonian Institution Press, Washington D.C.
Suharti, M. (1980). Penelitian pendahuluan penyakit karat pada Acacia auriculiformis A. Cunn.
(Preliminary study on rust disease of Acacia auriculiformis A. Cunn.). Lembaga Penelitian Hutan,
Bogor, August 1980. Laporan no. 347.
Supriana, N. & Natawiria, D. (1987). Forest pests and diseases in Indonesia. Southeast Asian
Regional Centre for Tropical Biology, Bogor, Indonesia. Biotrop Special Publication no. 26.
Swart, W.I., Wingfield, MJ. & Knox-Davies, P.S. (1987). Factors associated with Sphaeropsis
sapinea infection of pine trees in South Africa. Phytophylactica 19,505-510.
36
Turnbull, lW. (1991). Advances in Tropical Acacia Research. Proceedings of an international
workshop held in Bangkok, Thailand, 11-15 February 1991. AC/AR Proceedings No. 35.
Wang, H. & Fang, Y. (1991). The history of Acacia introductions to China. In Advances in
Tropical Acacia Research. Proceedings of an international workshop held in Bangkok, Thailand,
11-15 February 1991. pp.64-66. AC/AR Proceedings No. 35.
Wiersum, K.F. & Ramlan, A. (1982). Cultivation of Acacia auriculiformis on Jaya, Indonesia.
Commonwealth Forestry Review 61, 135-144.
Wingfield, M.l & Kemp, G.H.J. (1993). Diseases of Pines, Eucalyptus and wattles. In Forestry
Handbook (ed. H.A. Van der Sijde), The South African Association of Forestry, Pretoria, South
Africa.
Wingfield, M.l, De Beer, C., Visser, C.D. & Wingfield, B.D. (1996). A new Ceratocystis species
defined using morphological and ribosomal DNA comparisons. Systematic and Applied
Microbiology 19, 191-202.
Zakaria, M. (1990). Diseases offorest plantation species in Peninsular Malaysia. Proceedings of the
IUFRO workshop on Pests and diseases of forest plantations in the Asia-Pacific region. Bangkok,
1990. RAPA Publication: 1990/9.
Zeijlemaker, F.C.l (1971). Black-butt disease of black wattle caused by Phytophthora nicotianiae
var. parasitica. Phytopathology 61, 144-145.
Zwolinski, lB., Swart, M.J & Wingfield, M.l (1990). Economic impact of post-hail outbreak of
die-back induced by Sphaeropsis sapinea. European Journal of Forest Pathology 20, 405-411.

38
2
GENETIC VARIATION IN THE WILT PATHOGEN,
CERA TOCYSTIS ALBOFUNDUS, IN SOUTH AFRICA
ABSTRACT
Ceratocystis albofundus is a serious wilt pathogen of Acacia mearnsii in South Africa
where it kills large numbers of trees each year. Currently, no effective control measures
are available for reducing losses due to this pathogen. Recent success with clonal
propagation of A. mearnsii has raised hopes of being able to select disease tolerant clones
for future planting. The durability of disease tolerance in these clones will depend strongly
on the genetic diversity of C. albofundus in South Africa. The aim of this study was to
determine the genetic diversity of the C. albofundus population in South Africa. Isolates
were collected from a number of geographic regions, focusing on the commercial A.
mearnsii growing areas. Total genomic DNA was extracted for each isolate and restricted
with Pstl for determination of nuclear DNA diversity and HaelII for mitochondrial
diversity. The resultant Pstl fragments were probed with a radioactively labeled 15bp
oligonucleotide marker (CAT)5. For the mitochondrial DNA the RFLP's were scored
directly without probing. Nei's gene diversity (H) was determined for both methods and
compared with published values for other Ceratocystis species. A distance matrix was
developed for each technique using UPGMA and Neighbor-joining. The C. albofundus
population was found to have a high level of both nuclear and mitochondrial gene diversity
when compared with other Ceratocystis spp. These results support the hypothesis that C.
albofundus is native to South Africa. Data also suggest that selection and breeding for
disease tolerance will be complicated by genetic variation in the pathogen.
39
INTRODUCTION
The genus Ceratocystis sensu stricto Ell. & Halst. includes some of the most serious plant
pathogens known (Wingfield, Seifert & Webber, 1993). Fungi in this genus range from
aggressive primary pathogens to opportunistic secondary invaders of stressed plants (Kile,
1993). Some of the more serious diseases caused by Ceratocystis spp. or their Chalara
(Corda) Rabenh. anamorphs include black rot of sweet potato (Halsted, 1890), oak wilt
(French & Stienstra, 1978), canker and wilt of stone fruits (De Vay, Davidson & Moller,
1968), canker and rot of coffee and rubber (Upadhyay, 1981) and canker and wilt of
Nothofagus sp. (Kile & Walker, 1987).
Ceratocystis albofundus De Beer, Wingfield & Morris causes Ceratocystis wilt (wattle
wilt) of Acacia mearnsii de Wild. in South Africa (Morris, Wingfield & De Beer, 1993;
Wingfield et al., 1996b). The fungus results in rapid wilting and die-back of trees, leading
to death within a few weeks (Morris et al., 1993; Roux, Wingfield & Dunlop, 1998).
Ceratocystis wilt was first recorded in 1989 from the KwaZulu-Natal Midlands where A.
mearnsii trees were found dying of an unknown cause. Since then, regular outbreaks of
the disease have been reported (Roux & Wingfield, 1997).
Ceratocystis albofundus has been described only from South Africa and is suspected to be
endemic to the country. The only other records of this fungus are from Protea gigantea
L., from the Mpumalanga Province in 1977 (Gorter, 1977) and a collection from P.
cynaroides near Pretoria (pREM44932). These two records were of C. fimbriata Ell. &
Halst., but a re-examination has shown that the specimens resemble C. albofundus. Thus,
both specimens have perithecia with the light coloured bases with dark necks that
distinguish C. albofundus from C. fimbriata (Wingfield et al. 1996b) .
.No control measures are currently available for the management of wattle wilt caused by
C. albofundus. In an effort to reduce losses caused by diseases, a breeding and selection
programme has been initiated. This is focused strongly on selection of trees that have
40
outstanding growth and other quality characteristics, including tolerance to Ceratocystis
wilt. To ensure durability in crop resistance, a knowledge of the pathogen population is
needed (Wolfe & Caten, 1987; McDonald, 1997; Milgroom & Fry, 1997). Thus,
pathogens with more variable populations will be most likely to adapt to disease tolerant
planting stock (McDonald & McDermott, 1993). This is especially true in situations
where the host plants have very little genetic variation (McDonald & McDermott, 1993).
A recent technique described for determining the genetic variation within and between
populations of ascomycetous fungi, is the use of synthetic oligonucleotides as probes.
These probes are used to hybridize to variable number tandem repeat (VNTR) loci found
in the micro satellite DNA regions of the genome (Jeffreys, Wilson & Swee, 1985; Kistler,
Momol & Benny, 1991; DeScenzo & Harrington, 1994; Haymer, 1994). These
micro satellite regions are useful for studying population diversity since they have a higher
level of variation than coding regions of the genome and are not influenced by codon bias
or selection (Haymer, 1994; Akagi et aI., 1996). One such mini-sattelite probe is (CAT)5
which has been found to detect restriction fragment length polymorphisms (RFLP's) in a
wide variety of organisms, including Basidiomycetes and Ascomycetes (DeScenzo Sc .
Harrington, 1994). This probe is also effective in quantifying gene diversity across
different species (Harrington, Steimel & Kile, 1998). (CAT)5 is a 15 base pair
oligonucleotide which enables its use with in-gel hybridization techniques. It was shown
to reproducibly detect large numbers of hypervariabie loci in Heterobasidion annosum
(Fr.:Fr.) Bref, Ophiostoma piliferum (Fr.:Fr.) Syd. and Leptographium wagneri
(Kendrick) M.l Wingfield (DeScenzo & Harrington, 1994). It has also been used with
success to show the differences in genetic variation between outcrossing, selfing and
asexual species of Ceratocystis (Harrington et al., 1998).
The detection of mt DNA polymorphisms has been refined greatly by the development of
rapid methods to obtain restriction patterns. It is possible to isolate total genomic DNA to
use restriction enzymes that specifically digests the GC-rich nuclear DNA. Restriction
enzymes HaelII, CfoI and MspI have proven very successful for a number of fungal
41
genera, recogruzmg the sites GGCC and GCGC respectively (Lacourt et al., 1994;
Wingfield, Harrington & Steimel, 1996a; Harrington et aI., 1998) This leaves AT-rich
fragments of mtDNA that can be visualized directly with ethidium bromide staining of
agarose gels (Freeman, Pham & Rodriques, 1993; Wingfield et aI., 1996a). These
methods have been useful in studies of intraspecific polymorphisms in a range of fungi,
providing valuable knowledge about plant pathogenic populations (Milgroom·& Lipari,
1993; Lacourt et al., 1994; Harrington et al., 1998).
The objective of this study was to determine the genetic diversity of a population of C.
albofundus isolates. This would enable us to re-consider the hypothesis that the fungus
might be native to South Africa. Furthermore, it would reflect the durability in tolerance
that might be expected from clones of A. mearnsii. This goal was achieved by considering
nuclear and mitochondrial DNA diversity of isolates of C. albofundus.
MATERIALS & METHODS
Isolates
The 49 isolates used in this study were obtained from dying A. mearnsii trees throughout
South Africa (Fig. 1; Table 1). Isolations were made from diseased trees using the carrot
slice technique described by Moller & De Vay (1968). Each isolate originated from a
different tree and was transferred from a single drop of ascospores on one perithecium.
All isolates are maintained in the culture collection· (CMW numbers) of the Forestry and
Agricultural Biotechnology Institute (FABI), University of Pretoria, and in the culture
collection of T.C. Harrington, Iowa State University. Results for C. albofundus were
compared with published data for three other Ceratocystis spp. (Harrington et aI., 1998),
since no other populations of C. albofundus exist.
The three Ceratocystis spp. chosen for comparison with C. albofundus were selected on
the grounds of their reproductive strategies. Ceratocystis eucalypti Yuan & Kile is an
42
obligate outcrossing fungus, producing perithecia only when two strains of opposite
mating types are crossed. It is a weak, wound colonizing pathogen of Eucalyptus spp. in
Australia and it is also reported to be native to that country (Kile et aI., 1996). The
second species, Chalara australis Walker & Kile, is an asexually reproducing fungus also
native to Australia. It has only one mating type (MAT-2) and causes a serious wilt disease
of Nothofagus cunninghamii (Hook.) Oerst. (Kile & Walker, 1987; Harrington et al.,
1998). Ceratocystis vireseens (Davids) C. Moreau causes sap streak disease of maple
(Acer spp.), tulip poplar (Liriodendron tulipifera) and other hardwoods in the U.S.A. It
has two mating types, with one of the mating types capable of unidirectional mating type
switching and thus selfing (Harrington & McNew, 1997).
DNA Extraction
Total genomic, high molecular weight DNA was extracted from all isolates by culturing
them in 20 ml of liquid media (2 % malt extract, 1 % yeast extract) in 250 ml Erlenmeyer
flasks. Flasks were kept at room temperature for 10 days. Cells were collected using
vacuum filtration through 1mm Whatmann filter paper and care was taken to remove all
the agar. The harvested cells were ground to a fine powder in liquid nitrogen with a
mortar and pestle. Ten ml of extraction buffer (lOO mM Tris-HCI, pH 8.0; 50 mM
EDTA, pH 8.0; 500 mM NaCl, 1.25% SDS; 10 mM l3-mercaptoethanol; 4 mM
spermidine; 1 mM spermine; 1 mM PMSF), maintained at 65°C, was added to each
isolate. The resultant slurry was transferred to a sterile centrifuge tube and stored at -
20°C until all samples were ready for further processing.
Samples were incubated in a water bath at 65°C for 60 min with frequent mixing.
Potassium acetate (0.4 volumes of 5 M stock) was added to each sample and the samples
incubated on ice for 20 min. The supernatant was collected by centrifugation for 15 mi. at
17 000 RPM at 4°C. Ice cold isopropanol (0.58 volumes) was added to the supernatant
of each sample in a 30 ml glass Corex tube. Tubes were placed at -20°C overnight. The
43
resultant pellets were collected by centrifugation for la min at la 000 rpm's and 4°C,
after which they were washed with la ml of 70% ethanol for la min on ice.
Pellets were collected by centrifugation at la 000 RPM for la min and air dried in a fume
hood at room temperature after which they were resuspended in 1000 Jll of sterile distilled
water for 60 min at 37°C. Samples were transferred to 1.5 ml Eppendorf tubes and
centrifuged at la 000 RPM for la min. The supernatant, containing the DNA, was
collected in sterile 1.5 ml Eppendorf tubes and the DNA concentrations were determined
using a TKO fluorometer and then stored at -20°C.
DNA restrictions
Restriction digests of the total genomic DNA was done using 25 ug of DNA at 37°C for
15-20 hours, or overnight. Restrictions were carried out in a total volume of 500 ul
containing DNA, laX buffer, spermidine (1 mM), water and the specific enzyme, Hae III
or Pst 1(5 U/Jlg genomic DNA) (GIBCO BRL). Rnase (A 1.35 un/ul + T 37 un/ul) was
added after 2 hours to remove the RNA.
Samples were precipitated with NaC1 (0.2 M) and 2 volumes of 100 % cold ethanol for 45
min at -20°C. Pellets were collected by centrifugation at 12000 rpm's for 3 min and then
washed in 800 JlI of 70% ethanol for 20 min on a rotary shaker. The samples were again
centrifuged at 12 000 rpm's for 3 min and the pellets dried in a speed vac for -30 min or
until dry. Pellets were resuspended in sterile water at 37°C to a concentration ofO.2 Jlg/JlI
and stored at -20°C.
Separation of fragments
For the separation of fragments, 2 ug of restricted DNA was loaded onto 1% Agarose
(Biorad analytical grade) gels in IX TBE. Gels were run at 88 volts for 17.5 hours with
constant stirring for Pstl gels and at 80V for 17 hours for HaellI gels. Lanes 1 and 20
44
contained A. HindIII DNA (lug) (GmCO BRL) as molecular marker and samples were
loaded into lanes 2-19. Gels were stained for -15 min in ethidium bromide on a rotary
shaker, washed in water for -30 min and visualized under UV light. Successful genomic
DNA gels were dried using a gel drier for 60 min at 50°C. They were then sealed between
sheets of plastic, enclosed in tin foil and stored at 4°C until further use. Mitochondrial
DNA gels were photographed and analyzed from these images.
(CAT)s hybridization
In-gel hybridization was performed by rinsing gels for 45 min in 250 ml denaturing
solution (0.5 M NaOH; 1.5 M NaCl) on a rotary shaker. Denaturation was followed by
rinsing for 45 min in 250 ml neutralizing solution (1.0 M Tris, pH 8.8; 1.5 M NaCl). Gels
were washed for 20 min in 250 ml water and then placed in Church's solution (250 mM
Na2HP04 - NaH2P04, pH 7.4; 7% SDA; 1 mM EDTA; 1% BSA) for 2 hours at 42°C
on a shaker. The p32 labeled (CAT)5 probe was added to the hybridization mix and
incubated for 16-18 hours or overnight. Probes were prepared by end labeling 50 ng of .
(CAT)5 with 50 IlCi of 32p_dCTP using terminal deoxynucleotidyl transferase (GIPCO
BRL). The reaction was done at 37°C for 1 hour and stopped by adding 50 III of Buffer
EB (QIAGEN). Unincorporated nucleotides were removed by spin column
chromatography with Sephadex G25/80 (Sigma). Purified probe was added directly to the
Church's hybridization solution and hybridization was carried out for 16-18 hours at 42°C
with continuous shaking:
For the labeling of the HindIII marker the Prime-a-Gene Labeling System (pROMEGA)
was used. Labeled marker was prepared in a total volume of 50 III containing 5 Units of
Klenow DNA Polymerase I (SUI Ill), 50 IlCi p32, 5X labeling buffer, unlabelled DNTP's
(dGTP, dTTP, dATP), Nuclease free BSA and A. HindIII marker. The marker was
denatured before adding it to the reaction mixture. The reaction mixture was incubated at
37°C for 1 hour before the volume was adjusted to 100 III with QIAGEN elution buffer
45
and spun through a Sephadex G25/80 column. Labeled marker was then denatured again
and added to the gels with the labeled (CAT)5 probe.
The probe solution was removed and gels were washed for 45 mm with 6X SSC
(Prepared from 20X SSC stock: 3 M NaCl; 0.3 M Na-citrate-Zfl-O; pH 7) on a rotary
shaker. This SSC was replaced with fresh SSC and again washed for 45 min. Gels were
then washed in 5X SSC for 45 min and wrapped between two layers of plastic. Gels were
visualized in two ways. They were either exposed to Kodak X-ray film for one week or to
a Phosho Imager Screen for 1-2 days, depending on the strength of the probe.
Gel analysis
Nuclear DNA
Each unique band was scored as either present (1) or absent (0) for each isolate tested.
Band sizes were determined using the programme GelReader 2.0.5 (NCSA, University of
Illinois, Champagne, Urbana, IL). The procedure was repeated for all isolates and only
bands that were clearly visible in all runs were scored. Nei's (1973) gene diversity (H)
was calculated and a distance matrix and dendogram compiled using Neighbor-joining and
the Unweighted Pair-Group Mean Arithmetic Analysis (upGMA) (Felsenstein, 1993).
Data obtained for C. albofundus were compared with published data for C. virescens, C.
eucalypti and Chalara australis (Harrington et al. 1998). Although only a small number
of isolates were available per geographic area, gene diversity values were also calulated
for each area separately.
Mitochondrial DNA
For the analysis of bands generated from the RFLP's using HaelII, no probing was
necessary. All bright bands, larger than 2kb in size, were scored. Band sizes were
determined using GelReader. The procedure was repeated for each isolate. The gene
46
diversity (H) was determined and the data obtained for C. albofundus were compared with
those published by Harrington et al. (1998) for C. virescens, C. eucalypti and Chalara
australis. Gene diversity values were also calculated for each geographic area to
determine the influence of geographic distribution on the population diversity.
RESULTS
Nuclear DNA diversity
The (CAT)s markers were highly variable for C. albofundus (Fig. 2) when compared to
published results for the other Ceratocystis spp. (Table 2). For C. albofundus, 47 of the
50 loci scored were found to be polymorphic. Harrington et al. (1998) found only 2 of22
loci polymorphic for the asexual Ch. australis; 17 of 19 loci polymorphic for the
obligately outcrossing C. eucalypti and an intermediate level of variation, 1 of 4 loci, for
the homothallic C. virescens. Values for C. albofundus are thus most similar to those of
C. eucalypti.
A total of 37 phenotypes were found for the 37 isolates of C. albofundus tested for
nuclear diversity. This is higher than that published for any of the Ceratocystis spp. for
which similar values are available. The closest similarity was again with C. eucalypti,
showing 9 phenotypes from 10 isolates. For C. vireseens 2 phenotypes were found in 16
isolates and for Ch. australis, 3 phenotypes were seen in 30 isolates (Harrington et al.,
1998). The average gene diversity (H) of the (CAT)s markers for C. albofundus was
0.2137. This is higher than values for Ch. australis (0.0111) or C. vireseens (0.0935), but
lower than those ofC. eucalypti (0.3747) (Harrington et al., 1998).
Gene diversity values for individual plantations were similar to those for the country as a
whole (Table 2). When considering gene diversity values for individual plantations, the
results suggest that the total diversity is based not only on diversity between plantations,
but also on diversity within plantations. Values for individual plantations were similar to
47
those of the entire South African population, with the highest value found for the Vryheid
area (0.282).
Phylograms obtained from the UPGMA and Neigbor-joining analysis of the distance
matrix produced after scorring of the bands, show a tendency for isolates from different
plantations to group together in clusters (Fig. 3). Most clusters consisted of isolates from
more than one geographic area. Results suggests a migration of isolates between different
geographic areas in South Africa. Data obtained from UPGMA and Neighbor-joining
supported each other.
Mitochondrial DNA diversity
Variation in the mitochondrial DNA of C. albofundus (Fig. 4) was much higher than that
of any of the three Ceratocystis spp. with which it was compared (Table 3). Forty-one of
the 46 scored bands were polymorphic for C. albofundus. For the obligate outcrossing
fungus, C. eucalypti, only 9 of33 bands were polymorphic, while for Ch. australis 1 of28
and for C. vireseens only 13 of 40 were polymorphic (Harrington et al., 1998).
For C. albofundus 30 different phenotypes were found for the 31 isolates tested. As with
the nuclear DNA, C. eucalypti showed the most similar values, with 6 different
phenotypes from 10 isolates. Ceratocystis virescens, which has a similar mating strategy
to that of C. albofundus, had only 10 different phenotypes in 16 different isolates. For the
asexual Ch. australis, only 2 different phenotypes were found from 30 isolates.
The average gene diversity value for C. albofundus, using the Hae III marker was 0.249.
In contrast, the average diversity value for C. eucalypti, which is reported to be native to
Australia, was only 0.1115, while for C. vireseens a value of 0.0928 was reported. The
lowest value (0.0023) was again found for Ch. australis (Harrington et al., 1998).
48
Phylograms showed a grouping of isolates from different geographic areas in most clusters
(Fig. 5). Genetic diversity for individual plantations was also similar to that for the
country as a whole (Table 3). Mitochondrial data thus also show a mixing of genes
between different areas in South Africa.
For the Ha III digests, isolate CMW4084 from Dalton grouped with isolate CMW4758
from Umtata. These two areas are approximately 400 kilometers apart, the one occurring
in a plantation of a commercial A. mearnsii growing area and the other originating from
an area with only "jungle" stands of A. mearnsii (Fig. I). Isolates CMW4093 and
CMW4094 from East London in the Eastern Cape province and isolate CMW4105 from
Piet Retief in the South Eastern Mpumalanga Province group together (Fig. I). Isolate
CMW4102 from Piet Retief originated from a commercial plantation, approximately 700
km distant from East London, where isolates originated from "jungle" stands.
DISCUSSION
Recently established populations are expected to have small effective population sizes and
low levels ofmtDNA diversity (Ellstrand & Elam, 1993; Milgroom & Lipari, 1993). The
size of the founder population of C. albofundus is unknown and it is also not known if
this fungus was introduced or is endemic to South Africa. Results obtained in this study
show a level of nuclear and mtDNA diversity higher than those of any of the other three
species to which C. albofundus was compared. This includes C. eucalypti and Ch.
australis, which are thought to be native fungi in Australia (Kile et al., 1996) and are thus
expected to have relatively high levels of genetic diversity. The high gene diversity,
together with the reports of C. albofundus from indigenous Protea. spp. (Gorter, 1977;
Wingfield et aI., 1996b), supports the hypothesis that C. albofundus is native to South
Africa.
Genetic diversity is influenced by the mode of reproduction of the organism, mutation,
gene flow, genetic drift and selection (Kohn et al., 1988; McDonald & McDermott,
49
1993; Milgroom & Fry 1997). High levels of genetic diversity in C. albofundus could
thus be attributed to a number of factors, including its capacity for sexual reproduction.
Organisms capable of sexual reproduction have been found to have a higher degree of
genetic diversity than organisms that reproduce asexually (McDonald & McDermott,
1993; Wolf & McDermott, 1994; Milgroom, 1996). Ceratocystis albofundus has two
mating types, a .MAT-l (self-sterile) requiring outcrossing and a MAT-2 (self-fertile)
which is capable of selting (De Beer, 1994; Harrington & McNew, 1997). This
phenomenon has been shown for C. virescens, which has a similar reproduction system to
C. albofundus. Ceratocystis vireseens has an intermediate level of genetic diversity when
compared to strictly outcrossing and strictly asexual species (Harrington et aI., 1998).
The same situation could thus also have been expected for C. albofundus. The fact that
C. albofundus has nuclear DNA diversity values higher than those for C. vireseens.
despite its similar reproductive strategy, strongly suggests that it is either native to South
Africa, or has been in the country for an extended period of time.
Nuclear DNA diversity data for C. albofundus is supported by high levels of
mitochondrial diversity in the fungus population. Sexual reproduction and outcrossing
does not influence mitochondrial diversity (Taylor, 1986; Milgroom & Lipari, 1993;
Harrington et aI., 1998). Mitochondrial diversity suggests that a population has been in
existence for many years, or that it has not gone through a genetic bottle neck, such as an
introduction into a new environment (Harrington et al., 1998). The maternal and haploid
inheritance of mtDNA makes this more sensitive than nuclear DNA to severe reductions
in the number of individuals in a population of .organisms, such as those caused by
introductions to new areas (Cann, Stoneking & Wilson, 1987).
High levels of mitochondrial diversity could be attributable to a high mutation rate and
large effective population sizes (Taylor, 1986). Most mutations in animal mtDNA take
place through point mutations or nucleotide substitutions or deletions (Taylor, 1986). In
fungi, it has been shown that a high number of length mutations (due to insertions and
deletions) occur in the mitochondria (Taylor, 1986). In the U.S.A., Cryphonectria
50
parasitica (Murrill) Barr, is an introduced fungus with an extremely high mtDNA
diversity and it is hypothesized that the high level of diversity is due to high mutation
rates (Milgroom & Lipari, 1993). Observations on the occurrence of C. albofundus in
the colder areas of South Africa (winter temperatures below 0 °C), however, strongly
suggest that this fungus is a temperate species, unlike most other Ceratocystis spp., and
that it is native to South Africa.
Although gene diversity values for the nuclear and mitochondrial DNA of C. albofundus
are low when compared to the values provided by Nei (1973) for a diverse population (0
= clonal; 1 = diverse), results obtained in this study provide further support for the
hypothesis that this pathogen may be native to South Africa. It has higher diversity values
than those of other endemic Ceratocystis spp. (Harrington et al., 1998) and its only
known hosts include species of the native genus Protea.
As with any breeding programme, care should be taken in the clonal propagation of A.
mearnsii in South Africa. Ceratocystis wilt tolerant trees and clones should be monitored
continuously and new disease tolerant clones should be produced on a regular basis.
Surveys to find more alternative hosts for C. albofundus, both native or introduced, will
also continue in the future with the aim of unequivocaly determining the origin of this
unique fungus in South Africa.
51
REFERENCES
Akagi, H., Yokozeki, Y., Inagaki, A. & Fujimura, T. (1996). Microsattelite DNA markers
for rice chromosomes. Theoretical and Applied Genetics 93, 1071-1077.
Cann, RL., Stoneking, M. & Wilson, C. (1987). Mitochondrial DNA arid human
evolution. Nature 325,31-36.
De Beer, C. (1994). Ceratocystis .fimbriata with special reference to its occurrence as a
pathogen of Acacia mearnsii in South Africa. M. Sc. thesis. University of the Orange
Free State, Bloemfontein, South Africa.
DeScenzo, R.A. & Harrington, T.C. (1994). Use of (CAT)s as a DNA fingerprinting
probe for fungi. Phytopathology 84, 534-540.
DeVay, lE., Davidson, RW. & Moller, W.l (1968). New species of Ceratocystis
associated with bark injuries on deciduous fluit trees. Mycologia 60, 635-641.
Ellstrand, N.C. & Elam, D.R (1993). Population genetic consequences of small
population size: Implications for plant conservation. Annual Review of Ecology and
Systematics 24,217-242.
Felsenstein, J. (1993). PHYLIP (phylogeny Inference Package) Version 3.5p. University
of Washington, Seattle.
Freeman, S., Pham, M. & Rodriguez, RJ. (1993). Molecular genotyping of
Colletotrichum species based on arbitrarily primed PCR, A + T rich DNA and nuclear
DNA analyses. Experimental Mycology 17, 309-322.
.e.v.S. B1B[10TEEK
52
French, D.W. & Stienstra, W.e. (1978). Oak wilt. Agricultural Extension Service,
University of Minnesota. Extension Folder 310.
Gorter, G.lA (1977). Index of plant pathogens and the diseases they cause in cultivated
plants in South Africa. Department of Agricultural Technical Services, South Africa.
Science Bulletin 392.
Halsted, B.D. (1890). Some fungus diseases of sweet potato. New Jersey Agricultural
College Experiment Station, Bulletin 76, 7-14.
Harrington, T.C. & McNew, D.L (1997). Self-fertility and uni-directional mating type
switching in Ceratocystis coerulescens, a filamentous ascomycete. Current Genetics 32,
52-59.
Harrington, T.e., Steimel, lP. & Kile, G. (1998). Genetic variation in three Ceratocystis
species with outcrossing, selfing and asexual reproductive strategies. European Journal
of Forest Pathology 28,217-226.
Haymer, D.S. (1994). Random amplified polymorphic DNA's and microsatellites: What
are they, and can they tell us anything we don't already know? Annals of the
Entomological Society of America 87, 717-722.
Jeffreys, Al, Wilson, V. & Swee, L.T. (1985). Hypervariabie "minisatellite" regions in
human DNA Nature 314,67-73.
Kile, G.A (1993). Plant diseases caused by species of Ceratocystis sensu stricto and
Chalara. In Ceratocystis and Ophiostoma. Taxonomy, Ecology and Pathogenicity.
(eds. M.l Wingfield, K.A Seifert & JF. Webber), pp. 173-183. APS Press, St. Paul,
Minnesota.
53
Kile, G.A. & Walker, K. (1987). Chalara australis sp. nov. (Hyphomycetes), a vascular
pathogen of Nothofagus cunninghamii (Fagaceae) in Australia and its relationship to
other Chalara species. Australian Journal of Botany 35, 1-32.
Kile, G.A., Harrington, T.C., Yuan, Z.Q., Dudzinski, M.l. & Old. K.M. (1996).
Ceratocystis eucalypti sp. nov., a vascular stain fungus from eucalypts in Australia.
Mycological Research 100, 571-579.
KistIer, H.C., Momol, E.A. & Benny, U. (1991). Repetitive genomic sequences for
determining relatedness among strains of Fusarium oxysporum. Phytopathology 81,331-
336.
Kohn, L.M., Petsche, D.M., Bailey, S.R., Novak, L.A. & Anderson, r.s. (1988).
Restriction fragment length polymorphisms in nuclear and mitochondrial DNA of
Sclerotinia species. Phytopathology 78, 1047-105l.
Lacourt, I., Panabiéres, F., Marais, A., Venard, P. & Ricei, P. (1994). Intraspecific
polymorphism of Phytophthora parasitica revealed by analysis of mitochondrial DNA
restriction fragment length polymorphism. Mycological Research 98, 562-538.
McDonald, B.A. (1997). The population genetics of fungi: Tools and Techniques.
Phytopathology 87,448-453.
McDonald, B.A. & MeDermott, J.M. (1993). Population genetics of plant pathogenic
fungi. Bioscience 43, 311-319.
Milgroom, M.G. (1996). Recombination and the multilocus structure of fungal
populations. Annual Review of Phytopathology 34,457-477.
54
Milgroom, M.G. & Fry, W.E. (1997). Contributions of population genetics to plant
disease epidemiology and management. Advances in Botanical Research 24, 1-30.
Milgroom, M.G. & Lipari, S.E. (1993). Maternal inheritance and diversity of
Mitochondrial DNA in the Chestnut Blight fungus, Cryphonectria parasitica.
Phytopathology 83, 563-567.
Moller, W.J. & De Vay, lE. (1968). Carrot as a species-selective isolation media for
Ceratocystisfimbriata. Phytopathology 58, 123-126.
Morris, M.l, Wingfield, M.l & De Beer, C. (1993). Gummosis and wilt of Acacia
mearnsii in South Africa caused by Ceratocystis fimbriata. Plant Pathology 42, 814-817.
Nei, M. (1973). Analysis of gene diversity in subdivided populations. Proceedings of the
National Academy of Science, USA 70, 3321-3323.
Roux, J. & Wingfield, MJ. (1997). Survey and virulence of fungi occurring on diseased
Acacia mearnsii in South Africa. Forest Ecology and Management 99, 327-336.
Roux, L, Wingfield, M.l & Dunlop, R. (1998). Susceptibility of elite Acacia mearnsii
families to Ceratocystis wilt in South Africa. Journal of Forest Research. In Press.
Taylor, lW. (1986). Fungal evolutionary biology and mitochondrial DNA. Experimental
Mycology 10, 259-269.
Upadhyay, HP. (1981). A monograph of Ceratocystis and Ceratocystiopsis. University
of Georgia Press.
Wingfield, B.D., Harrington, T.C. & Steimel, J. (1996a). A simple method for detection
of mitochondrial DNA polymorphisms. Fungal Genetics Newsletter 43, 56-60.
55
Wingfield, M.l, Seifert, K.A. & Webber, LF. (1993). Ceratocystis and Ophiostoma.
Taxonomy, Ecology and Pathogenicity. APS Press, St. Paul, Minnesota.
Wingfield, MJ., De Beer, C., Visser, C.D. & Wingfield, B.D. (1996b). A new
Ceratocystis species defined using morphological and ribosomal DNA comparisons.
Systematic and Applied Microbiology 19, 191-202.
Wolfe, M.S. & Caten, C.E. (1987). Populations of plant pathogens. Blackwell Scientific
Publications.
Wolfe, M.S. & MeDermott, I.M. (1994). Population geneties of plant pathogen
interactions: The example of the Erysiphe graminis-Hordeum vulgare pathosystem.
Annual Review of Phytopathology 32,89-113.
56
Table 1. List of Ceratocystis albofundus isolates from wilted Acacia mearnsii, used to
determine genetic diversity in South Africa.
Culture number a Origin b Collector
CMW4059 - CMW4068 Bloemendal, KZN J. Roux & T.C. Harrington
CMW 4069 - CMW4078 Vryheid, KZN J. Roux & T.C. Harrington
CMW4079 - CMW4085 Dalton, KZN J. Roux & T.C. Harrington
CMW4087 - CMW4090 " "
CMW4092 - CMW4096 East London, EC MJ. Wingfield & T.C. Harrington
CMW4097 Cintsa, EC "
CMW4102 Bloemendal, KZN J. Roux
CMW4103 Dalton, KZN "
CMW4104 " "
CMW4105 Piet Retief, MP "
CMW4106 " "
CMW4107 Vryheid, KZN J. Roux & T.C. Harrington
CMW4109 Bloemendal, KZN J. Roux
CMW4110 Bloemendal, KZN "
CMW4757 Umtata, EC J. Roux & M.J. Wingfield
CMW4758 " "
CMW4905 Kataza, KZN M.J. Wingfield
CMW4906 " "
a CMW numbers represent cultures maintained in the culture collection of the Tree
Pathology Co-operative Programme (TPCP), Forestry and Agricultural Biotechnology
Institute (FABI), University of Pretoria, South Africa.
b All isolates were collected from diseased Acacia mearnsii in South Africa (Fig. I). KZN
refers to the KwaZulu-Natal Province, EC to the Eastern Cape Province and MP to the
Mpumalanga Province.
57
Table 2: Number of phenotypes, polymorphic loci and average gene diversity in
Ceratocystis albofundus based on DNA fingerprinting with Pst! restrictions and the 15bp
oligonucleotide probe, (CAT)5. Results for C. albofundus are compared to the published
data ofHarrington et al. (1998).
Species Number of Number of Number Number of Genetic
Isolates Phenotypes of Loci Polymorphic diversity
Loci (li)
C. albofundus 38 38 50 47 0.2137
C. eucalypti 10 9 19 17 0.3747
C. vireseens 16 2 4 1 0.0935
Chalara australis 30 3 22 2 0.0111
C. albofundus
Bloemendal 12 12 36 27 0.202
Dalton 12 12 40 35 0.258
Vryheid 8 8 37 30 0.282
Piet Retief 2 2 22 7 0.159
East London 4 4 27 20 0.278
58
Table 3: Number of phenotypes, polymorphic loci and average gene diversity in
Ceratocystis albofundus based on RFLP's after restrictions with HaelII. Results for C.
albofundus are compared to the published data of Harrington et al. (1998).
Species Number of Number of Number Number of Genetic
Isolates Phenotypes of Loci Polymorphic diversity
Loci (li)
C. albofundus 31 30 46 41 0.249
C. eucalypti 10 6 33 9 0.1115
C. vireseens 16 10 40 13 0.0928
Chalara australis 30 2 28 1 0.0023
C. albofundus
Bloemendal 9 9 36 26 0.251
Dalton 9 9 33 22 0.207
Vryheid 7 7 40 33 0.296
Piet Retief 2 2 26 13 0.125
East London 2 1 18 0 0
59
Figure 1: Map of South Africa showing areas from which C. albofundus has been
reported. Reports from the commercial A. mearnsii areas are indicated with (*), reports
from jungle stands are indicated with (D) and reports made from Protea spp. are indicated
with (a).
* Cemmerei 'al growi'ng areas
D Jungle stands
a Protea spp.
o0\
61
Figure 2: Nuclear fingerprint of C. albofundus, generated by probing PstI restrictions
with CAT 5. Lanes 1 and 20 are HindIII digested Lambda marker.
......
.~
~
Bloemendal cx:: Kataza
.~ Umtata
p.,
23.
6.6
4.1
2.3
2.0
63
Figure 3: Phylogram of UPGMA cluster analysis of genetic distance matrixes of C.
albofundus isolates after probing nuclear DNA with (CAT)5. In the legends the letters
refer to the area from which the isolate was obtained, while the numbers refer to the
CMW number of the isolate. BLOEM refers to isolates obtained from Bloemendal,
DALTO are isolates from Dalton, VRYHE represents isolates from Vryheid, EASTL
represents isolates from East London and POTG represents isolates from Piet Retief
64
BLOEM4063
I/BLOEM4067
BLOEM4064
BLOEM4102
BLOEM4062
DALT04089
DALT04081 DALT04084
BLOEM4065
VR).'HE4107 DALT04103DALT04080
DALT04085
EASTL4095
VRYHE4070 EASTL4093 • VRYHE4077
YHE40
)\ n
BLOEM4066 EASTL4094 EASTL4092 ~DALT0409Q
DALT04082 BLOEM41l0 DALT04104
DALT04079
65
Figure 4: Mitochondrial fingerprints of C. albofundus, generated by HaelII restrictions
of total genomic DNA. Lanes 1 and 20 are HindIII digested Lambda marker.
do
]
o
.....:l
Bloemendal Dalton Vryheid
23.1
9.6
6.6
4.1
2.3
2.0
67
Figure 5: Phylogram of UPGMA cluster analysis of genetic distance matrixes of C.
albofundus isolates after restriction with HaelII. In the legends the letters refers to the
area from which the isolate was obtained, while the numbers refer to the CMW number of
the isolate. BLOEM refers to isolates obtained from Bloemendal, DALTO are isolates
from Dalton, VRYHE represents isolates from Vryheid, EASTL represents isolates from
East London, KATA isolates are from Kataza, UMTAT isolates from Umtata and POTG
represents isolates from Piet Retief
68
l~~~~;:7BL5OE8M4063
DALT04104 b tBLOEM4102.
BLOEM4065 VRYHE4072
DALT04090
-...,-- EASTL4093
EASTL4094
DALT04110 __ ~_-::7 VRYHE4077
DALT04081 DALT04080 BLOEM41~pB/LOEM4060 DALT04103 ·VRYHE4078
KATA490S ·PIETR4106
DALT04087
BLOEM4064

70
3
CERA TOCYSTIS FIMBRIA TA AND CHALARA ELEGANS,
PATHOGENIC ON ACACIA MEARNSII IN SOUTH AFRICA
ABSTRACT
Ceratocystis albofundus causes a serious wilt disease of exotic Acacia mearnsii in South
Africa. During the course of a recent country-wide survey of A. mearnsii showing
symptoms of wattle wilt, two unusual fungal isolates were collected. Both isolates were
associated with typical symptoms of wattle wilt, such as a streaked appearance of the
infected timber. These fungi also had Chalara anamorphs, typical of Ceratocystis species.
They were, however, clearly different from C. albofundus and from each other. The aim·
of this study was to identify the two fungi, based on morphology and rDNA sequence
comparisons. Their relative pathogenicity to A. mearnsii seedlings was also tested in
greenhouse studies. The one fungus, which produced a Ceratocystis teleomorph, was
identified as a typical isolate of C. fimbriata, which is a well-known pathogen of woody
plants, but has not previously been reported from South Africa. The second fungus was
identified as Chalara elegans, which is a well-known pathogen of root crops in South
Africa and elsewhere. Both fungi cause rapid death of susceptible seedlings after
inoculation and I believe that they played a major role in the demise of the trees from
which they were isolated.
71
INTRODUCTION
The genus Ceratocystis sensu stricto Ell. & Halst. includes many important plant
pathogens that cause disease on a wide range of plant species. Species of Ceratocystis
have been described as pathogens of sugarcane (Abbot, 1964), oak (French & Stienstra,
1978), maple (Beil & Kenneth, 1979), Gmelina arborea Roxb. (Muchovej, Albuquerque
& Ribeiro, 1978), poplar (Gremmen & de Kam, 1978), sweat potato (Halsted, 1890),
pimento (Leather, 1966), fruit trees (DeVay, Davidson & Moller, 1968), Acacia mearnsii
de Wild. (Wingfield et al., 1996), coffee and rubber (pontis, 1951; Upadhyay, 1981) and
many other plant species (Hunt, 1956; McDonald & Hindal, 1981; Wingfield, Seifert &
Webber, 1993). In the past, Ceratocystis was collectively treated with Ophiostoma, which
also represents an important genus of tree pathogens (Wingfield et aI., 1993). However, it
is now generally accepted that Ceratocystis forms a discrete group of fungi that are
phylogenetically distinct from Ophiostoma (Huasner & Reid, 1993; Samuels, 1993;
Spatafora & Blackwell, 1994).
Ceratocystis species typically have Chalara (Corda) Rabenh. asexual states (Crone &
Bachelder, 1961; Hinds, 1972; Perry, 1991; Rosseto & Ribeiro, 1991; Nag Raj &
Kendrick, 1993; Wingfield et aI., 1993). There are also Chalara species that cause
diseases of plants and for which sexual states are not known. A contemporary view,
primarily based on sequence data, is that the latter fungi belong in Ceratocystis (Wingfield
et aI., 1993; Witthuhn et al., 1998a). Chalara spp. are pathogens of both hardwood trees
and agricultural crops and cause diseases ranging from root rots to vascular stains (Nag
Raj & Kendrick, 1975; Wills & Lambe, 1978; Yarwood, 1981; Specht & Griffon, 1985;
Kile, 1993).
One of the best known pathogenic Chalara spp. is Chalara elegans Nag Raj & Kendrick
[Syn. Thielaviopsis basicola (Berk. & Br.) Ferr.] which is a serious pathogen of tobacco
(Gayed, 1972), carrot (Chittaranjan, 1994), cotton (Mauk & Hine, 1988) and many other,
mostly herbaceous, plants (Nag Raj & Kendrick, 1975; Wingfield et aI., 1993). Chalara
72
elegans can also cause root rot and death of Japanese holly (Ilex sp.) and affects woody
hosts such as citrus and black locust (Lambe & Wills, 1978a, 1978b; Yarwood, 1981;
Sinclair, Lyon & Johnson, 1996). Other, highly pathogenic Chalara spp. include Ch.
neocaledoniae Kiffer & Delon that causes important wilt diseases of Coffea robusta
Linden and Psidium guajava L. (Kile, 1993) and Ch. australis Walker & Kile which
causes a severe wilt disease of Nothofagus cunninghamii (Hook.) Oerst in Tasmania (Kile
& Walker, 1987).
Ceratocystis spp. and their Chalara anamorphs are well adapted to dispersal by insects.
These adaptations include sticky spores borne on long necked perithecia or conidiophores
and the production of aromatics, which attract insects. These insects then transmit the
spores to freshly wounded plant tissue (Lanza, Ko & Palmer, 1976; French & Stienstra,
1978; Juzwik & French, 1983; Kile, 1993; Christen, Meza & Revah, 1997). Many
possible insect vectors have been described for Ceratocystis spp. Ceratocystis
fagacearum (Bretz) Hunt, the oak wilt pathogen, is vectored by sap-feeding beetles in the
family Nitidulidae (French & Stienstra, 1978; Juzwik & French, 1983). Nitidulid beetles
have also been reported as the vectors of C. fimbriata f platani Walter (Crone &
Bachelder, 1961). A number of other species of Ceratocystis have been found to be
vectored by insects in the families Rhizophagidae, Staphylinidae and Drosophilidae (Hinds,
1972). The exceptions are a number of Ceratocystis spp. on conifers that are vectored by
bark beetles (Mathre, 1964; Upadhyay, 1981; Redfurn, Stoakley & Steele, 1987;
Wingfield, Harrington & Solheim, 1997). The role of insects in Ceratocystis
dissemination may be direct, through feeding on and.crawling over fungal mats, or indirect
by kicking frass, contaminated with fungal spores, from galleries (Kile, 1993).
Pathogenic Ceratocystis spp. can act in several ways to cause disease and death of plants.
Vascular wilt pathogens, such as C. fagacearum, may cause physical blockage of the
vascular tissue or may act by the production of toxins and hydrolytic enzymes, as well as
the disruption of hormonal regulation (Kile, 1993). Blockage of vascular tissues take
place by stimulating the production of tyloses that occlude the vessels, thus reducing water
73
movement within the plant (MacDonald & Hindal, 1981). Many of the phloem, pith and
primary xylem cells are also plugged with hyphae (Zalasky, 1965). Chalara elegans
produces methyl acetate, which acts as a phytotoxin and causes the swelling of cell walls
and the discolouration of plant tissue (Kile, 1993).
Very few Ceratocystis and Chalara spp. have been reported from Africa. Reports include
C. paradoxa (Dade) C. Moreau from pineapple, sugarcane and banana (Doidge et al.,
1953; Gorter, 1977), Ch. elegans from chicory, peanuts and tobacco (Doidge et aI.,
1953; Gorter, 1977) and C. albofundus Wingfield, De Beer & Morris from Protea
gigantea and an unidentified Protea sp. (Hunt, 1956; Gorter, 1977; Upadhyay, 1981).
Ceratocystis albofundus has also been described as a serious pathogen of Acacia mearnsii
de Wild. (Wingfield et al., 1996) and is known only from South Africa.
Acacia meamsii (black wattle) is the third most commonly planted forestry tree in South
Africa and forms an important component of a major industry in the country. Acacia
mearnsii, however, suffers from a serious wilt disease caused by C. albofundus (Morris,
Wingfield & De Beer, 1993). Symptoms include rapid wilt and die-back (Fig. I ), stem
cankers (Fig. 2) and xylem discolouration (Fig. 3) of affected trees (Morris et aI., 1993).
Initial reports of this disease described the causal agent as C. fimbriata, but this was later
found to be incorrect (Wingfield et aI., 1996).
During recent surveys of diseased A. meamsii in Cape Town (Western Cape Province)
and Vryheid (KwaZulu-Natal Province), isolates of two unusual fungi with Chalara
anamorphs were found associated with vascular discolouration. One fungus produced a
typical Ceratocystis teleomorph, while the other produced only anamorphic structures.
The aim of this study was to identify these fungi based on morphology and DNA sequence
data. Furthermore, with pathogenicity tests we considered the role of these two fungi in
diseases of A. mearnsii.
74
MATERIALS AND METHODS
Isolates
Isolates from A. mearnsii were collected from two mature trees in South Africa. The
isolate from Vryheid (CMW4IOI) was collected from the stump of a recently' harvested
tree. This stump showed extensive discolouration of the xylem, with the streaked and
flared discolouration commonly associated with Ceratocystis diseases (Fig. 4). Isolate
CMW4690 from the Company Gardens in Cape Town was collected from a mature A.
mearnsii tree showing wilt and die-back symptoms and extensive cracking and gummosis
on the main stem. The sample was obtained from discoloured xylem, also with a streaked
appearance. All isolates were grown on 2% Malt extract agar (MEA) (20 gIL Biolab malt
and 15 gIL Biolab agar) amended with 0.1% streptomycin sulfate (Sigma) in Petri dishes
at room temperature for morphological studies, DNA isolation and pathogenicity trials.
Morphological comparisons
Isolates collected from A. mearnsii were examined morphologically using a Zeis Axioskop
light microscope. For the sexual structures, perithecial characteristics such as
morphology, colour, shape, ornamentation, arrangement of ostiolar hyphae, ascospore
shape and ascus size were noted. The morphology of chlamydospores in culture was also
recorded. For asexual structures, conidial shape, shape and size of conidiogenous cells
and the presence or absence of chlamydospores was recorded.
DNA Sequence comparisons
Polymerase chain reactions (PCR) were performed directly from mycelial scrapes from
Petri dishes without the extraction of DNA (Harrington & Wingfield, 1995). Primers
ITS 1 and ITS4 were used to amplify the ITS region of the ribosomal RNA operon. The
sequence for ITSI IS 5'TCCGTAGGTGAACCTGCGG3' and for ITS4 is
75
5'TCCTCCGCTTATTGATATGC3' (White et aI., 1990). Initial denaturation was
performed at 96°C for 5 min, after which the temperature was lowered to 90°C until the
PCR polymerase (Expand™, Boehringer Mannheim, South Africa) had been added.
Primer annealing took place at 55°C for 30 sec, chain elongation at 72°C for 1 min and
denaturation at 92°C for 1 min. These steps were repeated for 35 cycles. Final chain
elongation was at 72°C for 5 min, followed by 2 min at 37°C. The PCR products were
visualized under UV light on 1% agarose gels containing ethidium bromide.
DNA sequencing
The PCR fragments were purified using the Nucleon™ Qc kit for PCR/oligo clean up
(Amersham Life Sciences) and a QIAquick PCR purification Kit (Quiagen, Germany).
Sequence reactions were carried out with an ABI PRlSMTM Dye Terminator Cycle
Sequencing Kit with Amplitaq® DNA polymerase, FS (perkin-Elmer, Warrington, UK).
An ABI PRlSMTM 377 DNA autosequencer (perkin-Elmer) was used for the sequencing.
The sequences were aligned manually by the insertion of gaps. All phylogenetic
relationships among species were determined using PAUP (Phylogenetic Analysis Using
Parsimony) (Swofford, 1985) and bootstrap analysis (bootstrap confidence intervals on
DNA parsimony) (Felsenstein, 1988). Data obtained from the sequencing of the two A.
mearnsii isolates were compared with data obtained from Genbank as well as from
Wingfield et al. (1996) and Witthuhn et al. (1998a, b) (Table I). The two unknown
isolates were also compared to C. albojundus from A. mearnsii. Petriella setifera
(Schmidt) Curzi. was used as an outgroup.
Pathogenicity trials
Isolates CMW4690 (Chalara), CMW4101 (Ceratocystis) and CMW4908 (c. albojundus)
were used in glasshouse inoculation trials on A. mearnsii. Isolates were grown on 2 %
MEA amended with 0.1% streptomycin sulfate for 2 weeks prior to inoculation.
76
Glasshouse conditions were set with day/night lighting, with the average daily temperature
at 24/25°C and night temperature at approximately 20°C.
Ten Acacia mearnsii seedlings were inoculated for each isolate tested. A small wound (5
mm diam.) was made in the stem of each seedling by removing the bark and exposing the
cambium. Mycelial plugs, of similar size, overgrown with the test fungi, were Placed into
each wound, mycelium towards the cambium. All wounds were closed with parafilm to
prevent desiccation of the inoculum and wounds. For control inoculations, sterile MEA
plugs were used as inoculum and inserted into the stems of five wounded trees. Lesion
lengths were assessed after four weeks and statistical differences in lesion length for each
isolate were determined using Tukey's studentised range test (P=O.05). Re-isolations
were made from the lesions produced, to confirm that the lesions were caused by the
inoculated fungi.
RESULTS
Morphological comparisons
Isolate CMW 4101 produced both sexual and asexual structures in culture. Perithecia
were characterized by black, un-ornamented globose bases and black necks (Fig. 5) with
convergent ostiolar hyphae (Fig. 6). Ascospores were hat-shaped and accumulated in
slimy drops at the tips of the perithecial necks. Chlamydospores, globose to sub-globose
in shape, were produced either singly or in short chains. These characteristics are typical
of C. fimbriata. Isolate CMW4690 did not produce a sexual state in culture and was
characterized by thallic chlamydospores (Fig. 7), usually with 4 or more transverse septa.
Phialides had typical cylindrical collarettes that gave rise to hyaline conidia that were
cylindrical in shape and extruded in chains (Fig. 8). Morphological characteristics were
typical of Ch. elegans.
77
Analysis of DNA sequence data
Both strands of the lTS region of the rRNA operon of the isolates used in this study were
sequenced. Sequences for isolates from A. mearnsii were aligned manually with Genbank
data for Ceratocystis spp. A total of 559 characters were aligned for the analysis (Fig. 9),
after the insertion of gaps. A heuristic search using the no branch swapping option in
PAUP generated a single tree (Figure la). Values for the consistency index (Cl),
homoplasy index (Ill) and retention index (RI) were 0.817, 0.183 and 0.867 respectively.
The Ceratocystis isolate from A. mearnsii grouped with C. fimbriata isolates from sweet
potato and plane trees. The Chalara isolate from A. mearnsii grouped with Ch. elegans,
separate from other Chalara species. Sequence data comparisons, therefore, confirmed
morphological studies that showed that one of the A. mearnsii isolates represented C.
fimbriata and the other Ch. elegans.
Pathogenicity trials
Ceratocystis albofundus (CMW4908) produced the largest lesions on A. mearnsii
seedlings (Ave. 77.4 mm). The next most virulent isolate was Ch. elegans (Ave. 52.4
mm) and the least virulent isolate was C. fimbriata (Ave. 42.6 mm) (Fig. 11). All isolates
produced lesions significantly larger than those of the control inoculation (Ave. 14.6 mm)
(Fig. 12) (P=0.05). Re-isolation from diseased material consistently yielded the
inoculated fungi. Lesions were characterized by death of the bark and streaking of the
xylem. Susceptible seedlings showed signs of wilt and die-back before the experiment was
terminated.
78
DISCUSSION
This study investigated two unusual fungal isolates associated with wilt of A. mearnsii in
South Africa. The one isolate was shown to be typical of C. fimbriata and represents the
first unequivocal record of C. fimbriata from the country. Previous reports of this fungus
on Protea spp. (Gorter, 1977) and A. mearnsii (Morris et al., 1993) were later' shown to
represent the related, but distinct C. albofundus (Wingfield et al., 1996). There is
precedence for finding C. fimbriata on Acacia spp., since a report of this fungus from A.
decurrens Wendl. in Brazil was made in the late 1980's (Ribeiro et al., 1988).
The discovery of Ch. elegans associated with vascular discolouration and wilting of A.
mearnsii is intriguing. This fungus is mostly known as an important pathogen of root
crops (Gayed 1972; Yarwood, 1981; Kile, 1993) and graft failures (Longrée, 1940).
Surveys of diseased A. mearnsii in South Africa during the course of the past 10 years
have consistently yielded C. albofundus. The appearance of C. fimbriata and Ch. elegans
was unusual. Although these fungi have each appeared only once on single wilting trees,
the fact that they were both able to cause disease in pathogenicity tests suggests that their
discovery is significant, and that they are both worthy offurther study.
The best known Ceratocystis sp. in South Africa, associated with disease of a woody host
is C. albofundus, the cause of wattle wilt of A. mearnsii (Morris et al., 1993; Wingfield et
al., 1996). This fungus can lead to the death of susceptible trees within six weeks after
inoculation. It also has a wide geographic distribution in South Africa (Roux et al., 1998;
Chapter 2). Although C. albofundus was initially confused with C. fimbriata, it has very
distinctive morphological characteristics, distinguishing it from this closely related species.
Typical C. albofundus isolates have light coloured perithecial basis and dark necks (Fig.
13). Perithecia are also characterized by having divergent ostiolar hyphae (Fig. 14),
compared to the typically convergent ostiolar hyphae and dark perithecial basis of C.
fimbriata (Fig. 5, 6). Morphological characteristics of the species collected from A.
mearnsii in this study, place this fungus firmly in C. fimbriata.
79
Chalara elegans has been reported from a wide range of hosts and has a cosmopolitan
distribution (Wills & Lambe, 1978; Yarwood, 1981; Kile, 1993). The host range of this
fungus includes, among others, birch, citrus, poinsettia, American elm, Japanese holly and
black locust (Lambe & Wills, 1978a, 1978b; Yarwood, 1981; Sinclair et al., 1996).
Chalara elegans is reported to be most infectious in non-lignified or slightly lignified
tissue, especially in the Solanaceae, Leguminosae and Cucurbitaceae (Kile, 1993). It can
saprophytically colonize the roots of various plant hosts, either directly or through
wounds, and is known to survive in the soil by the formation of chlamydospores (Gayed,
1972; Wick & Moore, 1983). Symptoms on A. mearnsii from which Ch. elegans was
isolated resemble those described for other pathogenic Chalara and Ceratocystis spp.
from woody hosts. These include wilt, stem cankers and streaking of the xylem (Kile &
Walker, 1987). The fact that the Ch. elegans is most likely a Ceratocystis anamorph
might suggest that this report from A. mearnsii is not unusual. Additional isolations from
diseased trees in future might lead to the appearance of the fungus on other trees.
Very few Chalara spp. are known to cause diseases of woody plants. Those that have
been reported include Chalara australis, Ch. neocaledoniae, Ch. thielaviodes Peyr. and
Ch. populi Veldeman ex. Kiffer & Delon (Kile, 1993). Chalara australis causes a serious
wilt of Nothofagus cunninghamii in Australia (Kile & Walker, 1987), while Ch.
neocaledoniae causes vascular stain of coffee and guava in New Caledonia (Kile, 1993).
Chalara populi from Europe causes small cankers on Populus and Salix spp., known as
trunk scab or brown patch disease, while Ch. thielaviodes causes root and stem rots of
Ulmus spp., walnut and peach in Europe, North America and Australia (Lamb, Wright &
Davidson, 1935; Baker & Thomas, 1946; Kile, 1993). Chalara thielaviodes has also
been reported as the cause of graft union failure in several hosts (Longrée, 1940; Baker &
Thomas, 1946; Kile, 1993).
Sequence data from the ITS region of the ribosomal DNA has proven to be most useful
for distinguishing Ceratocystis spp. (Hausner & Reid, 1993; Visser et al., 1995;
Wingfield et aI., 1996; Witthuhn et aI., 1998a; 1998b). Analysis of sequence data from
80
this region has made it possible to confirm the morphological identification of Ch. elegans
and C. fimbriata from A. mearnsii. It has been suggested that C. fimbriata may represent
a complex of many different species (Wingfield et al., 1996). Given the fact that this is the
first time that C. fimbriata has been collected from South Africa it would thus be of
considerable interest to compare the A. mearnsii isolate with isolates from additional hosts
and origins.
Ceratocystis fimbriata and C. albofundus form a sub-clade within Ceratocystis, showing a
close relationship between these two species (Witthuhn et al., 1998b). In a search for the
possible origin of C. albofundus, we have hypothesized that it might be derived from C.
fimbriata. Apart from C. moniliformis (Hedgecock) Moreau, C. fimbriata and C.
albofundus are also the only species of Ceratocystis with hat shaped ascospores. The fact
that both fungi have now been found on the same tree species in South Africa, supports
the view that they are closely related. The isolation of C. albofundus from the temperate
and colder (below O°C winter temp.) areas in South Africa suggests that it could be a
temperate species that has developed from C. fimbriata.
The pathogenicity of C. fimbriata and Ch. elegans to A. mearnsii has been shown in this
study for seedlings under laboratory conditions. Although a close correlation between
greenhouse and field inoculation studies has been shown with C. albofundus (De Beer,
1994), tests in this study should be repeated under field conditions on older trees. Under
laboratory conditions, C. albofundus appears to be the most pathogenic of the three
species, but more isolates of each of them would need to be considered before clear
conclusions can be made regarding the role that each fungus may play in disease.
Although thorough surveys have already been conducted, we believe that it is likely that
more isolates of C. fimbriata and Ch. elegans will be obtained in future surveys.
Comparison of C. fimbriata and Ch. elegans with isolates from other hosts in Africa and
the rest of the world will also be a future priority and will provide knowledge as to the
possible origin of these two fungi from A. mearnsii.
81
REFERENCES
Abbot, E.V. (1964). Black rot. In Sugarcane diseases of the world. Volume II (eds.
c.o. Hughes, E.V. Abbot & C.A. Wismer), pp. 99-101.
Baker, K.F. & Thomas, H.E. (1946). Failure of bud and graft unions of rose induced by
Chalaropsis thielaviodes. Phytopathology 36,281-291.
Beil, lA. & Kenneth, lK. (1979). Sapstreak disease of sugar maple found in New York
State. Plant Disease Reporter 63,436.
Chittaranjan, S. (1994). Factors influencing survival of phialospores of Chalara elegans
in organic soil. Plant Disease 78, 411-415.
Christen, P., Meza, lC. & Revah, S. (1997). Fruity aroma production in solid state
fermentation by Ceratocystis fimbriata: influence of the substrate type and the presence
of precursors. Mycological Research 101, 911-919.
Crone, L.l & Bachelder, S. (1961). Insect transmission of the canker stain fungus,
Ceratocystis fimbriata f platani. Phytopathology 51, 576.
De Beer, C. (1994). Ceratocystis fimbriata with special reference to its occurrence as a
pathogen of Acacia mearnsii in South Africa. M,Sc. thesis. University of the Orange
Free State, Bloemfontein, South Africa.
DeVay, lE., Davidson, R.W. & Moller, W.l (1968). New species of Ceratocystis
associated with bark injuries on deciduous fruit trees. Mycologia 60, 635-641.
82
Doidge, E.M., Bottomley, AM., van der Plank, lE. & Pauer, G.D. (1953). A revised list
of plant diseases in South Africa. Department of Agriculture, South Africa. Science
Bulletin no. 346.
Felsenstein, J. (1988). DNABOOT - Bootstrap Confidence Intervals on DNA parsimony
3.1. University of Washington.
French, D.W. & Stienstra, W.C. (1978). Oak wilt. Extension Folder 310, Agricultural
Extension Service, University of Minnesota.
Gayed, S.K. (1972). Host range and persistence of Thielaviopsis basicola in tobacco soil.
Canadian Journal of Plant Science 52, 869-873.
Gorter, G.J.M.A (1977). Index of plant pathogens and the diseases they cause in
cultivated plants in South Africa. Plant Protection Research Institute, Department of
Agricultural Technical Services, Pretoria, South Africa. Science Bulletin 392.
Gremmen, J. & de Kam, M. (1978). Ceratocystis fimbriata, a fungus associated with
poplar canker in Poland. European Journal of Forest Pathology 7,44-47.
t
Halsted, B.D. (1890} Some fungus diseases of sweet potato. New Jersey Agricultural
College Experiment Station, Bulletin 76, 7-14.
Harrington, T.C. & Wingfield, B.D. (1995). A PCR based identification method for
species of Armillaria. Mycologia 87,280-288.
Hausner, G. & Reid, J. (1993). On the subdivision of Ceratocystis s.f., based on partial
DNA sequences. Canadian Journal of Botany 71,52-63.
83
Hinds, T.E. (1972). Insect transmission of Ceratocystis species associated with Aspen
cankers. Phytopathology 62, 221-225.
Hunt, J. (1956). Taxonomy of the genus Ceratocystis. Lloydia 19, 1-59.
Juzwik, J. & French, D.W. (1983). Ceratocystis fagacearum and C. piceae on the
surfaces of free-flying and fungus-mat-inhabiting nitidulids. Phytopathology 73, 1164-
1168.
Kile, G.A. (1993). Plant diseases caused by species of Ceratocystis sensu stricto and
Chalara. In Ceratocystis and Ophiostoma. Taxonomy, Ecology and Pathogenicity.
(eds. M.l Wingfield, KA. Seifert & lF. Webber), pp. 173-183. APS Press, St. Paul,
Minnesota.
Kile, G.A. & Walker, K (1987). Chalara australis sp. nov. (Hyphomycetes), a vascular
pathogen of Nothofagus cunninghamii (Fagaceae) in Australia and its relationship to
other Chalara species. Australian Journal of Botany 35, 1-32.
Lambe, RC. & Wills, W.R. (1978a). Pathogenicity of Thielaviopsis basicola to Japanese
Holly (!lex crenata). Plant Disease Reporter 62, 859-863.
Lambe, RC. & Wills, W.R. (1978b). Distribution of die-back associated with
Thielaviopsis black root rot of Japanese Holly. Plant Disease 64, 956.
Lamb, R., Wright, E. & Davidson, RW. (1935). A root rot of Chinese Elms.
Phytopathology 25,652-654.
Lanza, E., Ko, KH. & Palmer, J'K. (1976). Aroma production by cultures of
Ceratocystis moniliformis. Journal of Agricultural and Food Chemistry 24, 1247-1250.
84
Leather, RI. (1966). A canker and wilt disease of pimento (Pimenta officinalis) caused
by Ceratocystisfimbriata in Jamaica. Transactions of the British Mycological Society 49,
213-218.
Longrée, K. (1940). Chalaropsis thielaviodes, cause of "black mold" of rose grafts.
Phytopathology 30, 793-807.
Mauk, P.A. & Hine, RB. (1988). Infection, colonization of Gossypium hirsutum and G.
barbadense, and development of black root rot caused by Thielaviopsis basicola.
Phytopathology 78, 1662-1667.
MacDonald, W.L. & Hindal, D.F. (1981). Life cycle and epidemiology of Ceratocystis.
In Fungal wilt diseases of plants. (eds. E.M. Marshall, A.A. Bell & C.H. Beckman), pp.
113-144. Academic Press, New York, USA.
Mathre, D.E. (1964). Survey of Ceratocystis spp. associated with bark beetles In
California. Contributions from Boyce Thompson Institute 22,353-362.
Morris, M.J., Wingfield, MJ. & De Beer, C. (1993). Gummosis and wilt of Acacia
mearnsii in South Africa caused by Ceratocystisfimbriata. Plant Pathology 42,814-817.
Muchovej, J.J., Albuquerque, F.C. & Ribeiro, G.T. (1978). Gmelina arborea - a new
host ofCeratocystisfimbriata. Plant Disease Reporter 62,717-719.
Nag Raj, T.R & Kendrick, W.B. (1975). A monograph of Chalara and allied genera.
Wilfrid Laurier University Press, Waterloo, Ontario, Canada.
85
Nag Raj, T.R. & Kendrick, W.B. (1993). The anamorph as generic determinant in the
holomorph: The Chalara connection in the Ascomycetes, with special reference to the
Ophiostomatoid fungi. In Ceratocystis and Ophiostoma. Taxonomy, Ecology and
Pathogenicity. (eds. M.I Wingfield, K.A. Seifert & IF. Webber), pp 61-70. APS Press,
St. Paul, Minnesota.
Perry, T.I (1991). A synopsis of the taxonomic revisions in the genus Ceratocystis
including a review of blue-staining species associated with Dendroctonus bark beetles.
United States Department of Agriculture, Forest Service, New Orleans. General
Technical Report, SO-86.
Pontis, R.E. (1951). A canker disease of the coffee tree in Colombia and Venezuela.
Phytopathology 41, 178-184.
Redfurn, D.B., Stoakley, IT. & Steele, H. (1987). Die-back and death oflarch caused by
Ceratocystis laricicola sp. nov. following attack by Ips cembrae. Plant Pathology 36,
467-480.
Ribeiro, I.J.A., Fumikoito, M., Filho, O.P. & De Castro, IL. (1988). Gomose da Acacia-
negra eausada por Ceratocystisfimbriata Ell. & Halst. Bragantia Campinas 47, 71-74.
Rosseto, C.I & Ribeiro, I.IA. (1991). Root infection by Ceratocystis fimbriata the
primary cause of tree wilt. XII International Plant. Protection Congress, Rio de Janeiro,
Brazil, August, 1991.
Roux, I, Wingfield, M.I, Bouillette, lP. & Coutinho, T.A. (1998). First report of
Ceratocystis fimbriata from Eucalyptus in the Republic of the Congo in West Afiica.
European Journal of Plant Pathology. Submitted.
86
Samuels, G.J. (1993). The case for distinguishing Ceratoeystis and Ophiostoma. In
Ceratoeystis and Ophiostoma. Taxonomy, Ecology and Pathogenicity. (eds. M.J.
Wingfield, K.A. Seifert & J.F. Webber), pp. 173-183. APS Press, St. Paul, Minnesota.
Sinclair, W.A., Lyon, H.H. & Johnson, W.T. (1996). Diseases of trees and shrubs.
Comstock Publishing Associates, Ithaca, New York.
Spatafora, J.W. & Blackwell, M. (1994). The phylogenetic origins of Ophiostomatoid
fungi. Myeologieal Research 98, 1-9.
Specht, L.P. & Griffon, GJ. (1985). A selective medium for enumerating low populations
of Thielaviopsis basieola in tobacco field soils. Canadian Journal of Plant Pathology 7,
438-44l.
Swofford, D.L. (1985). PAUP Phylogenetic Analysis using Parsimony. Version 2.4.1:
Champaign, Illinois.
Upadhyay, H.P. (1981). A monograph of Ceratoeystis and Ceratoeystiopsis. University
of Georgia Press.
Visser, C., Wingfield, MJ., Wingfield, B.D. & Yamaoka, Y. (1995). Ophiostoma
polonieum is a species of Ceratoeystis sensu stricto. Systematic and Applied
Microbiology 18, 403-409.
White, T.J., Bruns, T., Lee, S. & Taylor, J. (1990). Amplification and direct sequencing
of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A guide to
methods and applications (eds. M.A. Innis, D.H. Gelfand, JJ. Sninsky & TJ. White), pp.
315-322. Academic Press, San Diego, USA.
87
Wick, R.L. & Moore, L.D. (1983). Histopathology of root disease incited by
Thielaviopsis basicola in /lex crenata. Phytopathology 73, 561-564.
Wills, W.R. & Lambe, R.C. (1978). Pathogenicity of Thielaviopsis basicola from
Japanese Holly (/lex crenata) to some other host plants. Plant Disease Reporter 62,
1102-1106.
Wingfield, M.l, Harrington, T.c. & Solheim, R. (1997). Two new species in the
Ceratocystis coeruleseens complex from conifers in western North America. Canadian
Journal of Botany 75,827-834.
. .
Wingfield, M.l, Seifert, K.A. & Webber, lF. (1993). Ceratocystis and Ophiostoma.
Taxonomy, Ecology and Pathogenicity. APS Press, St. Paul, Minnesota.
Wingfield, M.l, De Beer, C., Visser, C. & Wingfield, B.D. (1996). A new Ceratocystis
species defined using morphological and ribosomal DNA sequence comparisons.
Systematic and Applied Microbiology 19, 191-202.
Witthuhn, R.C., Wingfield, B.D., Wingfield, M.l & Harrington, T.C. (1998a). PCR
based identification and phylogeny of species of Ceratocystis sensu stricto. Mycological
Research. In Press.
Witthuhn, R.C., Wingfield, B.D., Wingfield, MJ.; Wolfaardt, M. & Harrington, T.C.
(1998b). Monophyly of the conifer species in the Ceratocystis coeruleseens complex
based on DNA sequence data. Mycologia 90, 96-10l.
Yarwood, c.E. (1981). The occurrence of Chalar a elegans. Mycologia 73,524-529.
Zalasky, H. (1965). Process of Ceratocystis fimbriata infection in aspen. Canadian
Journal of Botany 43, 1157-1162.
88
Table 1: Ceratocystis and Chalara species used In molecular comparisons and in
pathogenicity studies.
SPECIES ISOLATE ORIGIN BOST GENBANK
NUMBER a ACCESSION
NUMBER
Ceratocystis adiposa CMW1622 Japan AF043606
C albofundus CMW4908 South Africa Acacia mearnsii
" CMW2475 East London " AF043605
" PREM51639 KwaZulu-Natal "
" PREM51645 " "
" PREM51829 " "
C. coerulescens C666 Norway Picea abies U75618
C. eucalypti C639 Australia Eucalyptus sieberi U75627
C. fagacearum CMW2651 Iowa, USA Quercus palustris AF043598
Cfimbriata CMW4101 KwaZulu-Natal Acacia mearnsii
" CMW2220 France F. platani AF043604
" PREM51830 Italy P. orientalis
" PREM51831 " "
" PREM51644 France P. hybrida
" C854 USA Ipomoea batatas AF007749
C. moniliformis CMW3782 South Africa Erythrina sp. AF043579
C. paradoxa CMW1546 New Zealand Musa sp. AF043607
C. pinicola CMW1323 England Pinus sp. AF043602
C. vireseens CMW0460 USA Quercus sp. U75624
Chalara australis C619 Australia Nothofagus U75629
cunninghamii
Ch. elegans CMW4690 Cape Town Acacia mearnsii
" C185 USA Pelargonium sp.
Ch. neocaledoniae C694 New Caledonia Coffea robusta U75628
a CMW numbers represent cultures maintained in the culture collection of the Tree
Pathology Co-operative Programme (TPCP), Forestry and Agricultural Biotechnology
Institute (FABI), University of Pretoria, South Africa. The two isolates, C. fimbriata
(CMW4101) and Ch. elegans (CMW4690), presented in bold were used in sequence
comparisons and pathogenicity tests. Data pertaining to the remaining isolates were
derived from Genbank.
C numbers - Culture collection of T.C. Harrington, Department of Plant Pathology, Iowa
State University
PREM - Official designation of the National Collection of fungi, Pretoria, South Africa
89
Figures 1-4: Disease symptoms caused by Ceratocystis albofundus on Acacia mearnsii.
Fig. 1: Wilt and die-back of A. mearnsii after inoculation with C. albofundus.
Fig.2: Stem cankers and gummosis caused by a natural infection of C. albofundus. Note
small cracks exuding gum higher up middle stem.
Fig.3: Xylem discolouration caused by C. albofundus infection.
Fig.4: Streaked appearance of xylem, caused by C. albofundus infection.

91
Figures 5-8: Morphological characteristics of C. fimbriata from A. mearnsii.
Fig. 5: Perithecium with black base and neck, typical of C. fimbriata.
Fig. 6: Convergent ostiolar hyphae of C. fimbriata.
Fig.7: Thallic chlamydospores, typical of Ch. elegans.
Fig.8: Cylindrical conidia produced in chains from phialide.

93
Figure 9: Aligned nucleotide sequences for the ITS region for different species of
Ceratocystis and Chalara. N indicates unknown bases, a dash (-) indicates a gap in' the
sequence alignment and (.) indicates bases identical to those of isolate
ALBOFUNDUS2475.
10 20 30 40 50 60 70
ALBOFUNDUS247s GCTGCCTTG- --GTGGGTG- TCT-G-TAGT GGTGTTAA-C CTCTTTTTAT ----AAGGGG GCAGCCC-AC
ALBOFUNDUSs1829 .. .. .. .. .. .. .. .. .. - -- .. .. .. .. .. .. .. - .. .. .. - .. - ........ ................ - ..
ALBOFUNDUSs164s .................. - -- .............. - ...... - .. - ........ .. .. .. .. .. .. .. .. - .. .................... ---- .. .. .. .. .. ...~
ALBOFUNDUSs1639 .. .. .. .. .. .. .. .. .. - -- .. .. .. .. " .... - .N.-.-.... ................
ACACIA4101 C.ATGTG ..A AC ..ACCCTA ...T.-.... .AGA.G..TG ·.G..-..GG TGGT- ....- ---- ...TT .
FIMBRIATA8s4 -.ATGTG ..A AC ..ACC-TA ...T.-.... .AGA.G..TG ·.G..-..GG TGGT- ....- ---- ...TT .
FIHBRIATA2220 C.ATGTG ..A AC ..ACC-TA ...T.- .... .AGA.G..TG ·.G..-..GG TGGT- ....- ---- ...TT .
FIHBRIATAs1831 ---T--- ..A ---.------ ...T.- .... .AGA.G..TG G.G ..G.-GG TGGT- ..-T. ·--- ...TT.
FIMBRIATAs1830 ---T--- ..A ---.------ ...T.- .... .AGA.G..TG G.G ..G.-GG TGGT- ..-T. ·--- ...TT.
FIMBRIATAs1644 C------ ..A ---.------ ...T.-.... .AGA.G..TG G.G ..G.-GG TGGT- ..-T. ·--- ...TT .
VIRESCENS0460 C.ATATG ..A ACA.ACC-TA .-.------- -------.-G ·.GC-...GG C---- ...-- ------.TTG
EUCALYPTI639 C.ATATG ..A ACA.ACC-T- ...------- -------.-G ·.GC-...GG C---- ...-- ------.TTG
MONILIFORMIS3782 C.ATTTG ..A ATT.-CCACA AACA--.C-- -----G ..-- ·.GCGA..GG C----G ..T- ------.T-.
PARADOXA1s46 C.ATTTG ..A ACT.ACC--T ...-.----- ---------G ·.GC-...GG C---- ...T- ---- ...TTG
ADIPOSA1622 C.ATTTG ..A ACA.ACC-TA ...T-- ..-- ---------- ·.GC-...GG C-GT-- ..T- ----- ..TT.
PINICOLA1323 C.ATATG ..A ACA.ACC-T- .-.T--..-- ---------G ·.GC-...GG C---- ...-- ------.TTG
FAGACEARUM26s1 C.ATTTG ..A ACA.ACC-.A .-.TTT.TT. CTCTAAT.-- ·.GC-...GG C---- ....A ------.TT.
COERULESCENS666 C.ATATG ..A ACA.ACC--T ...------- -------.-G ·.GC-...GG C---- ...-- ------.TTG
NEOCALEDONIA694 C.ATATG ..A ACA.ACC--T . . ---- .. -- ---------G ·.GC-...GG C---- ...-- ------.TTG
AUSTRALIS619 C.ATATG ..A ACA.ACC--T .... ---- ... -- ---------G ·.GC-...GG C---- ...-- ------.TTG
ELEGANS18s C.ATATG ..A AC ..ACC.TT ...------- -------.-G ·.GC-...GG C---- ...T- --- ...--T.
ACACIA4690 C.ATATG ..A -CA.ACCCTT .-.C-- ..-- ---------G ·.GC-...GG C---- ...T- --- ...--T .
PETRIELLA C.CTTTG ..A ACC.TACC-A --.T.T ..-- --....---G .CTCGGC-GG -GGTT ..--- --C-- ..CCA
\.0
~
80 90 100 110 120 130 140
ALBOFUNDUS2475 TACCGC-TAG -CCACC---- ----AGCAGC ATACA--AGT CTTTTACCAC TAT---AAA- C-CTTCTGT-
ALBOFUNDUS51829 · ..... - ...
ALBOFUNDUS51645 · ..... - . .. - ..... ---- .- -
ALBOFUNDUS51639 · ..... - . .. - ..... ---- .- .
ACACIA4101 .-GAAGAG.. GG G--C TGCC - -..--TT -CG G.--- - .T TAT.-
FIHBRIATA854 .-GAAGGG.. GG G--C TGCC - -..--TT --C --- - .T T.---
FHlBRIATA2220 .-GAAGGG-- -- G--C TGCC - -..---T --CG G.--- - .T -----
FIHBRIATA51831 .-GAAG---- -- G--C TGCC - -..---T --CG G.--- - .T -----
FIHBRIATA51830 .-GAAG---- -- G--C TGCC - -..---T --CG G.--- - .T -----
FIMBRIATAS1644 .-GAAGGG-- -- G--C TGCC - -..---T --CG G.--- - .T -----
VIRESCENS0460 GTAACA---- -- ..AGTC-- TGCCG.T ..- -..------- - ----- ------ A .T T.T.T
EUCALYPTI639 GTAACA---- -- ..AGTC-T TGCCG.T ..- ---------- -- ..---- .. ------ - .T T.T--
HONILIFORMIS3782 --.- .. ---- GCCCG ....- - -----G ..-- .T.G.T.T.-
PARADOXA1546 G------G.T T--------- TGCCG.T ..- ---------- ------- ... -.AAC- - .T T----
ADIPOSA1622 GG-----G.T TG-------- TGCCG.T ..- -..------- -...---- .. ------ - .T T.---
PINICOLA1323 GTAAAA--.- --..AGTC-- TGCCG.T ..- -..TTT-.-A AA-------- ------ A .T T----
FAGACEARUM2651 .TT-CTTC.. GGG.TGTTTC TGCC ..T ..- -..TTT-.-- ------- ..- --------.A .T T.T--
COERULESCENS666 GTAAAA---- --..AGTC-- TGCCG.T ... --.TTT-.-- ---------- ------ ...A .T T----
NEOCALEDONIA694 GTAACA---- ,--..AGTCT- TGCCG.T ..- -..TTT-.C- ------- ..A .T T.T--
AUSTRALIS619 GTAACA---- -- ..AGTCT- TGCCG.T ..- -..TTT-.C- ------- ..A .T T.T--
ELEGANS185 ----- GGGC-TTCT- -GCCG.T ... --.TTT-.T- ------- ..A .T T----
ACACIA4690 ----- GGGC-TTCT- -GCCG.TT .. --.TTT-.T- ------- ..A .T T----
PETRIELLA A.-- ..T.CT C..-G.CGG- ---C....-- C.-------- -. -
\0
(Jl
150 160 170 180 190 200 210
ALBOFUNDUS2475 -AT-ATT-TT TTAAAA--TT TTT-AAAA-- -ATTGCTGAG TGGCAT--AA -CTATAAAAA -AAGTTAAAA
ALBÓFUNDUS51829 - ... - ...... - · . .. .. .. .. .. .. -- .. ..... - ........ -- -
ALBOFUNDUS51645 - .... - ...... - · . ..N ...-- .. ...-..N.-- - ........... -- . . - ...NNNNN . - "'
ALBOFUNDUS51639 - .. .. - ...... - · . ............ -- .. ...... - ........ -- -
ACACIA4101 - ..T ...T.- C ..--GA- .. .,.------- C.
FIHBRIATA8S4 -..T ...T.- C ..--GA- .. .,.------- C.
FIMBRIATA2220 -..- ...T.- CC.--GA- .. ·..T------ C.
FHIBRIATAS1831 - ..- ...T .. CC. --GA- .. ...T------ C ........ " ............ -- . .
_ ..._____- -N .
FIMBRIATAS1830 - ..- ...T .. CC. --GA- .. ·..T------ C.
FIMBRIATAS1644 - ..- ...T .. CC. --GA- .. ·..T------ C .•
VIRESCENS0460 T--- ...--- C ....GAA .. ----.---TT C ....·.... ..... .T- .. -.- ....--- T .
EUCALYPTI639 ---- ...T-- C ..G.GAA .. ----.---TT C ......... ..... .T- .. _._ ....--- T .
MONILIFORHIS3782 - .... - .... ---- -- ...GAA .. .---.---TT C ..···...· .A ....TTT .
____ ....-- TGTA .
PARADOXAlS46 - ..- ...T-- C ..G.GAA .. ----.---TT C ...··.... .... ..T- .. _.__ ....-- T .
ADIPOSA1622 -.-- ...T-- C ..G.GAA .. ----.---TT C ....·.... .T ....TT ..
_.___ ...-- T.- .
PINICOLA1323 A ..- ...T-- C ..G.GAA .. .---.TT-TT C ..···.... ..... .T- .. A.-;.-...--- T .
FAGACEARUM2651 -.-- ...T-- C ..G.GAA .. ----.---TT C ......... .T....TT .. _._._ ...-- T.-
COERULESCENS666 -..- ...T-- C .. G.GAA .. ----.---TT C .... ·...· ..... .T- .. _._ ....--- T .
NEOCALEDONIA694 - ..-- ..--- C ..G .GAA .. ----.---TT C ......... ." ...T- .. _._ ....--- T .
AUSTRALIS619 -..-- ..--- C ..G.GAA .. ----.T--TT C ........ ; ..... .T- .. _._ ....--- T .
ELEGANS18S - ..- ...T-- C .• T.GAA .. ----.T---T C ..···.... ..... .T- ..
_.__ ....-- T .
ACACIA4690 -..- ...T-- C ..T.GAA .. ----.T---T C ....·..·· ..... .T- .. _.-- ....-- T .
PETRIELLA -.-- ...T.A .AGCG--GA. .---.T.--- C- .. - .... A .ACA ..--.- -.--- ....- C ..A.A .
1.0
0\
220 230 240 250 260 270 280
ALBOFUNDUS2475 CTTTCAACAA CGGATCTCTT GGCTCTAGCA TCGATGAAGA ACGCAGCGAA ATGCGATAAG TAATGTGAAT
ALBOFUNDUS51829 " .................. ..............
ALBOFUNDUS51645 .. .. .. .. .. .. .. .. .. .. .................... .. ..........
___ .__ .N. -.
ALBOFUNDUS51639 .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. - - .............. .. ........
ACACIA4101 .. .. .. .. .. .. .. .. .. .. .................... .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. · .
FIHBRIATA854 .. .. .. .. .. .. .. .. .. .. ................ .. .. .. .. .. .. .. .. .. .. ......
FIMBRIATA2220 .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. ...... " ....... · .......
FIHBRIATA51831 .. . .. . . .. . .. . " · .......... " ... · ............ · ...... " ... " .. " .....
FIl'-1BRIATA51830 ... ........ .. . .. . .. .. . .. .. ................. N .. .. ................ . ." " "
FIHBRIATA51644 · ...... " ... · ........ " . .. . . . . . .. . .. . " .......
VIRESCENS0460 · ..... " ..... " · ........... · ... " ...... · ......... .. . .. " ........ ........ C .
EUCALYPTI639 · .......... · ....... " .... · ......... " . · ... " ......... · ..... .. .. .. .. __ ...... C .
HONILIFORMIS3782 ............ .. . . . . . . . . " ..... " .. " .... · . " ......... .. . .. " ...... " ......... . ........"
· ........... ............... .. . .. .. .. .. . . . . .. .. .. .. .. .. .. .. .. .. · .... - ... __ ...... C.PARADOXA1546
ADIPOSA1622 · .......... · ......... · .......... ·....
PINICOLA1323 - - . - - ....... · ............. · - - - - ....... · .. - - . __ ...... C.
FAGACEARUM2651 · ............. ·
COERULESCENS666 · .............. .. .. . .. .. . . .. .. .. .................. .. .. .. .. .. .. .. .. .. . .. .. . . .. .. .. .. .. .. ........ C .
NEOCALEDONIA694 .. . . . .. . . .. .. .. .. . . . . .. .. .. .. . · ............ .. . .. . .. . .. .. .. .. .. .. .. .. . .. .. . .. .. ........ C .__ ...... C.
AUSTRALIS619 - - .
ELEGANS185 · ..............
ACACIA4690 .. .. .. .. .. .. .. .. .. . · .................. · ...........
PETRIELLA - - - ........ ................ ·.T ...G.
\()
-.-J
290 300 310 320 330 340 350
ALBOFUNDUS2475 TGCAGAATTC AGTGAATCAT CGAATCTTTG AACGCACATT GCCCCTGG-T AGTATTCTGC CAGGCATGCC
ALBOFUNDUSS1829 .......... " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " .NN ..... -N " " " " "
ALBOFUNDUSS164S .." " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " ..N ..... -N " " " " "
ALBOFUNDUS51639 " " " " " " " " " " ....... N .. .... .N .... " " " " " " " " " " .NN·..... -. " " " " " " " " " " " " " " " " " " "
ACACIA4101 " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " ·.G ..... GC
FIMBRIATA854 " " " " " " " " " " " ·.G ..... -C" " " " " " " " " " " " " " " " " " " " " " " " " " ......
FIHBRIATA2220 .. " ................ .. .. " .............. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. " " " ...... " .. -
FIMBRIATA51831 ...N ...... .. " " .............. " .................. .. .................. ..N ..... N-
FHlBRIATA51830 .. .. .. .. .. .. " ...... .. .................. ..NN ...N .. .................... ·.G ..... -C .. .. .. .. .. .. .. .. .. " " ..............
FItvlBRIATA51644 .. .. .. .. .. .. .. .. " .. .. ........ " ........ ....... N .. .. .. .. .. .. .. .. .. .. .. ·....... N- .. .. .. .. .. .. .. .. .. .. ...........
VIRESCENS0460 .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. " .... .................... ·.G ..... -C
EUCALYPTI639 .. .. .. .. .. .. " ...... .. ........ " ........ " .. " .............. ...... " ............ ·.G ..... -C
HONILIFORMIS3782 .. .. " .............. .. .................. .. .. .. .. .. .. .. .. .. .. .................... ·.G ..CA.-C .... C ..... TG.
PARADOXA1546 .. .. .. .. .. .. .. .. .. .. .. .. .. .. " .......... .. .. .. .. .. .. .. .. . . · ............ ·.G ..... -C ............... ....T ..
ADIPOSA1622 · ............ · .............. .. . . . .. . .. .. .. .. · .............. ·.G ..... -C
PINICOLA1323 · ................ · .............. .. . . .. .. .. .. .. . .. · .............. ·.G ..... -C
FAGACEARUM2651 · ............... .. .. . .. .. . .. . . . .. .. .. . .. . .. .. .. . .. .. .. .. . .. .. . .. .. ·.G ...A.-C ................... T.
COERULESCENS666 · ............... .. .. .. . .. . . . .. .. .. .. .. .. .. . .. .. .. . ................... ·.G ..... -C
NEOCALEDONIA694 .. .. .. . .. .. .. .. .. . .. .. . .. .. .. .. . .. .. .. . .. . .. .. .. . . . ................ ·.G ..... -C
AUSTRALIS619 · ................ .. .............. .. . . .. .. .. .. .. . .. .................... ·.G ..... -C
ELEGANS185 .. .. .. .. .. .. .. .. .. .. · ............... .. . .. .. .. . .. .. .. .. .................... ·.G ..... -C
ACACIA4690 .. .. .. .. .. .. .. .. .. .. · ............... .. .. .. . .. .. .. .. .. .. .................... ·.G ..... -C
PETRIELLA .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. . .. .. .. .. .. .. .. .. .. .................... ·.G ..C ..-C .... A ..... .G
c-oc
360 370 380 390 400 410 420
ALBOFUNDUS2475 TGTCCGAGCG TCATTTCACC ACTCAA-GAC TT-GCTTT-- AGTT-TTGGT -GTT-GG-AG GTCCTGTTC-
ALBOFUNDUS51829 .,.N...... .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. - · .. · .- .. .. .. .. .. -- .. .. .. .. - .. ........ - ...... - .... - . . ................
ALBOFUNDUS51645 ...N ...... .................... .. .......... - · .. .... - .......... -_ . - - - - ..
ALBOFUNDUSS1639 ...N ...... .. .. .. .. .. .. .. .. .. .. .. .......... - · .. · .- .. ........ -- .. ...... - .......... - ...... - -
ACACIA4101 .. .. .. .. .. .. .. .. .. .. .................... .. .......... - · .. .--- ....T- - ...C ....G C ...G. -
FH1BRIATA854 .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. ............ - · .- ·.--A ..CT- -- ..C .... - C ...-. -
FHIBRIATA2220 .. .. .. .. .. .. .. .. .. .. .................... ..... .G ... .CC-- ...-- - ...C ....- C ...- . -
FIMBRIATA51831 ...N ...... .................... ..... .G ... .CC-- ...-- - ...C .... - C . - -
FIMBRIATAS1830 .. .. .. .. .. .. .. .. .. .. .................... ..... .G ... .CC-- ... -- - ... C ....- C . - -
FIMBRIATAS1644 .. .. .. .. .. .. . .. .. .. .................... ...... G ... .CC-- ...-- -.NNC ....- C... - .. -
VIRESCENS0460 .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. ............ .CC ....--- -.G.G ..--- ----- ..- .. .A...... -G
EUCALYPTI639 .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. ............ - .. - .. .CC ....--- -.G.G ..--- ----- ..- .. .A.-.CG-.A
MONILIFORMIS3782 .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. ............ - .. - .. .CT ....--- - ...G ..--- ----- ..- .. AG ..... ---
PARADOXA1546 .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. ............ .CT ....--- -.GCG ..--- ----- ..- .. .A. ------
ADIPOSA1622 .................... .................... .. .......... -. - · .CT ....--- -.G.G ..--- ----- ..- .. .A. ------
PINICOLA1323 .................... .................... .. .......... · · .CT ....--- -.G.G ..--- -~--- ..- .. .A..------
FAGACEARUM26S1 .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. ............ - .. - .. C.T ....--- -.G.G ..--- ----- ..- .. .A. ------
COERULESCENS666 .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. ............ - .. - .. .CT ....--- -.G.G ..--- ----- ..- .. .A. ------
NEOCALEDONIA694 .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. ............ -. - .CC ....--- -.G.G ..--- ----- ..- .. .A ..------
AUSTRALIS619 .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. ............ .CC ....--- -.G.G ..--- ----- ..- .. .A..------
ELEGANS18S .............. . . . . . . . . . . ...... .CT .... --- -.G.G ..--- ----- ..- .. .A. ------
ACACIA4690 .......... . . . . . . . . . . ...... ·· .CT ....--- -.G.G ..--- ----- ..G .. .A ..------
PETRIELLA .......... ....... .A. C ...G.G-C . .AA.T ...TT .AA-C.-.-- ---AA ..ATC --GG .... -G
1.0
1.0
430 440 450 460 470 480 490
ALBOFUNDUS2475 TT----ACCC TTC-----TG AA-CAGGCC- GCCGAAATGC ATCGGCTGTT ATTTTTACTT GCCAACTCCC
ALBOFUNDUS51829 · .---- ........ ...-----C. .... - - .. ..
ALBOFUNDUS51645 .... ---- ........ · .. ----- . . - - .. ..
ALBOFUNDUS51639 · . ---- ........ ...-----C. .... - - .. ..
ACACIA4101 ------ ... -- .. ----- · . - - T
FHIBRIATA854 ------ -- ----- .... - -
FIJVIBRIATA2220 .. ------ ...... --.----- .... - - ......... T
FIMBRIATA51831 ------ -- ----- .... - - . T
FIMBRIATA51830 ------ ... -- .. ----- · . - - ..•...... T
FHIBRIATA51644 .. ------ ...... --.----- ..- - T
VIRESCENS0460 ·.TTC----- ---------- •• - .••••. - A •.......• .. - .G .. T ..
EUCALYPTI639 -------- ·.-A---- .. ·TG .G G - -.. .. - .G .. T ..
MONILIFORMIS3782 -----GC--- -.ATGC---- ---GC ..G.C T.T - G.--- A -.GT.T ..
PARADOXA1546 ----CGC--G ·.-TGC---- _____ ..G.C A ---- -.G ..T ..
ADIPOSA1622 ----CGC--- ---TG----T C .AGC ..G .C . A G- --- ..T.. ..- .G ..T ..
PINICOLA1323 ----CGCAT. ·.-T-TT--- ---GC ..G.C . --:--- .. T .. .. - .G .. T ..
FAGACEARUM2651 ----C-CA-. ·.GT-CA--- C.AGC-.G.C A . . . . . . . . . . - .G--- .. T .. .. -.G .. T ..
COERULESCENS666 ----CGCAT. · .-------- ---GC ..G.C A . . ---- .. T .. .. -.G .. T ..
NEOCALEDONIA694 ----CGCGT. ·.AT------ ---GC ..G.C ---- -.G ..T ..
AUSTRALIS619 ----CGCGT. ·.-T-AT--- ---GC ..G .C .----. .... ..- .G ..T. .
ELEGANS185 ----CGCGT- ·.A-G-T--- C--GC ..G .C G.A .A -- --- .G ..T. .
ACACIA4690 ----CGCGT- ·.A-G-T--- C--GC ..G.C GNA.A -- ---.G ..T ..
PETRIELLA -----G-G-- ----GCGC.A ----CA ..-- .GTTCTTC.G -AGCAGCTG .. GG---C.C .. -- ..A.A.-
.....
oo
500 510 520 530 540 550 559
ALBOFUNDUS2475 C-TGTGTAGT ACAAGATTTT -TTAAATTTT TACGCTTT-G GAGTGCTTGT GTAACAT-GC CGT--TAAA
ALBOFUNDUS51829 - .. .. .. .. .. .. .. .. · ......... - · ........ ·....... - · .. - ...... .......-.G
ALBOFUNDUS51645 - · ....... · ......... - ·........ · ....... -. · ......... .......-.G ".
ALBOFUNDUS51639 - · ....... · ......... - ·........ ·....... - · .......... ·...... -
ACACIA4101 - · ....... .T ..A.- ... C.-- ...... -..A ....-. A ...T..... ......C- .. ·.C--.
FIMBRIATA854 - · ....... .T ..A.- ... C.--...,.. ...A ....-. A ...T ..... ·.....C- .. ·.C--.
FIMBRIATA2220 - ·....... .T ..A.- ... C.--...... ...A ....-. A ...T ..... ·.....C- .. ·.C--.
FIMBRIATA51831 - · ....... .T ..A.- ... C.--...... ...A ....-. A ...T ..... ......C-.G ·.C--.
FIMBRIATA51830 - · ....... .T ..A.- ... C.--...... ...A ....-. A ...T ..... ·.....C-.G ·.C--.
FIMBRIATA51644 - · ....... .T ..A.- ... C.--...... ...A ....-. A ...T ..... ......C-.G ·.C--.
VIRESCENS0460 .-.......- -T..T ..--- C.--- ..--. ...A ....-. A.ACT ..... ACT. -
EUCALYPTI639 ·-.......- -T ..T ....- ----- ..--. · ....... - . A.ACT ..... ACT ....-
MONILIFORMIS3782 ·-.......- -T..A.C ... ----- ...G. .G.A ....-. A.ACT ..... ACT ....-.. ·.--T.
PARADOXA1546 ·-..C ....- -T..--- ... -----..-G. · ....... - A.ACT ..... ACT ....-.. ·.---.T.
ADIPOSA1622 ·-..C ....- -T ..A.C ... G.------G. · .............. - . A.CCT ..... AC. -
PINICOLA1323 .-.......- -T..T ....- ----- ....- ................ - A.ACT ...T . AC .....-.. .... _-- ..
FAGACEARUM2651 ·-..C..... .-..AC .... G.------G . .......-C. A.ACT ..... ACG ....T.
COERULESCENS666 ·-.......- -T..T ....- -----.--.. ................ - A.ACT ...A. AC .....-.. ·.---.T.
NEOCALEDONIA694 .-.......- -T ..T ....- -----.-- .. ................ - A.ACT ..... ACT. -
AUSTRALIS619 ·-.......- -T..T ....- -----.-... ................ - A.ACT ..... ACT ....-
ELEGANS185 ·C.......- -T ..ATGC .. AGC----- .. ...A ....-. A.ACTT ..A . A ......-.. ·.---A.
ACACIA4690 .-.......- -T..ATGC .. AGC----- .. ...A ....-. A.ACTT ..A . A ......-.. ·.--GA.
PETRIELLA ------- ... GGCG.-.CCC GCCGC----- GG ...----- ----- ...-- -CT----- .. -..AG.
.......
o
.......
102
Figure 9: Aligned nucleotide sequences for the lTS region for different species of
Ceratocystis and Chalara. N indicates unknown bases, a dash (-) indicates a gap in the
sequence alignment and (.) indicates bases identical to those of isolate
ALBOFUNDUS2475.
103
I"" ALBOFUNDUS 2475
~ ALBOFUNDUS51829
ALBOFUNDUS51639
I.. ALBOFUNDUS 51645
r- ACACIA4101
84
r- r- Fl.MBRI~_TA2220
FIMBRI2\TA51831
75
--~ FIMBRIATA51ó44
FIMBRIATA51830
.__ FIMBRIATA854
~ VlRESCENS0460
EUCALYPTI639
PARADOXA1546
-- ~ ADIPOSA1622
I-.-
FAGACEARUM2 651
~ COERULESCENS666
PINICOLA1323
- AUSTRALIS619
NEOCALEDONIA694
L- 100~ ,... ELEGANS185
.__ ACACIA4690
MONILIFORMIS3782
PETRIELL~_
104
Figures 11, 12: Symptoms produced on A. mearnsii seedlings during glasshouse
inoculation trials with C. fimbriata.
Fig. 11: Black cankers developing on A. mearnsii seedling after inoculation with C.
fimbriata.
Fig. 12: Comparison between control inoculation and C. fimbriata inoculation after four
weeks.

106
Figures 13, 14: Morphological characteristics of C. albofundus.
Fig. 13: Light coloured perithecial base with dark necks, typical of C. albofundus.
Fig. 14: Divergent ostiolar hyphae of C. albofundus.


109
4
A SERIOUS NEW WILT DISEASE OF EUCALYPTUS CAUSED BY
CERA TOCYSTIS FIMBRIA TA IN WEST AFRICA
ABSTRACT
In a recent survey of Eucalyptus clones in the Republic of Congo, West Africa, a serious
wilt and die-back disease of two different hybrid clones was observed. Affected trees
ranged in age from approximately 6 months to 4 years. Isolations from symptomatic plant
material consistently yielded a Ceratocystis species. Based on morphology, this fungus
was identified as C. fimbriata, which is a well-known wilt and canker pathogen of many
economically important plants. The Eucalyptus isolates were compared with other
Ceratocystis spp. based on sequence data generated from the ITS region of the rRNA
operon. The results confirmed the identity of the Ceratocystis species from Eucalyptus
and also showed that it groups with South American C. fimbriata isolates, as well as with
C. fimbriata from Acacia mearnsii in South Africa. Inoculations of young Eucalyptus
plants were conducted in the greenhouse and all three of the isolates tested, produced
lesions in the bark and xylem. This study represents the first report of C. fimbriata as a
pathogen of Eucalyptus in Africa. This is a serious new disease which will require
considerable study in order to ensure that losses caused by C. fimbriata do not continue.
110
INTRODUCTION
Eucalyptus spp. are native to Australia, but approximately 8 million hectares of plantations
have been established, mostly in tropical and sub-tropical countries of the world (Mohanan
& Sharma, 1986; Wingfield, Crous & Peredo, 1995; Wingfield, Crous & Boden, 1996;
Wingfield & Wingfield, 1998). The wood from these trees are used for timber, paper and
pulp, the production of rayon and viscose and for firewood (Tumbull, 1991). Eucalyptus
spp. have been grown in the Republic of the Congo since 1953 and from 1978, clonal
plantations, established from vegetatively propagated trees, have been utilized (Leaky,
1987).
Serious disease problems have emerged on exotic Eucalyptus spp. in most countries
where they have been planted, despite the fact that they have been isolated from their
natural enemies. These diseases include both stem, root and leaf diseases. Diseases such
as Cryphonectria canker, caused by C. parasitica (Bruner) Hodges, have necessitated
extensive clonal programmes to reduce losses in countries such as South Africa and Brazil
(Florence, Sharma & Mohanan, 1986; Hodges, Alfenas & Ferreira, 1986; Conradie,
Swart & Wingfield, 1990). Other stem and root diseases include Eucalyptus rust caused
by Puccinia psidii G. Winter (Ferreira, 1989), Coniothyrium canker caused by C. zuluense
(Wingfield, Crous & Coutinho, 1997) and Pythium and Phytophthora root rot (Linde,
Kemp & Wingfield, 1994). Leaf diseases caused by species of Mycosphaerella Johanson
and Cylindrocladium Morgan also cause serious problems, especially in tropical areas
(park & Keane, 1984; Crous & Wingfield, 1994; Crous & Wingfield, 1996). These are
but a few of the diseases that have already lead to considerable economic losses to the
Eucalyptus industry.
Until recently, no thorough survey of the diseases affecting plantation Eucalyptus in the
Republic of the Congo had been conducted. Sporadic reports of tree deaths were made
occasionally, but no detailed investigations into the causal agents were initiated, since the
mortalities were not considered to be serious. One such report was of a wilt and die-back
111
disease, thought to be caused by an undetermined species of Botryodiplodia (Declert,
1996).
During 1998, a survey of diseases of eucalypt plantations in the Pointe-Noire area of the
Republic of Congo was undertaken. This lead to the discovery of a serious wilt and die-
back disease of E. urophylla S. T. Blake X E. pellita F. Muel!. (UP) and E. grand is Hill
ex. Maid. XE. territicornis Srn. (ET). Affected trees ranged from 6 months to more than
4 years old. The most common symptoms were the rapid wilting and death of trees and
dark brown "streaking" of the xylem. The aim of this study was, therefore, to determine
the cause of the Eucalyptus wilt disease in the Republic of Congo and to prove
pathogenicity of the isolated fungus using greenhouse inoculation trials.
MATERIALS AND METHODS
Disease and symptoms
Disease was observed on 2-year-old trees and 6-month-old coppice stems of E. urophylla
XE. pellita (UP) hybrids from Kissoko plantation and from 4-year-old coppice stems of
E. grand is XE. territicornis (GT) growing at Tchittanga plantation, Republic of Congo.
Approximately 50 % of these stands were affected. Hybrid E. urophylla XE. pellita (UP)
showed symptoms of wilt, followed by death. Upon cutting into the xylem, extensive
streaking was observed (Fig. I). These streaks were more intense and concentrated
towards the base of the tree. Adjacent to this UP stand was a stand of young UP coppice
(less than l-year-old), of which at least one of the coppice stems per stump was dead (Fig.
2) or dying. Again, distinct dark brown streaks were found in the xylem (Fig. 3). These
symptoms were similar to those on the adjacent, approximately 2 year old, UP trees.
At Tchittanga plantation, trees showed signs of wilt and die-back of first rotation coppice
of a 4-year-old GT clone. More than half of the trees in this stand were dead or dying.
Many of the affected trees were exuding kino and the stems of many trees were cracked.
112
Extensive kino pockets were observed in the xylem. Epicormic shoots were also common
on many of the trees. Some trees showed streaking of the xylem.
Isolations
Pieces of symptomatic tissue from the leading margin of the streaked and discoloured
wood were plated directly onto 2% malt extract agar (MEA) (20 gIL Biolab malt and 15
gIL Biolab agar). Segments of symptomatic material were also placed in humidity
chambers to induce the formation of fungal fruiting bodies. All plates were incubated at
approximately 25°C to induce fungal growth. Perithecia formed in the stains within a few
days and single ascospore drops were transferred to separate MEA plates. Direct isolation
from plant material on to MEA resulted in the abundant formation of colonies of a fungus
that produced long necked perithecia.
Greenhouse pathogenicity trials
Twenty trees, approximately 5 mm diameter, of a E. grandis X E. camaldulensis Denh.
(GC) hybrid were artificially inoculated with 3 isolates of the suspected pathogen .. The
isolates were grown on MEA for 14 days before inoculation. Wounds were made into the
xylem of the trees by removing the bark with a 4 mm diameter cork borer. Mycelial plugs
of equal size, covered by the test fungus were placed into the wounds and the wounds
sealed with parafilm to prevent desiccation of the inoculum and the wounds. Ten trees
were inoculated with sterile agar plugs as controls .. Lesions were measured after 5 weeks
on the outer bark and in the xylem. Pieces of symptomatic material were placed in
humidity chambers to confirm that the inoculated fungus were responsible for causing the
observed lesions.
113
DNA amplification and sequencing
Isolates used in this study were grown on MEA plates and template DNA was obtained by
scraping the mycelial surfaces with a pipette tip (Harrington & Wingfield, 1995). The
polymerase chain reaction (PCR), using pnmers ITS 1
(5'TCCGTAGGTGAACCTGCGG3') and ITS 4 (5'TCCTCCGCTTATTGATATGC3')
was used to amplify the Internal Transcribed Spaeer (ITS) regions of the ribosomal RNA
operon (White et al., 1990). The PCR reaction mixture included Expand™ (Boehringer,
High Fidelity PCR), 0.2 mM DNTP's, 10X Buffer (Boehringer), 1 mM MgCI
(Boehringer) and 0.75 mM primer. Denaturation was performed at 96°C for 1 min,
followed by 35 cycles of primer annealing at 55°C for 30 sec. Chain elongation took place
at 72°C for 1 min and denaturation at 92°C for 1 min. Final chain elongation took place at
72°C for 5 min. PCR products were stained with ethidium bromide and visualized under
UV light.
The PCR fragments obtained were purified using the QIAquick PCR purification kit
(QIAGEN, Germany). PCR products were sequenced in both directions using the Big
Dye Cycle Sequencing kit with Amplitaq® DNA polymerase, FS (perkin-Elmer,
Warrington, UK) on a ABI PRISMrM 377 DNA Autosequencer (perkin-Elmer). Primers
ITS 1 and ITS 4 was used in the sequence reaction. Sequences for the Congolese isolates
were aligned against sequences obtained from Genbank, Witthuhn et al. (1998a, b) and
Roux et al. (unpublished) (Table 1). Nucleotide sequences were manually aligned by
inserting gaps and analyzed using the Heuristic search option in PAUP (phylogenetic
Analysis Using Parsimony) (Swofford, 1985). Confidence intervals were determined using
DNA BOOTSTRAP analysis (Bootstrap confidence intervals on DNA parsimony)
(Felsenstein, 1988).
114
RESULTS
Isolatlons
Isolations made from the diseased 2-year-old UP and the 6-month-old coppice at Kissoko
consistently yielded a species of Ceratocystis, both from humidity chambers "and from
isolations made on agar. The same fungus was also isolated from the UT coppice at
Tchittanga. The Ceratocystis sp. was found to sporulate abundantly in the brown streaks.
The fungus was identified as Ceratocystis fimbriata based on perithecial morphology and
size, hat-shaped ascospores, chlamydospore morphology and the presence of a distinctive
Chalara anamorph. Cultures of the fungus have been deposited in the culture collection
of the Tree Pathology Co-operative Programme (TPCP), Forestry and Agricultural
Biotechnology Institute (FABI), South Africa.
Greenhouse pathogenicity trials
All 3 isolates tested produced lesions on the outer bark as well as in the xylem of the
inoculated trees (Fig. 4, Table 2). The typical streaking associated with C. fimbriata
infection on naturally infected trees was also evident in many of the inoculated trees (Fig.
4). No symptoms developed on trees inoculated as controls and in all cases the
inoculation wounds were covered with callus (Table 2). The inoculated pathogen was
consistently re-isolated from the lesions on inoculated trees and never from control trees.
DNA amplification and sequencing
Sequences for the Congolese isolates were aligned against sequences obtained from
Genbank, Witthuhn et al. (1998a, 1998b) and Roux et al. (unpublished) (Table 1).
Sequences were manually aligned by the insertion of gaps, resulting in a total of 560
characters (Fig. 5). A Heuristic search using PAUP with the no branch swopping option,
generated one tree (Fig. 6). Values for the consistency index (Cl), homoplasy index (Hl)
115
and retention index (RI) were 0.878, 0.122 and 0.852 respectively. Isolates from the
Republic of Congo grouped with C. fimbriata, separately from other Ceratocystis spp.
with which they were compared, with a confidence interval of 83 %. The Congolese
isolates formed a clade with C. fimbriata isolates from Eucalyptus in Brazil and A.
mearnsii in South Africa. This clade was separate from the clade containing C. fimbriata
isolates from Platanus spp. in the Northern Hemisphere.
DISCUSSION
As far as we are aware, this report represents the first record of a Ceratocystis sp. as a
pathogen of Eucalyptus. We are, however, aware of a similar report of a fungus
representing C. fimbriata from a Eucalyptus sp. by colleagues in Brazil (Dr. A. Alfenas,
University of Vicosa), although details of that disease are not known to us. This is also
the first example of a serious wilt disease of Eucalyptus caused by a fungus. The
appearance of the disease at a time when the propagation of these trees is increasing
greatly is of concern and it deserves further study.
Ceratocystis spp. are well-known causal agents of wilt diseases and are amongst the most
serious pathogens of woody plants in the world (Kile, 1993; Wingfield, Seifert & Webber,
1993). Ceratocystis fimbriata is perhaps the best known of these species and has a wide
host range including sweet potato (Halsted & Fairchild, 1891), coffee (pontis, 1951),
cocoa (Kile, 1993), gmelina (Muchovej, Albuquerque & Ribeiro, 1978), fruit trees such as
peach and almond (De Vay et al., 1963; Teviotdale & Harper, 1991), poplar (Wood &
French, 1962; Gremmen & de Kam, 1976), Acacia decurrens (Ribeiro et al., 1988) and
many others, on all of which it causes serious wilt and canker diseases. The fungus
produces slimy droplets of spores from perithecia and also produces sweet smelling
aromatics which are thought to play a role in insect dispersal (Hanssen, 1993; Christen,
Meza & Revah, 1997). Trees usually require wounds for the initiation of infection (De
Vay et al., 1963; Teviotdale & Harper, 1991) and these wounds are usually visited by
insects that transmit spores to them (Crone & Bachelder, 1961; Hinds, 1972; Rosetto &
116
Ribeiro, 1991). At this stage, we know very little concerning the factors associated with
disease development on Eucalyptus in the Congo, but we must expect that it will be
similar to the situation on other trees, elsewhere in the world.
There has been only one other report of a Ceratocystis sp. from Eucalyptus. This is C.
eucalypti Yuan & Kile that was collected from wounds on the stems of E.. siberi L.
Johnson and E. globoidea Blakely in Australia (Kile et aI., 1996). There can, however, be
no mistaking C. fimbriata for C. eucalypti. The latter has very large elongated, fusiform
ascospores, whereas C. fimbriata has very characteristic hat-shaped ascospores.
Ceratocystis eucalypti is reportedly not pathogenic to Eucalyptus.
Morphological characteristics of the fungus associated with Eucalyptus wilt in the Congo
closely match the description of C. fimbriata. Recently, considerable data pertaining to
the phylogenetic relationships between Ceratocystis spp. have become available (Hausner,
Reid & Klassen, 1993; Visser et al., 1995; Witthuhn et al., 1998a; 1998b). For the
present, C. fimbriata remains a discrete species. However, Webster and Butler (1967)
have previously presented data that might suggest that this fungus represents a number of
closely related, but different species. They, however, concluded, based on hybridisation
studies, that C. fimbriata represents one species including several strains that differ in
morphology and cultural characteristics. As additional sequence data become available,
this situation might need reconsideration.
The recent discovery of a Ceratocystis sp. causinga serious wilt disease of black wattle
(A. mearnsii de Wild.) in South Africa aptly illustrates the difficulty with morphological
identification of species in the C. fimbriata group (Morris, Wingfield & DeBeer, 1993).
The pathogen was first reported as C. fimbriata but, later, based largely on sequence data,
was described as a new species that is now known as C. albofundus Wingfield, De Beer &
Morris (Wingfield et al., 1996). The grouping in the present study of C. fimbriata isolates
from South America and Africa in a clade separate from European and North American
117
isolates, also supports the hypothesis that C. fimbriata represents a species aggregate.
This matter requires further investigation.
Pathogenicity tests on young trees in the greenhouse confirmed the likely role of C.
fimbriata as the causal agent of the Eucalyptus disease in the Congo. The results are also
seen together with the symptoms on trees which are similar to those usually associated
with C. fimbriata infection of woody crops (Leather, 1966; Muchovej et aI., 1978; Kile
& Walker, 1987; Ribeiro et al., 1988). In the future, I would, however, hope to conduct
pathogenicity tests on established trees in the Republic of Congo. Such tests will expand
our understanding of disease development, and perhaps more importantly, will allow us to
compare the susceptibility of different species and hybrids. Ultimately, the aim must be to
reduce the effects of this disease. This could potentially be achieved through selection of
disease tolerant planting stock.
It is intriguing to consider what the possible origin of C. fimbriata on Eucalyptus in the
Republic of Congo might be. At the present time, there are no reports of this fungus
causing disease in this country or any other African countries. This might be due to the
fact that intensive surveys for this pathogen, which can be inconspicuous and difficult to
isolate, have not been undertaken. However, our preliminary sequencing data show that
the fungus from Eucalyptus in the Republic of Congo is most similar to C. fimbriata
isolates from South America and C. fimbriata from A. mearnsii in South Africa. These
data might imply that the fungus originated in South America where C. fimbriata is a well-
known pathogen of a wide range of crops. Further phylogenetic and biogeographic
studies are planned to consider this question more completely.
118
REFERENCES
Christen, P., Meza, l.C. & Revah, S. (1997). Fruity aroma production in solid state
fermentation by Ceratocystis fimbriata: influence of the substrate type and the presence
of precursors. Mycological Research 101,911-919.
Conradie, E., Swart, WJ. & Wingfield, M.l. (1990). Cryphonectria canker of
Eucalyptus, an important disease in plantation forestry in South Africa. South African
Forestry Journal 152, 43-49.
Crone, LJ. & Bachelder, S. (1961). Insect transmission of the canker stain fungus,
Ceratocystisfimbriata f platani. Phytopathology 51, 576.
Crous, P.W. & Wingfield, M.l. (1994). A monograph of Cylindrocladium, including
anamorphs ofCalonectria. Mycotaxon 51,341-435.
Crous, P.W. & Wingfield, MJ. (1996). Species of Mycosphaerella and their anamorphs
associated with leaf blotch disease of Eucalyptus in South Africa. Mycologia 88, 441-
458.
De Vay, l.E., Lukezic, F.L., English W.H. & Trujillo, E.E. (1963). Ceratocystis canker of
stone fluit trees. Phytopathology 53, 873.
Declert, C.C. (1996). La maladie de deperissement de l'Eucalyptus Urophylla X Grandis
ou "die-up". Rapport Centre ORSTOM de Pointe-Notre.
Felsenstein, J. (1988). DNABOOT - Bootstrap Confidence Intervals on DNA parsimony
3.1. University of Washington.
119
Ferreira, F.A. (1989). Patologia forestal. Principais doencas florestais no Brazil.
Sociedade de Investigacoes Florestais, Vicosa, Brazil.
Florence, E.l, Sharma, lK & Mohanan, C. (1986). A stem canker disease of Eucalyptus
caused by Cryphonectria cubensis in Kerala. KFRI Scientific paper No. 66, 384-387.
Gremmen, J. & De Kam, M. (1976). Ceratocystis fimbriata, a fungus associated with
poplar canker in Poland. European Journal of Forest Pathology 7,44-47.
Halsted, B.D. & Fairchild, D.G. (1891). Sweet-potato black rot. Journal of Mycology 7,
1-11.
Hanssen, H-P. (1993). Volatile metabolites produced by species of Ophiostoma and
Ceratocystis. In Ceratocystis and Ophiostoma: Taxonomy, Ecology and Pathogenicity
(eds. M.l Wingfield, K.A. Seifert, & lA. Webber), pp. 117-126. APS Press, St. Paul,
Minnesota.
Harrington, T.C. & Wingfield, B.D. (1995). A PCR based identification method for
species of Armillaria. Mycologia 87,280-288.
Hausner, G., Reid, J. & Klassen, G.R. (1993). On the subdivision of Ceratocystis s.1.,
based on partial ribosomal sequences. Canadian Journal of Botany 71, 52-63.
Hinds, T.E. (1972). Insect transmission of Ceratocystis species associated with aspen
cankers. Phytopathology 62, 221-225.
Hodges, C.S., Alfenas, A.C. & Ferreira, F.A. (1986). The conspecificity ofCryphonectria
cubensis and Endothia eugeniae. Mycologia 78,343-350.
120
Kile, G.A. (1993). Plant diseases caused by species of Ceratocystis sensu stricto and
Chalara. In Ceratocystis and Ophiostoma: Taxonomy, Ecology and Pathogenicity (eds.
MJ. Wingfield, KA. Seifert, & J.A. Webber), pp.173-183. APS Press, St. Paul,
Minnesota.
Kile, G.A. & Walker, K (1987). Chalara australis sp. nov. (Hyphomycetes), a vascular
pathogen of Nothofagus cunninghamii (Fagaceae) in Australia and its relationship to
other Chalara species. Australian Journal of Botany 35, 1-32.
Kile, G.A., Harrington, r.c., Yuan, Z.Q., Dudzinski, M.l & Old, KM. (1996).
Ceratocystis eucalypti sp. nov., a vascular stain fungus from eucalypts in Australia.
Mycological Research 100, 571-579.
Leakey, RRB. (1987). Clonal forestry in the tropics - A review of developments,
strategies and opportunities. Commonwealth Forestry Review 66, 61-75.
Leather, RI. (1966). A canker and wilt disease of pimento (pimenta officinalis) caused
by Ceratocystisfimbriata in Jamaica. Transactions of the British Mycological Society 49,
213-218.
Linde, c., Kemp, G.H.l & Wingfield, M.l (1994). Pythium and Phytophthora species
associated with eucalypts and pines in South Africa. European Journal of Forest
Pathology 24, 345-356.
Mohanan, c. & Sharma, lK (1986). Epidemiology of Cylindrocladium diseases of
Eucalyptus. KFRI Scientific Paper No. 67, 388-394.
Morris, MJ., Wingfield, M.l & De Beer, C. (1993). Gummosis and wilt of Acacia
mearnsii in South Africa caused by Ceratocystisfimbriata. Plant Pathology 42,814-817.
121
Muchovej, ll, Albuquerque, F.e. & Ribeiro, G.T. (1978). Gmelina arborea - A new
host of Ceratocystisfimbriata. Plant Disease Reporter 62: 717-719.
Park, R.F. & Keane, P.l (1984). Further Mycosphaerella species from leaf diseases of
Eucalyptus. Transactions of the British Mycological Society 83, 93-105.
Pontis, R.E. (1951). A canker disease of the coffee tree in Colombia and Venezuela.
Phytopathology 41, 179-184.
Ribeiro, I.lA., Ito, M.F., Filho, O.P. & De Castro, lP. (1988). Gomose da Acacia-negra
eausada por Ceratocystisfimbriata Ell. & Halst. Bragantia Campinas 47,71-74.
Rosseto, C.I. & Ribeiro, I.lA. (1991). Root infection by Ceratocystis fimbriata the
primary cause of tree wilt. Proceedings of the XII International Plant Protection
Congress,Rio De Janeiro, Brazil, 11-16 August 1991.
Swofford, D.L. (1985). PAUP Phylogenetic Analysis using Parsimony. Version 2.4.1:
Champaign, Illinois.
Teviotdale, B.L. & Harper, D.H. (1991). Infection of pruning and small bark wounds in
almond by Ceratocystisfimbriata. Plant Disease 75, 1026-1030.
Tumbull, lW. (1991). Future use of Eucalyptus: Opportunities and problems. In
Intensive Forestry: The role of Eucalyptus. Proceedings of the IUFRO Symposium,
Durban, South Africa, September 1991.
Visser, C., Wingfield, M.l, Wingfield, B.D. & Yamaoka, Y. (1995). Ophiostoma
polonicum is a species of Ceratocystis sensu stricto. Systematic and Applied
Microbiology 18,403-409.
122
Webster, RK. & Butler, E.E. (1967). A morphological and biological concept of the
species Ceratocystisfimbriata. Canadian Journal of Botany 45, 1457-1468.
White, T.l, Bruns, T., Lee, S. & Taylor, J. (1990). Amplification and direct sequencing
of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to
Methods and Applications (eds. M.A. Innis, D.H. Gelfand, II Sninsky & T.l White), pp.
315-322, Academic Press: San Diego, U.S.A.
Wingfield, M.l & Wingfield, B.D. (1998). Cryphonectria canker of Eucalyptus.
Abstracts of the r" International Congress of Plant Pathology. Edinburgh, Scotland, 9-
16 August.
Wingfield, M.l, Crous, P.W. & Boden, D. (1996). Kirramyces destructans sp. nov., a
serious leaf pathogen of Eucalyptus in Indonesia. South African Journal of Botany 62,
325-327.
Wingfield, M.l, Crous, P.W. & Coutinho, T.A. (1997). A serious canker disease of
Eucalyptus in South Afiica caused by a new species of Coniothyrium. Mycopathologia
136, 139-145.
Wingfield, M.l, Crous, P.W. & Peredo, H.L. (1995). A preliminary, annotated list of
foliar pathogens of Eucalyptus spp. in Chile. South African Forestry Journal 173, 53-57.
Wingfield, MJ., Seifert, K.A. & Webber, LA. (1993). Ceratocystis and Ophiostoma:
Taxonomy, Ecology and Pathogenicity. APS Press, St. Paul, Minnesota.
Wingfield, M.l, De Beer, C., Visser, C. & Wingfield, B.D. (1996). A new Ceratocystis
species defined using morphological and ribosomal DNA sequence comparisons.
Systematic and Applied Microbiology 19, 191-202.
123
Witthuhn, R.C., Wingfield, B.D., Wingfield, M.l & Harrington, r.c (1998a). PCR
based identification and phylogeny of species of Ceratocystis sensu stricto. Mycological
Research. In Press.
Witthuhn, R.C., Wingfield, B.D., Wolfaart, M. & Harrington, T.C. (1998b). Monophyly
of the conifer species in the Ceratocystis coerulescens complex based on DNA sequence
data. Mycologia 90, 96-101.
Wood, F.A. & French, D.W. (1962). Ceratocystisfimbriata, the cause of a stem canker
of quaking aspen. Scientific Journal Series, Minnesota Agricultural Experiment Station,
University of Minnesota, Paper no. 4873.
124
Table 1: List of Ceratocystis isolates used in DNA sequence comparisons.
SPECIES ISOLATE ORIGIN GENEBANK
NUMBERSo ASSENCION
NUMBER! ISOLATE
NUMBER
Ceratocystis adiposa CMW1622 Japan AF043606
C. albofundus CMW2475 South Africa F043605
" PREM51639 "
C. coerulescens C666 Norway U756618
C. eucalypti C639 Australia U75627
C. fagacearum CMW2651 USA AF043598
C. fimbriata CMW4769 Republic of Congo
" CMW4783 "
" CMW4101 South Africa
" CMW4900 Brazil
" CMW4901 "
" CMW2220 Europe AF043604
" PREM51830 "
" C854 USA AFOO7749
C. paradoxa CMW1546 New Zealand AF043607
C. vireseens CMW0460 USA U75625
a CMW numbers represent cultures maintained in the culture collection of the Tree
Pathology Co-operative Programme (TPCP), Forestry and Agricultural Biotechnology
Institute (FABI), University of Pretoria, South Africa.
PREM - Official designation of the National Collection of fungi, Pretoria, South Africa.
C - Culture collection of T.C. Harrington, Department of Plant Pathology, Iowa State
University.
125
Table 2: Lesions produced on E. grandis XE. camaldulensis
clones in glasshouse inoculation trials.
ISOLATE LESION LENGTH (mm)"
CMW 4786 50.7
CMW 4769 47.15
CMW 4781 40.15
Control 9.0
a Each value represents an average of 20 measurements for
the 3 isolates tested and 10 measurements for the controls.
126
Figures 1-4: Symptoms caused by Ceratocystis fimbriata on Eucalyptus clones.
Fig. 1: Streaking of the xylem of a - 2 year-old E. urophylla XE. pellita (UP) clone ..
Fig. 2: Die-back of - é-month-old coppice stems of a UP clone.
Fig.3: Discolouration of the xylem of UP coppice stem after infection with C. fimbriata.
Fig. 4: Lesion produced on E. grand is XE. camaldulensis clone during greenhouse
inoculation trials with C. fimbriata.

128
Figure 5: Aligned nucleotide sequences for the ITS region of the rRNA operon for
different species of Ceratocystis. N indicates unknown basis, a dash (-) indicates a gap in
the sequence alignment and (.) indicates bases identical to the corresponding base in the
sequence of C albofundus isolate number ALBOFUNDUS2475.
10 20 30 40 50 60 70
ALBOFUNDUS2475 GCTGCCTTG- --GTGGGTG- TCT-G-TAGT GGTGTTAA-C C'I'crrTTTTAT----AAGGGG GCAGCCC-AC
ALBOFUNDUS5l639 ......... - -- ....... - .N. -. - .... ........ -. ·......... ---- . ..... . ...... -
ACACIA4l0l C.ATGTG ..A AC ..ACCCTA ...T.- ..., .AGA.G ..rrG ·.G..- ..GG TGGT- ....- ---- ...TT.
IPOMOEA854 -.ATGTG ..A AC ..ACC-TA ...T.- .... .AGA.G ..'I'G ..G..- ..GG TGGT- ....- ---- ...TT .
PLANE2220 C.ATGTG ..A AC ..ACC-TA ...T.- .... .AGA. G ..rrG ·.G ..- ..GG TGGT- ....- ---- ...TT .
PLANE51830 ---T--- ..A ---.------ ...T.- .... .AGA.G ..TG G.G ..G.-GG TGGT- ..-T. .--- ...TT.
CONG04783 C.ATGTG ..A AC ..AC--TA ... -. - . ... .AGA.G ..rr_ -.G-- ...GG TGGT- ...-- ---- ...TT.
CONG04769 C.ATGTG ..A -C ..-CC-TA ... -. - . ... -AGA.G ..TG ..G ..- ..GG TGGT- ....- ---- ...TT.
BRAZIL4900 C.ATGTG ..A AC ..ACCCTA ...T.- .... .AGA.G ..'I'G ·.G..- ..GG TGGT- ....- ---- ...TT .
BRAZIL4901 ---TGTG ..A AC ..ACCCTA ...T.- .... .AGA.G ..TG ·.G ..- ..GG TGGT- ....- ---- ...TT .
VIRESCENS0460 C.ATATG ..A ACA.ACC-TA .-.------- -------.-G ·.GC- ...GG C---- ...-- ------.TTG
EUCALYPTI639 C.ATATG ..A ACA.ACC-T- ...------- -------.-G ·.GC- ...GG C---- ...-- ------.TTG
COERULESCENS666 C.ATATG ..A ACA.ACC--T ...------- -------.-G ..GC- ...GG C---- ...-- ------.TTG
PARADOXA1546 C.ATTTG ..A ACT.ACC--T ...-.----- ---------G ·.GC- ...GG C---- ...T- ---- ...TTG
ADIPOSA1622 C.ATTTG ..A ACA.ACC-TA ...T-- ..-- ---------- ·.GC- ...GG C-GT-- ..T- ----- ..TT.
FAGACEARUM2651 C.ATTTG ..A ACA.ACC-.A .-.TTT.TT. CTCTAAT.-- ..GC- ...GG C~--- ....A ------.TT.
PETRIELLA C.CTTTG ..A ACC.TACC-A --.T.T ..-- -- ....---G .CTCGGC-GG -GGTT ..--- --C-- ..CCA
I-'
IV
ID
80 90 100 110 120 130 140
ALBOFUNDUS2475 TACCGC-TAG -CCACC---- ----AGCAGC ATACA--AG- TCTTTTACCA CTAT---AAA -C-CTTCTGT
ALBOFUNDUS51639 ...... - ... - .....
ACACIA4101 .-GAAGAG.. GG G--C TGCC - -..--TT ..- -CG G.--- '-.T TAT.
IPOMOEA854 .-GAAGGG.. GG G--C TGCC - -..--TT ..- --C '" .--- -.T T.--
PLANE2220 .-GAAGGG-- -- G--C TGCC - -..---T ..- --CG G.--- -.T ----
PLANE51830 .-GAAG---- -- G--C TGCC - -..---T ..- --CG G.--- -.T ----
CONG04783 .-GAAGAG.. G- G--C TGCC - -..---T ..- --CG G.AAA A.T TAT.
CONG04769 .-GAAGAG.. GG G--C TGCC - -..---T ..- --CG G.AAA A.T TAT.
BRAZIL4900 .-GAAGAG.. GG G--C TGCC - -..--TT ..- '" .-CG G.--- -.T T-T.
BRAZIL4901 .-GAAGAG.. GG G--C TGCC - -..--TT ..G ....CGG G.--- -.T T-T.
VIRESCENS0460 GTAACA---- --..AGTC-- TGCCG.T ..- - A.T T.T.
EUCALYPTI639 GTAACA---- -- ..AGTC-T TGCCG.T ..- -..------- -.T T.T-
COERULESCENS666 GTAAAA---- -- ..AGTC-- TGCCG.T ... --.TTT-.-- A.T T---
PARADOXA1546 G------G.T T--------- TGCCG.T ..- .-.AAC-... -.T ...T---
ADIPOSA1622 GG-----G.T TG-------- TGCCG.T ..- - -.T T.--
FAGACEARUM2651 .TT-CTTC.. GGG.TGTTTC TGCC ..T ..- -..TTT-.-- -""'1'"-------. A.T T.T-
PETRIELLA A.-- ..T.CT C..-G.CGG- ---C ....-. -.--------
t-'
Wo
150 160 170 lBO 190 200 210
ALBOFUNDUS247S --AT-ATT-T TTTAAAA--T TTTT-AAAA- --ATTGCTGA GTGGCAT--A A-CTATAAAA A-AAGTTAAA
ALBOFUNDUSS1639 -- . .- . .. - · ...... -- . ·... - .... - -- ........ · ...... -- - · . -
ACACIA4101 --..T ...T. -C..--GA-. ·...------ -C ........ ·... -- - -
IPOMOEABS4 --..T ...T. -C..--GA-. ·...------ -C........ · ... -- -
PLANE2220 --..-...T. -CC.--GA-. ·...T----- -C ........
PLANES1830 --..-...T . .CC.--GA-. ·...T----- -C........ · ...... -- - · .
CONG047B3 --.C----T. ·C ..--GA-. ....------ -C........ · . -- -
CONGO·4769 --.C----T. ·C ..--GA-. ·...------ -C.... -- - -
BRAZIL4900 --..T ...T. -C..--GA-. ·...------ -C........ · ...... -- - · ....... -
BRAZIL4901 --..T ...T. -C..--GA-. ·...------ -C ..
VIRESCENS0460 TT--- ...-- -C....GAA. .----.---T TC ........ .......T-. .-.-....-- -T.
EUCALYPTI639 ----- ...T- -C..G.GAA. .----.---T TC ........ .......T- . .-.-....-- -T.
COERULESCENS666 --..-...T- -C..G.GAA . .----.---T TC .....,.. .......T- . .-.- ....-- -T.
PARADOXA1S46 --..-...·T--C..G.GAA . .----.---T TC ........ .......T-. .-.--....- -T.......
ADIPOSA1622 --.-- ...T- -C..G.GAA. .----.---T TC ........ ·.T....TT . .-.---...- -T.- ......
FAGACEARUM26S1 --.-- ...T- -C ..G.GAA. .----.---T TC ........ ·.T....TT . ...,-..-...- -T.-.
PETRIELLA --.-- ...T. A.AGCG--GA ·.---.T.-- -C- ..-.... A.ACA ..--. --.--- .... -C ..A.A.
.......
(;.)
.......
220 230 240 250 260 270 280
ALBOFUNDUS2475 ACTTTCAACA ACGGATCTCT TGGCTCTAGC ATCGATGAAG AACGCAGCGA AATGCGATAA GTAATGTGAA
ALBOFUNDUS51639 .. .. .. .. .. .. .. .. .. .. .. .................. .................... .. .................. · ..
ACACIA4101 .................... .. .................. .. .................. .. .................. .. ..........
IPOMOEA854 .................... .. .. .. .. .. .. .. .. .. .. .. .................. .. ................
PLANE2220 .................... .. .................. .................... .. ..................
PLANE51830 ·.. .. .. .. .. .. .. .. .. .. .. .................. .. .................. .N ........ .. ......
CONG04783 .. .. .. .. .. .. .. .. .. .. .................... .. .................. .. .................. .. ......
CONG04769 .. .. .. .. .. .. .. .. .. .. .. .................. .................... .. .................. .. .................. .. .................. .. ................
BRAZIL4900 .. .. .. .. .. .. .. .. .. .. .................... .. ..................
BRAZIL4901 ·.. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .......... '" ........ .. ................
VIRESCENS0460 .. .. .. .. .. .. .. .. .. .. .. .................. .. .. .. .. .. .. .. .. .. .. .. ................. ................... ......... C
EUCALYPTI639 .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .................... .. .................. .. .................. ......... C
COERULESCENS666 .. .. .. .. .. .. .. .. .. .. .. .................. .. .................. .................... .. .................. ......... C
PARADOXA1546 .. .. .. .. .. .. .. . . . · ......... ·......... · ......... · .. _ ...... ......... C
ADIPOSA1622 · ......... · ......... ·........
FAGACEARUM2651 · ......... · ......... · ......... · ......... · .... _ .... o_
PETRIELLA · ......... · ......... ...T ...G.
>-'
W
IV
290 300 310 320 330 340 350
ALBOFUNDUS2475 TTGCAGAATT CAGTGAATCA TCGAATCTTT GAACGCACAT TGCCCCTGG- TAGTATTCTG CCAGGCATGC
ALBOFUNDUS51639 · ....... " " ........N . ......N ... · " " " " " . ..NN.....-
ACACIA4101 · . " . " " " " " " . " . " " . " " .. " " " . " " " " " " · " . " " " . " ••• G .•... G C ••.•..•...•
IPOMOEA854 · " . " " " .. " . " " " . " " " " . " " " " " " " " " " . " " " . " " ... G ..•.. - C .
PLANE2220 " . " " " " " " " . . " " " " " . " " " . " " . " " . " " " ·.
PLANE51830 " " " ... " " " " " " " " " " " " " . ...NN ...N.
CONG04783 · . . .. ·
• •. G •.... - C ••.......
" " " " " " . " " " " " " " " ..• G .•••. - C .••••....
CONG04769 " . " . " " " " " " " . " " " . " " " " " " " " " " " " " " " " " " " " " .•• G •.•.. - C .••.•••••
BRAZIL4900 " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " ••. G ..... - C .....••.•
BRAZIL4901 " " " " " ••. G •••.. - C ••...••.•
VIRESCENS0460 " .. " " " " " " " " " " " " " " " " " " " " " " " " " " " " · . ••. G •.... - C .•••.•...
EUCALYPTI639 " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " .•• G ••••. - C ...••.•.•
COERULESCENS666 " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " ••• G ••... - C .
PARADOXA1546 " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " ••• G - C ..•...... .... . T ....
ADIPOSA1622 " " " " " " " " " " " " " " " " " " " " ••• G - C .
FAGACEARUM2651 " " " " " " " " " " " " " " " " " " " " " " " " " " " " " •.. G A.- ·C .•••....•. T .
PETRIELLA " " " " " " " " " " " " " " " " " " " ... G .• C .• - C .••. A G .•.••..
I--'
W
W
360 370 380 390 400 410 420
ALBOFUNDUS2475 CTGTCCGA-G CGTCATTTCA CCACTCAA-G ACTT-GCTTT --AGTT-TTG GT-GTT-GGA GGTCCTGTTC
ALBOFUNDUS51639 .... N ... -. . . . . . . . . . . ............... - . .. ...... - .. ........ -- ........ - . .. · .- . .. - . .... .. ..............ACACIA4101 . .. .. .. .. .. .. .. - .. .. .. .. .. .. .. .. .. .. .. .............. - ...... --- ........ T-- ...C ... .GC ...G.
IPOMOEA854 .. .. .. .. .. .. .. .. - .. .................. ................ - .-..--A ..C T--- ..C ... ·-C ...- ... .. ................
PLANE2220 ................ - .. .................. ....... .G. ·..CC-- ... --- ...C ... ·-C ...- ... .. ............
PLANE51830 .. .. .. .. .. .. .. .. - .................... ........ G. ·..CC-- ... --- ...C ... ·-C ...- ... .. ..................
CONG04783 ....... .A. . .. .. .. .. .. .. .. .. .. .. .............. - .-..--A ..C T--- ..C ... ·-C ...- ... ..................
CONG04769 ................ - .. .................... .. .............. - .-..--A ..C T--- ..C ... .-C. -
BRAZIL4900 .. .. .. .. .. .. .. .. - .. .................. ................ - ·.. --- .. ...... T-- ...C ... ·-C ...-
BRAZIL4901 .. .. .. .. .. .. .. .. - .................... .. .............. - · .. --- .. ...... T-- ...C ... ·-C ...- ... A.
VIRESCENS0460 .. .. .. .. .. .. .. .. - .................... .. .............. - - ..CC ....- ---.G.G ..- ------- ... ·.A...... -
EUCALYPTI639 .. .. .. .. .. .. .. .. - .. .................. ................ - - ..CC ....- ---.G.G ..- ------- ... ·.A.- .CG-.
COERULESCENS666 ................ - .. .................. .. .............. - -..CT ....- ---.G.G ..- ------- ... ·.A. -----
PARADOXA1546 .. .. .. .. .. .. .. .. - .................... .. .............. - - ..CT ....- ---.GCG ..- ------- ... ·.A. -----
ADIPOSA1622 .. .. .. .. .. .. .. .. - .................... .. .............. - - ..CT ....- ---.G.G ..- ------- ... ·.A. -----
FAGACEARUM2651 .. .. .. .. .. .. .. .. - .. .................. ................ - -.C.T ....- ---.G.G ..- .------- ... ·.A..-----
PETRIELLA ................ - .. .................. A.C ...G.-. C ..AA.- ... T--- ..AAA- --C-.--.A. ·.AT.G ..GT
I-'
W
.p.
430 440 450 460 470 480 490
ALBOFUNDUS2475 -TT----ACC CTTC-----T GAA-CAGGCC -GCCGAAATG CATCGGCTGT TATTTTTACT TGCCAACTCC
ALBOFUNDUS51639 .... -----C ... - .
ACACIA4101 -. ------ --. ----- .... - .. T .
IPOMOEA854 - .. ------ .... -- .. ----- ...... - ..
PLANE2220 -.------ ... . --.----- . .. .. .. - .. T .
PLANE51830 - .. _----- .... -- .. ----- ...... - .. T .
CONG04783 - .. ------ -- .. ----- ...... - ...... - .... T .
CONG04769 - .. ------ .... -- .. ----- ...... - .. T .
BRAZIL4900 - .. ------ .... -- .. ----- .... ,. - . T •....... G
BRAZIL4901 - .. ----- .. T .
VIRESCENS0460 G ..TTC---- ---------- -..- -A . . .. -.G .. T.
EUCALYPTI639 A.-------- -A---- TG.G G- . . .. -.G .. T.
COERULESCENS666 -----CGCAT ----Gc ..G. CA . ...----.T. . .. - .G .. T .
PARADOXA1546 -----CGC-- G..-TGC--- ------ ..G. C......... A......... ..---- .... ...-.G ..T.
ADIPOSA1622 -----CGC-- ----TG---- TC.AGC ..G. C AG---- ..T -.G ..T.
FAGACEARUM2 651 -----C-CA- GT-CA-- -C.AGC-.G. CA -.G--- ..T -.G ..T.
PETRIELLA T-----G--- G--G--G-CG CT.- ...CGG TT.T----.C GG-A.CAGC. GTAGG--C.C ..-A..TA.-
......
W
UI
500 510 520 530 540 550 560
ALBOFUNDUS2475 CC-TGTGTAG TACAAGATTT T-TTAAATTT TTACGCTTT- GGAGTGCTTG TGTAACAT-G CCGT--TAAA
ALBOFUNDUS51639 · .- · ...... · ......... - . ....... ·........ - . ......... · ......
ACACIA4101 · . - · ...... ·.T..A.- .. .C.--..... .-..A ....- .A...T .... ·......C-. :..C--.
IPOHOEA854 · .- · ...... ·.T..A.- .. .C.--..... '" .A....- .A...T .... .......C-. ·..C--.
PLANE2220 · .- ·...... ·.T..A.- .. .C. -- ..... ....A ....- .A...T .... · ...... C-. · .. C--.
PLANE51830 • • -lO •••••• ·.T..A.- .. .C.--..... .,..A ....- .A...T .... · ...... C-. G ..C-- ....
CONG04783 -- · ...... ·.T..A--- . . C. --- .... .-..A ...--
· .A...----- ---------- ----------CONG04769 · .- ...... ·.T..A-- .. •C. -- ..... --..A ...-- .A...-.... ...T ...C-.
BRAZIL4900 · .- · ...... ·.T..A.- .. .C. -- ..... ....A ....- .A...T .... · ...... C-. · .. C--.
BRAZIL4901 ·.- ....... ·.T..A.- .. .C.--..... ....A ....- .A...T .... · ...... C-. · .. C--.
VIRESCENS0460 • • -lO •••••• --T..T ..-- -C.---..-- '" .A....- .A.ACT.... .ACT. -
EUCALYPTI639 • • -lO •••••• --T..T .... ------. lO-- lO •••••••• - .A.ACT.... .ACT....-.
COERULESCENS666 · .- · ...... --T..T .... ------.--. ·........ - .A.ACT...A .AC.....-. ·..---.T.
PARADOXA1546 ., - .. C .... --T..---.. .----- ..-G · ......... - .A.ACT.... .ACT....-. ·..---.T ..
ADIPOSA1622 .. - .. C .... --T..A.C .. .G.------G ·........ - .A.CCT.... .AC .....-
FAGACEARUH2651 .. - .. C .... ·.-..AC ... .G.------G ........-C .A.ACT.... .ACG....T .
PETRIELLA -------- .. .GGCG.-.CC CGCCGC---- -GG...---- ------ ...- --CT-----. .-..AG .
......
UJ
0'1
137
Figure 6: Phylogram generated using the Heuristic search option, with no branch
swopping, in PAUP. Bootstrap confidence intervals are indicated at the branches of the
tree. Isolates sequenced in this study appear in bold type.
138
~ ALBOFUNDUS247S
~ ALBOFUNDUSS1639
ACACIA4101
r CONG04783
82
I--
~ ..C.ONG04769
I-- BRAZIL4901
BRAZIL4900
83 - PLANE2220
- PLANES1830
- IPOMOEA8S4
~ VlRESCENS0460
98
EUCALYPTI639
~ COERULESCENS666
PARADOXA1S46
ADIPOSA1622
FAGACEP-.F..UM265 1
PETRIELLP...

140
5
MOLECULAR COMPARISON OF A SEIRlDIUM SPECIES FROM
ACACIA MEARNSIIWITH THE CYPRESS CANKER PATHOGENS
ABSTRACT
During a disease survey of Acacia mearnsii (black wattle) in South Africa, isolates of an
unknown Seiridium sp. were collected from stem cankers. This species is morphologically
indistinguishable from Seiridium spp. responsible for Cypress (Cupressus spp.) canker.
The latter disease occurs in South Africa and many other parts of the world. The aim of
this study was to compare isolates of the Seiridium sp. from A. mearnsii with those of S.
cardinale, S. cupressi and S. unicorne associated with cypress canker. The ribosomal
RNA operon was used for the molecular comparisons. Representative isolates from
Cupressus spp. and A. mearnsii were also inoculated into Cupressus lusitanica and A.
mearnsii to determine their relative pathogenicity to these hosts. Results obtained from
this study suggest that the Seiridium sp. from A. mearnsii is very closely related to those
causing cypress canker. Data also provide further support for the view that only one
Seiridium sp., or closely related species that has only recently speciated, is associated with
cypress canker.
141
INTRODUCTION
The genus Seiridium Nees ex Fr. is characterized by the formation of six celled,
appendaged conidia in acervuli (Sutton, 1980). The genus is best known for the species
causing cypress canker ofCupressaceae in many parts of the world (Swart, 1973; Graniti,
1986; Wingfield & du Toit, 1986). It has been suggested that cypress canker originated
in the United States, where the host is native (Swart, 1973), but the disease has been
reported from Africa, Australia, New Zealand, Japan and Europe (Rudd Jones, 1953;
Nattrass, Booth & Sutton, 1963; Swart, 1973; Raddi & Panconessi, 1981; Boesewinkel,
1983; Tabata, 1991; Tisserat, 1991). Hosts of these pathogens include species of
Cupressus, Chamaecyparis, Juniperus and Thuja (Swart, 1973), as well as species of
Rhus, VUis, Malus, Taxodium and many more (Boesewinkel, 1983; Graniti, 1986;
Tisserat, 1991).
The taxonomy of Seiridium unicorne (Cke & Ell.) Sutton, S. cardinale (Wagener) Sutton
& Gibson and S. cupressi (Guba) Boesewinkel has been the subject of considerable
debate, for many years. The number of species causing cypress canker, and the correct
name to use for this species, or species, have been the subject of many debates (Guba,
1961; Swart, 1973; Boesewinkel, 1983; Graniti, 1986).
The first record of cypress canker reports the causal agent as Pestalozzia unicornis Cke &
Ell. from diseased Chamaecyparis thyoides (L.) in North America in 1878 (Boesewinkel,
1983). Later, two other fungi, from Africa and New Zealand, were, however, also
described as the cause of cypress canker, using the names of Monochaetia unicornis (Cke
& Ell.) and Coryneam cardinale (Swart, 1973; Graniti, 1986). The species name
"cupressi" first appeared in connection with cypress canker in 1961 (Guba, 1961).
The main criteria by which the three Seiridium spp. are separated include the orientation
of the appendages and differences in the development of the appendages. Boesewinkel
(1983) reported that the appendages of S. unicorne are formed at right angles to the
142
median septurn, either endogenously or exogenously. Appendages of S. cupressi follow
the curve of the conidia and may be formed either endogenously or exogenously.
Seiridium cardinale lacks appendages, or when they are present, they are much shorter
than those of the other two species. Chou (1989), confirmed previous reports (Swart,
1973), that the appendages in all species are formed only endogenously. Considerable
differences in cultural appearance and geographic distribution were also noted between the
three species (Boesewinkel, 1983). There have, however, been many arguments for the
existence of only two species (Sutton, 1980; Chou, 1989), and also the view that only one
morphologically variable species is associated with cypress canker (Swart, 1973; Viljoen,
Wingfield & Wingfield, 1993; Roux, 1996).
During disease surveys of Acacia mearnsii de Wild in South Africa, a species of Seiridium
was regularly isolated from stem cankers and wood of diseased trees (Roux & Wingfield,
1997). The aim of this study was to compare isolates of the Seiridium sp. from A.
mearnsii with cypress isolates, based on sequence data of the rRNA operon and
morphological comparisons. The pathogenicity of isolates from A. mearnsii and
Cupressus spp. on A. mearnsii and Cupressus lusitanica was also compared.
MATERIALS AND METHODS
Isolates
Isolates used in these studies originated from diseased A. mearnsii trees, as well as from
cankers on Cupressus spp. from New Zealand, Greece, Italy, Portugal and South Africa
(Table 1). These isolates are maintained in the culture collection of the Tree Pathology
Co-operative Programme (TPCP), Forestry and Agricultural Biotechnology Institute
(FABI), University of Pretoria, South Africa.
143
Morphological comparisons
Isolates from A. mearnsii were grown on Potato Dextrose Agar (PDA) (39 g Difco PDA
in 1000 ml distilled H20) at 25°C and the morphology was examined using a Zeiss
Axioskop light microscope. Measurements (fifty of each characteristic structure) were
made on mature conidia with 4 coloured median cells and intact apical and basal
appendages only. These measurements were compared with characteristics of Seiridium
spp. associated with cypress canker (Table 2) (Sutton, 1980; Boesewinkel, 1983; Graniti,
1986).
Growth rates were determined on PDA at la, 15,20,25 and 30°C respectively. The PDA
plates were inoculated with 4 mm discs removed from the margins of actively growing
colonies and placed, face down, at the center of the plates. Colony diameters were
measured after la days. A total of 5 plates were incubated for each isolate at each
temperature. Two diameter measurements were obtained from each colony, perpendicular
to each other. A total of la measurements were thus taken at each temperature for every
isolate studied, and the mean growth computed.
DNA isolation and amplification
Cultures used for DNA sequence comparisons included 6 isolates from cypress canker and
6 isolates from A. mearnsii (Table 1). Isolates were grown in liquid culture of 20 ml 2%
MEA (Biolab Malt Extract Agar) in 50 ml Erlenmeyer flasks on shaking incubators at
25°C for 10 days. The mycelium was collected, by removing the MEA, and then
lyophilized. DNA was isolated using the technique of Raeder & Broda (1985) with some
amendments. Small pieces of lyophilized mycelium were transferred to sterile 1.5 ml
Eppendorf tubes and 100 ul of Extraction buffer (200 mM Tris-HCL, pH 8.5; 250 mM
NaCl; 25 mM EDTA; 0.5% SDS) added. The tubes were emersed in liquid nitrogen and
the mycelium ground into a fine powder with a mini pestle. Another 400 f..llof extraction
buffer was then added and the mixture was incubated in a water bath at 65°C for 5 min.
144
The aqueous phase was collected after centrifugation and phenol/chloroform extractions
were performed until the interface was completely clean. The aqueous phase was further
extracted with chloroform and the DNA precipitated with sodium acetate (3 M) and 0.45
vol. isopropanol at -20°C. The pellets were rinsed with 70% ethanol, dried and the DNA
resuspended in 100 J...I.I water.
The internal transcribed spaeer regions of the 5.8S gene of the ribosomal RNA operon
(rRNA) were amplified using the Polymerase Chain Reaction (PCR) (Saiki et al., 1988).
Primers ITSl (5'TCCGTAGGTGAACCTGCGG3') and ITS4
(5'TCCTCCGCTTATTGATATGC3') were used for the amplification reactions (White et
al. 1990). PCR reactions were carried out on a Omnigene Temperature Cycler (Hybaid,
Middlesex, UK). An initial denaturation step was performed at 96°C for 5 min, after
which the temperature was lowered to 90°C until the Taq polymerase (Boehringer
Mannheim, South Africa) was added. Primer annealing was done at 55°C for 30 sec,
chain elongation at 72°C for 1 min and denaturation at 92°C for 1 min. These steps were
repeated 35 times. Final chain elongation took place at 72 °C for 5 min, followed by 2
min at 37°C. All PCR products were visualized under UV light on a 1% agarose gel
stained with ethidium bromide. The amplified DNA fragments were purified using the
Magic PCR Preps Purification System (promega Corporation, Madison, USA).
DNA sequencing
Purified PCR products were sequenced in both directions using an ABI PRISM™ 377
Autosequencer (perkin-Elmer). Sequence reactions were carried out with an ABI
PRISM™ Dye Terminator Cycle Sequencing Kit with Amplitaq®. DNA Polymerase, FS
(perkin-Elmer, Warrington, U'K). The sequences obtained were aligned manually by the
insertion of gaps.
The DNA sequence data were analyzed using PAUP (phylogenetic Analysis Using
Parsimony) (Swofford, 1985) and DNA BOOTSTRAP analysis (bootstrap confidence
145
intervals on DNA parsimony) (Felsenstein, 1988). The heuristic search option of PAUP,
with no branch swopping, was used to find the most parsimonious tree. DNA sequence
data for Pestalotiopsis maculans (Corda) Nag Raj (CBS 322.76) was used as outgroup,
since the genus Pestalotiopsis belongs to the same sub-order as Seiridium
(Blastostromatineae), with pigmented conidia produced in acervuli (Sutton, 1980).
Sequence data were also analyzed using Unweighted Pair-Group Mean Arithmetic
Analysis (UPGMA) to confirm PAUP results (PHYLLIP Version 3.5 72C) (Felsenstein,
1993). Distances between isolates were calculated using DNADIST and UPGMA was
used to analyze the distance matrix and generate a dendogram. Data obtained in this study
was also compared with data from a previous study in which Se iridium species from
Curpressaseae were considered (Viljoen et al., 1993). This was done to compare the A.
mearnsii isolates with more isolates from Cupressus hosts.
Pathogenicity trials
To compare the pathogenicity of Seiridium isolates from Cupressus and A. mearnsii, C.
lusitanica and A. mearnsii trees were inoculated with 3 test isolates. Isolates CMW4152
and CMW4149 from A. mearnsii and CMW4723 from C. lusitanica were used in the
pathogenicity trials.
During January 1998, twenty 18-month-old A. mearnsii trees were inoculated with each
isolate. The trial was established on the Bloemendal Experimental Farm,
Pietermaritzburg, South Africa (29° 32. 93S; 30° 27. 33E). Isolates were grown on 2%
potato dextrose agar (PDA) (Difco) at 25°C for 2 weeks. Mycelial plugs, 9 mm in
diameter, were removed from each culture and inoculated into the trees by removing a
piece of bark of equal size, so that the fungus came into contact with the cambium.
Twenty trees were inoculated with sterile agar to serve as controls. Each wound was
sealed with masking tape to prevent desiccation of the inoculum and wound. Lesion
lengths were measured after 6 weeks. The trial was repeated during February 1998.
146
Side branches, approximately 2 to 3 cm in diameter, of 10 C. lusitanica trees were
inoculated with the same isolates during January 1998. The same inoculation procedure
as was used for inoculating the A. mearnsii trees was used. For each isolate, 2 side
branches were inoculated per tree. Control inoculations with sterile agar were included on
1 branch of each tree. Lesion lengths were measured after 8 weeks, by removing the outer
layer of bark and measuring the size of lesions in the cambium. Data obtained from the
pathogenicity trials were statistically analyzed for differences between isolates· using
Tukey's Studentized range (P=O.05).
RESULTS
Morphological comparisons
Isolates of the Seiridium sp. from A. mearnsii have conidia with appendages most
commonly arranged at an angle following the curve of the conidium, or arranged
perpendicular to the median septurn (Fig. I). Conidial sizes of the A. meamsii isolates
ranged from 23 - 40 urn in length and 4 - 10 urn in width. This makes them similar in size, .
and indistinguishable from S. unicome isolates associated with Cypress canker.
Considerable variation was, however, found in the appendage morphology of the isolates
examined, with conidia from the same acervuli having appendages oriented perpendicular
to the median septum, or following the curve of the conidium (Fig. 2). Within these
acervuli, conidia with very short appendages (± 1-2 urn) were also found.
In growth studies, most isolates from A. meamsii and from Cupressus spp. had growth
optima at 25°C. The exceptions were CMW3904 and CMW2092 at 15°C and CMW4251
at 20°C. Acacia isolates grew poorly, or did not grow, at 30°C, while all the Cupressus
isolates grew at this temperature (Table 3).
147
DNA Sequence analysis
DNA amplification resulted in a single DNA fragment. After alignment and insertion of
gaps, 402 base pairs were used in further analysis (Fig. 4). The Heuristic search option
was used in PAUP to produce a single tree. Values for the consistency index (Cl),
homoplasy index (HI) and retention index (RI) were 0.834, 0.61 and 0.412 respectively
(Fig. 5). No differences were found between the three authenticated Seiridium spp. or
between the A. mearnsii isolates and those from Cupressus spp. (Fig. 5). With the
exception of isolates CMW4151 and JP1758, the A. mearnsii isolates formed a sub-clade
on their own. Isolate JP1758, from A. mearnsii, grouped with isolate CMW2I09 from
Cupressus.
The bootstrap analysis showed that the Seiridium isolates group together with abootstrap
value of 100%. Comparison of the sequences obtained from this study, with published
sequences of Viljoen et al. (1993), confirmed that the A. mearnsii isolates group with the
isolates of Seiridium spp. from Cupressus. The A. mearnsii isolates grouped in the same
clade as S. cardinale from Italy and S. cupressi from Greece.
When data were analyzed using UPGMA, isolates clustered in two major clades (Fig. 6).
There were no obvious differences between isolates from A. mearnsii and Cupressus.
Seiridium cardinale from Italy (CMWI644) formed a clade together with isolate
CMW4150 from A. mearnsii. All other isolates formed one larger and well resolved
clade.
Pathogenicity trials
Lesions were produced on both A. mearnsii and C. lusitanica, by both the Acacia and
Cupressus isolates (Table 4, Fig. 3). On A. mearnsii, lesions produced by the two Acacia
isolates differed significantly from those of the Cupressus isolate in the January 1998
inoculations (P=O.05) (Table 4). Isolates CMW4149 and CMW4152, from A. mearnsii,
148
produced larger lesions than isolate CMW4723 from Cupressus. In the February 1998
inoculations, lesions produced by CMW4149 from A. mearnsii, again differed significantly
from that of CMW 4723 from C. lusitanica. There were, however, no significant
difference between isolates CMW4723 and CMW4152. All lesions associated with
Seiridium isolates differed significantly from those of control inoculations. Lesions
produced by all isolates tested, were also much larger on C. lusitanica than on A.
mearnsii.
DISCUSSION
In this study, evidence is provided to support the view that the Seiridium sp. from A.
mearnsii is the same as the species, or species complex, causing cypress canker. Results
also support the view that only one species of Seiridium, with morphological variation,
causes cypress canker (Swart, 1973; Viljoen et al., 1993). This study has further shown
that these Seiridium spp. all have the ability to cause lesions on both A. mearnsii and C.
lusitanica, when inoculated into these trees.
Seiridium unicorne is reported to have a wide host range beyond the Cupressaceae,
including Rhus, Tamarix, Pyrus, Malus and others (Guba, 1961; Boesewinkel, 1983;
Graniti, 1986). It is, therefore, not surprising that this species was isolated from A.
mearnsii. In contrast, S. cardinale, has only been found in association with Cypress
canker (Boesewinkel, 1983; Graniti, 1986). This, together with the morphological
differences, has been used to support the view that these fungi represent distinct species.
The findings of Viljoen et al. (1993), that S. cardinale, S. unicorne and S. cupressi,
probably represent morphological variants of a single species, were, therefore, somewhat
inconsistent with published morphological, cultural and geographical data. In this study,
we have shown that based on sequence data, it is not possible to distinguish isolates of the
Seiridium sp. from A. mearnsii, which in its most common morphological manifestation, is
identical to S. unicorne. The wide host range that has previously been reported for S.
149
unicome also supports our view that the fungus is the same as the one that we commonly
isolate from A. mearnsii.
S. cardinale is known to occur only on Cupressus (Boesewinkel, 1983; Graniti, 1986)
and its spores are generally, but not always, free of appendages (Sutton & Gibson, 1972;
Boesewinkel, 1983). This suggests that the fungus is different to other Seiridium spp. on
Cupressus. The fact that our sequence data suggest that it is the same as S. unicome and
the Seiridium sp. from A. mearnsii, is enigmatic.
The use of appendage orientation as a taxonomic character appears to be unreliable. It
has been reported by Viljoen et al. (1993) and Roux (1996) that conidia with differing
appendage orientation could be found within the same acervuli. Similar findings have been
made for the genus Seimatosporium Cda., where conidia without appendages are often
found amongst those with appendages (Swart, 1973). This may explain the presence of
non-appendaged conidia in S. cardinale, and supports the view of Swart (1973) that S.
cardinale, S. cupressi and S. unicome represent a single, morphologically variable species.
From pathogenicity tests, it was shown that the Seiridium spp. considered in this study are
capable of causing lesions of similar magnitude on A. mearnsii and on Cupressus
lusitanica. These data are reasonably unequivocal for inoculations on A. mearnsii, where
sufficient trees were available to allow a reasonable number of replication and repetition of
the trial. The smaller number of inoculations on Cupressus arose due to the fact that these
trees are valuable omamentals in South Africa and not commonly available for
inoculations. Results should be viewed with a knowledge of this constraint. However, the
fact that both the Acacia and Cupressus isolates of Seiridium produced lesions on both A.
mearnsii and C. lusitanica supports molecular and morphological data, suggesting that the
Seiridium from A. mearnsii belongs to the same, or a very similar taxon as the fungus
causing cypress canker. The fact that the Acacia isolates produced larger lesions on A.
mearnsii than did the Cupressus isolate, suggests that adaptation to their new host has
occurred. It is possible that these isolates might have spread to A. mearnsii from
150
Cupressus or visa versa, which would account for the fact that lesions were also formed
on C. lusitanica.
Molecular techniques, if used correctly, can be valuable in clarifying difficulties in
taxonomy (Crawfordt et aI., 1996; Wingfield et aI., 1996). Direct sequencing of target
areas of DNA, using PCR have proven especially useful. This technique has a ·high level
of resolution and allows the sequencing of both strands of DNA (Bruns, White & Taylor,
1991). The ribosomal RNA operon is an extremely useful source of genetic data for
taxonomic comparisons (Blanz & Unseld, 1986; Kurtzman, 1992). The internally
transcribed spaeer region (ITS) of the rRNA operon is variable and can be used at low
taxonomic levels such as to distinguish different species of fungi (Chambers, Dutta &
Crouch, 1986; Bruns et al., 1991; Hibbet, 1992; Mitchell, Roberts & Moss, 1995;
Wingfield et al., 1996; Witthuhn et al., 1998).
The fact that sequence data fails to separate species of Seiridium that have minor, yet
obvious, morphological differences, or different hosts, might suggest that these fungi are
very similar, but that they have speciated recently. This would be similar to the situation :
with Ceratocystis laricicola Redfurn & Minter and C. polonica (Siemaszko) Moreau,
which are morphologically identical fungi that occur on different hosts and have different
insect vectors (Harrington et al., 1996). They cannot be separated based on analysis of
ITS sequence data (Witthuhn et al., 1998), but differ at one isozyme locus (Harrington et
al., 1996). Comparison of Seiridium spp. considered in this study, using a range of
techniques, including sequences of other parts of the genome, should provide even more
insight into the evolution of this group of pathogens.
For the present, all evidence suggests that the fungus from A. mearnsii and those causing
canker of Cupressus spp. are the same. These results reiterate the conclusions of Viljoen
et al. (1993), that S. cardinale, S. cupressi and S. unicome represent one phylogenetic
entity. We, therefore, suggest that the Seiridium sp. from A. mearnsii be known as S.
cardinale, since this species name was first used for the cypress canker causing fungus in
151
the genus Seiridium. It is clear that morphological characteristics used for differentiating
species in Seiridium deserve re-evaluation. If these species have recently undergone
speciation, the degree of morphological variation, if any, that is sufficient to define taxa
must be determined.
152
REFERENCES
Blanz, P.A & Unseld, M. (1986). Ribosomal RNA as a taxonomic tool in mycology. In
The expanding realm of yeast-like fungi (eds.: G.S De Hoog, M.T. Smith, & AC.M.
Weijman), pp. 247-258. Elsevier Science, Amsterdam.
Boesewinkel, H.l (1983). New records of the three fungi causing cypress canker in New
Zealand, Seiridium cupressi (Guba) comb. nov. and S. cardinale on Cupressocyparis and
S. unicorne on Cryptomeria and Cupressus. Transactions of the British Mycological
Society 80, 544-547.
Bruns, T.D., White, T.l & Taylor, lW. (1991). Fungal molecular systematics. Annual
Review of Ecological Systematics 22, 525-564.
Chambers, c., Dutta, S.K. & Crouch, Rl (1986). Neurospora crassa ribosomal DNA:
sequence of internal transcribed spaeer and comparison with N intermedia and N
sitophila. Gene 44, 159-164.
Chou, C.K.S. (1989). Morphological and cultural variation of Seiridium spp. from
cankered Cupressaceae hosts in New Zealand. European Journal of Forest Pathology
19, 435-445.
Crawfordt, AR, Bassam, B.l, Drenth, A, Maolean, DJ. & Irwin, lAG. (1996).
Evolutionary relationships among Phytophthora species deduced from rDNA sequence
analysis. Mycological Research 100, 437-443.
Felsenstein, J. (1988). DNABOOT - Bootstrap Confidence Intervals on DNA parsimony
3.1. University of Washington.
153
Felsenstein, 1. (1993). PHYLIP (phylogenetic Inference Package), Version 3.5.
University of Washington.
Graniti, A. (1986). Seiridium cardinale and other cypress cankers. OEPPIEPPO Bulletin
16,479-486.
Guba, E.F. (1961). Monograph of Monochaetia and Pestalotia. Harvard University
Press.
Harrington, T.e., Steimel, l.P., Wingfield, MJ. & Kile, G.A. (1996). Isozyme variation
and species delimitation in the Ceratocystis coerulescens complex. Mycologia 88, 104-
113.
Hibbet, D.S. (1992). Ribosomal RNA and fungal statistics. Transactions of the
Mycological Society of Japan 33, 533-556.
Kurtzman, C.P. (1992). rRNA sequence compansons for assessing phylogenetic
relationships among yeasts. International Journal of Systematic Bacteriology 42, 1-6.
Mitchell, JJ., Roberts, P.l. & Moss, S.T. (1995). Sequence or structure? A short review
on the application of nucleic acid sequence information to fungal taxonomy. Mycologist
9,67-75.
Nattrass, R.M., Booth, C. & Sutton, B.C. (1963). Rhyncosphaeria cupressi sp. nov., the
causal organism of Cupressus canker in Kenya. Transactions of the British Mycological
Society 46, 102-106.
Raddi, P. & Panconesi, A. (1981). Cypress canker disease in Italy: Biology, control
possibilities and genetic improvement for resistance. European Journal of Forest
Pathology 11, 340-347.
154
Raeder, U. & Broda, P. (1985). Rapid preparation of DNA from filamentous fungi.
Letters in Applied Microbiology 1, 17-20.
Roux, J. (1996). Seiridium species isolated from Acacia mearnsii in South Africa. In A
preliminary study of the diseases of Acacia mearnsii de Wild in South Africa. M.Sc
thesis, pp52-69. University of the Orange Free State, South Africa.
Roux, J. & Wingfield, M.l. (1997). Survey and virulence of fungi occurring on diseased
Acacia mearnsii in South Africa. Forest Ecology and Management 99, 327-336.
Rudd Jones, D. (1953). Studies on a canker disease of cypress in East Africa, caused by
Monochaetia unicornis (Cooke & Ellis) Sacc.. I. Observations on the pathology, spread
and possible origins of the disease. Annals of Applied Biology 40, 323-343.
Saiki, R.K., Gelfand, D.A., Stoffel, S., Scharf, s.r, Higuchi, R., Hom, G.T., Mullis, K.B.
& ErIich, HA. (1988). Primer directed enzymatic amplification of DNA with a
thermostable DNA polymerase. Science 239, 487-491.
Sutton, B.C. (1980). The Coelomycetes. Fungi imperfecti with pycnidia, acervuli and
stromata. Commonwealth Mycological Institute, Surrey, England.
Sutton, B.C. & Gibson, lA.S. (1972). Seiridium cardinale. Commonwealth Mycological
Institute. Descriptions of Pathogenic Fungi and Bacteria No. 326.
Swart, HJ. (1973). The fungus causing cypress canker. Transactions of the British
Mycological Society 61, 71-82.
Swofford, D.L. (1985). PAUP (Phylogenetic Analysis using Parsimony). Version 2.4.1:
Champaign, IL.
155
Tabata, M. (1991). Distribution and host range of Seiridium unicorne in Japan.
Transactions of the Mycological Society of Japan 32,259-264.
Tisserat, N.A. (1991). A canker disease of Cupressaceae in Kansas and Texas caused by
Seiridium unicorne. Plant Disease 75, 138-140.
Viljoen, C.D., Wingfield, B.D. & Wingfield, M.l (1993). Comparison of Seiridium
isolates associated with cypress canker using sequencing data. Experimental Mycology
17, 323-328
White, T.l, Brons, T., Lee, S. & Taylor, J. (1990). Amplification and direct sequencing
of fungal ribosomal RNA genes for phylogenetics. In peR Protocols: A Guide to
Methods and Applications (eds. M.A. Innis, D.H. Gelfand, II Sninsky & TJ. White), pp.
315-322, Academic Press: San Diego, USA
Wingfield, M.l & Du Toit, I. (1986). Cypress canker caused by two Seiridium species in
South Africa. Phytophylactica 18, 43.
Wingfield, M.l, De Beer, C., Visser, C. & Wingfield, B.D. (1996). A new Ceratocystis
species defined using morphological and ribosomal DNA sequence comparisons.
Systematic and Applied Microbiology 19, 191-202.
Witthuhn, R.C., Wingfield, B.D., Wingfield, M.l & Wolfaardt, M. (1998). Monophylyof
the conifer species in the Ceratocystis coerulescens complex based on DNA sequence
data. Mycologia 90, 96-101.
156
Table 1. Fungal isolates used in the comparison of the Seiridium from A. mearnsii with
Seiridium spp. associated with cypress canker.
SPECIES CULTURE HOST ORIGIN
NUMBER8
Seiridium unicome CMW2109 C. horizontalis South Africa
" CMW1648 " Portugal
" CMW1502 C. glabra South Africa
" CMW806 C. lusitanica "
" CMW692 " New Zealand
S. cardinale CMW1644 " Italy
" CMW2092 C. horizontalis South Africa
" CMW2133 Cupressus sp. Chile
" CMW690 Cupressus sp. South Africa
Lepteutypa cupressi CMW1646 Greece
Seiridium sp. CMW4148 Acacia mearnsii South Africa
" CMW4149 " "
" CMW4150 " "
" CMW4151 " "
" CMW4152 " "
" CMW4153 " "
" CMW4154 " "
" CMW4155 " "
" CMW4157 " "
" CMW4159 " "
" JP1758 " "
" CMW3904 " "
" CMW4723 Cupressus lusitanica "
Pestaloti0e.sis maculans CBS322.76 Camelia sE. France
8 Isolates are maintained in the culture collection of the Tree Pathology Co-operative
Programme, Forestry and Agricultural Biotechnology Institute (FABI), University of
Pretoria.
Table 2: Comparison of important morphological characteristics of Seiridium cardina/e, S. unicorne, S. cupressi
and a Seiridium sp. from A. mearnsii.
MORPHOLOGICAL CHARACTERISTICSa
FUNGUS CONIDIUM CONIDIUM MEDIAN APICAL BASAL
LENGTH SOURCEWIDTH CELLS APPENDAGE
S. APPENDAGEcardinale OF DATA21 - 30 8-9 -b 1
S. (1)unicorne Sutton, 198024 - 28 8-9 18 - 22 11 - 19
S. 8 - l3unicorne Sutton, 1980(22-)25 - 27(31) 7 - 10 17 - 23 5 - 12 5 - 12 Boesewinkel,
S. cardinale 1983(21-)24 - 30(-31) 8 - 10 -b -b -b Boesewinkel,
S. cupressi 1983(25-)27 - 32(-37) 7 - 10 19 - 27 -b -b Boesewinkel,
S. cardinale 198321 - 30 8-9 17 - 21 -b -b Sutton &
Seiridium sp. Gibson, 197226 - 34 (30) 6 -7 (6.2) 17-24(21) 4 - 9 (7) 4 - 10 (5)
CMW4150 This study
Seiridium sp. 23 - 30 (27) 6 - 9 (8) 16 - 22 (20) 3 - 12 (8) 3 - II (7)
CMW3904
Seiridium sp. 24 - 38 (29) 6 -7 (7) 17 - 24 (20) 4 - 12 (7) 3 - 12 (6)
CMW4155
Seiridium sp. 24 - 35 (31) 6 - 7 (6) 17 - 26 (23) 4 - 10 (8) 4 - 9 (7)
CMW39l3
Seiridium sp. 24-31(27) 4 - 9 (7) 17-23(20) 4 - l3 (8) 3 - 9 (5)
CMW4159
Seiridium sp. 29 - 40 (33) 7 - 10 (8) 20 - 28 (24) 4 - 10 (8) 3 - 8 (6)
JP 1758
a All measurements are in urn
b Values not published
157
Table 3. Growth of S. cardinale (CMW609, CMW2092), and S. unicorne (CMW806, CMW1502, CMW2133) isolates
from Cupressus hosts, compared with those of Seiridium isolates from A. mearnsii.
ISOLATES a TRIAL 1 b,c TRIAL2 b,c
15°C 200e 25°C 30°C 15°e 200e 25°e 300e
CMW4150 25.97 be 29.39 be 27.00 de 12.51 d 21.41 be 28.00 be 31.33 e Od
CMW3904 23.72 e 23.39 e 21.79 f 7.11 f 22.70 b 22.21 e 20.01 e Od
CMW4155 8.93 d 11.41 d 14.84 g 7.00 f Of 12.73 d 20.70 de Od
CMW4151 26.38 ab 31.22 ab 32.81 e Og 23.81 ab 30.63 ab 34.38 be Od
CMW4157 13.52 d 13.45 d 13.88 g Og 8.25 e 12.20 d 16.96 f Od
CMW4152 22.40 e 23.52 e 20.95 f 7.72 f 18.87 e 23.60 e 20.32 de Od
JP1758 15.59 e 24.24 e 29.02 d Og 19.91 e 29.10 ab 31.44 e Od
CMW4153 26.40 ab 32.49 ab 25.32 e 10.32 e 24.72 ab 28.61 ab 32.36 e Od
CMW4154 26.51 abe 29.83 abe 27.38 de Og 25.82 a 31.12 ab 36.73 b Od
CMW690 26.89 a 33.41 a 40.30 a 28.52 b 25.91 a 32.97 a 52.86 a 10.65 e
CMW806 16.54 ab 30.07 ab 36.28 b 36.89 a 1l.89 d 28.21 b 3l.15 e 29.35 a
CMW1502 10.76 d 1l.39 d 12.21 g 10.90 e 6.96 e 10.51 d 10.93 g 14.15 b
CMW2092 27.36 be 26.43 be 23.44 ef 18.67 e 26.09 a 24.53 be 22.81 d 9.66 e
CMW2133 9.32 d 13.01 d 13.85 s 13.37 d Of 12.83 d 13.51 s 9.4ge
a Growth was measured after incubating cultures for 10 days in the dark. Each bar represents the mean of 20
measurements. Isolates fromA. mearnsii are in bold.
bEach value represents an average of 10 measurements.
"Each value with a different letter differs significantly from the others for that specific temperature range.
158
Table 4: Lesion lengths associated with inoculations using Seiridium isolates from A. meamsii and Cupressus spp.
ISOLATE HOST LESION LENGTH
C lusitanica a, b A. mearnsii b, c A. mearnsii": d
January 1998 February 1998
CMW4723 C. lusitanica 33.Ia 14.Ic 18.95b
CMW4152 A. mearnsii 31.2a 19.75b 17.4b
CMW4149 A. mearnsii 31.2a 22.2a 22.55a
CONTROL 17.0b IO.Od lac
a Each value is an average of 17 measurements. CV= 26.58%.
b Values followed by different letters differ significantly at P=O. 05.
C Each value is an average of20 measurements. CV= 16.5%.
d Each value is an average of 20 measurements. CV=17.2%.
159
160
Figures 1, 2: Conidial morphology of Seiridium isolates from A. mearnsii.
Fig. 1: Conidium with appendages at a right angle to the median septum.
Fig. 2: Conidium with appendages following the curve of the conidium.
Figure 3: Lesions produced on C. lusitanica after inoculation with Seiridium spp. from
C. lusitanica (A) and A. mearnsii (B). The third branch represents the control
inoculation.

162
Figure 4: Alignment of 402 bases of the lTS regions of the ribosomal RNA operon for 6
Seiridium isolates associated with cypress canker and six isolates from A. mearnsii. N
indicates an unknown base and gaps (-) indicate spaces necessary for the alignment of the
sequence. Dots indicate bases identical to the corresponding base in the P. maculans
isolate.
10 20 30 40 50 60 70 80
A.MEARNSII(41S0)
A.MEARNSII(4149) ---------- ------AAAA -GC'!'ACCCTGTACCT-ACC'!'GG-AAACAGC CTACCTGGAA GCNATCCGGG CTGGCCTACCTTTGTTGCCT CG-GC-.G .. A ......... - -
A.MEARNSII(41S1) · .... · ... · . · ...... · .......
-
TTTGTTGCCT CG-GC-.G.G A ..C ....-. ·.G.-
A.MEARNSII(4152) ·....- ..T. · ...... · .........-TTG---CCT CG-GC-.G .. · . -.G ...T.- · ........
A.MEARNSII(4148) · ....
- · ... · . - · ......TTTGTTGCCT CG-GC-.GG. · ......... ·.G.- · ........
A.MEARNSII(17S8) · ....
- · ... -
TTTGTTGCCT CG-GC-.GG. · . · .
- · ... · ....... - ·.G.
- · ........ -
SEIRIDIUM (4723) · .... · ... · .
- · ...... ·.... ,..G.
---------- ----C-.G .. ·.G......A- · ..... - -
S.UNICORNE-LINCOLN · . · .... · ...
- - · ... · ....... -
TTTGTTGCCT CGAGC-.G .. · . · . ·.G..T ....- ....A .... .. '" T.-
S.CARDINALE-ITALY · .... · ... · . - - · ... · ....... -TTTGTTGCCT CG-GC-.G .. -- · . ·.G....... - ·T ...- .... - - -
L.CUPRESSI-GREECE · . · ... · ....... -TT'I'GTTGCCTCGN-CG.G .. -- · ....... -
·.G.
·T ...- .... - - -
S.UNICORNE-PORTUGAL · . · ... · ....... -TTTGTTGCCT C-AGC-.G .. · . ·.G.- · ..... - - - -
S.UNICORNE-SA · . · .... · ... · . · ...... · .......TTTGTTGCCT CG-GC-.G .. ·.G.- · ..... -
P.MACULANS · . · ....
- · ... · . - · . - · ... · ....... -
ATTGTTGCCT CG-GC- .... A- ......G. ·.G.·....T .... T.G ....G .. ·....CT. T. ·.G-- ..--- -----'1'.
90 100 110 120 130 140 150 160
A.MEARNSII(41S0) -TGGAAACGG TCTGG-TGGT CGA----CTG CCGGTGGACC ATTCl\ACTCT TGTTl\TTTTA TTGTAATCTG AGCGTCTTl\T
A.MEARNSII(4149) - · ........ · .... -
A.MEARNSII(41S1) - · ........ · .... - . . . . . . .---- . ..
A.MEARNSII(41S2) · ......... . . . . . . . . . . ....... A.- · .... - · .. · .... -
A.MEARNSII (4148') - · ........ · .... -
A.MEARNSII(17S8) - · ........ '...C.G .... A---
SEIRIDIUM(4723) - · .... - · .. · .... -
S.UNICORNE-LINCOLN - · .... - · .. · .... -
S.CARDINALE-ITALY - · .... - · .. · .... -
L.CUPRESSI-GREECE - · ........ · .... -
S.UNICORNE-PORTUGAL - · .... - · .. · .... -
S.UNICORNE-SA - · .... - · .. · .... -
P.MACULANS C .....- ... CT .ACCCT .. -- .ACGG ... .........T .CCA ...... . . . . . . . . . .T .
f-"
0\
(JJ
170 180 190 200 210 220 230 240
A.MEARNSII(4150) TTTAATAAGT CAAAACTTTC AACAACGGAT CTCTTGGTTC TGGCATCGAT GAAAAA-CGC AGCGAAATGC GATAAGTAAT
A.MEARNSII(4149) · ..............•..........•.......................... G .. - "•..........
A.MEARNS II (4151) · .
A.MEARNSII(4152) · . · .. E; .. - .
A.MEARNSII(4148) · . · .. G .. - .
A.MEARNSII(1758) · . .. .. l'! ..... · .. G .. - .
SEIRIDIUM(472J) · . · .. G .. - .
S.UNICORNE-LINCOLN · . · .. e .. - .
S.CARDINALE-ITALY 0." •••• '.' •••
L.CUPRESSI-GREECE · .. G .. - .
S.UNICORNE-PORTUGAL ...... A .
S.UNICORNE-SA · .. G .. - .
P.MACULANS - ..... A .
250 260 270 280 290 JOO JI0 J20
A.MEARNSII(4150) GTGAATTGCA GAATTCAGTG AATCATCGAA TCTTTGAACG CACATTGCGC CCATTAGTAT TCTAGTGGGC ATGCCTGTTC
A.MEARNSII(4149)
A.MEARNSII(4151)
A.MEARNSII(4152) A .
A.MEARNSII(4148) A .
A.MEARNSII(1758) .. T .
SEIRIDIUM(472J)
S.UNICORNE-LINCOLN
S.CAHDINALE-ITALY
L.CUPRESSI-GREECE
S.UNICORNE-PORTUGAL
S.UNICORNE-SA .. T .
P.MACULANS A .
~
0\
.p..
330 340 350 360 370 380 390 400
A.MEARNSII(4150) GAGCGTCAT'[,TCAACCCTTA AGCCTAGCTT AGTATTGGGA ATCTACTGTA '1'TG--TAG------TTCCTC AAATCCAACG
A.MEARNSII(4149)
A.MEARNSII(4151) G C .. -- --
A.MEARNSII(4152)
A.MEARNSII(4148) · .A .
A.MEARNSII(1758) G C .. -- -- N .........
SEIRIDIUM(4723) GC .
S.UNICORNE-LINCOLN G .
S.CARDINALE-ITALY · .A . G G- --
L.CUPRESSI-GREECE · .N . G .
S.UNICORNE-PORTUGAL G . ...'1'.-..--
S.UNICORNE-SA · .A . .N N TN----- C .
P.NACULANS ...G. ..... GC CT ..TGC CT GTAGC G A .
A.MEARNSII (4150) GC
A .t"lEARNSI(4149)
A.MEARNSII(4151)
A.MEARNSII(4152)
A.MEARNSII(4148)
A.MEARNSII (1758)
SEIRIDIUM(4723)
S.UNICORNE-LINCOLN
S.CARDINALE-ITALY
L.CUPRESSI-GREECE .G
S.UNICORNE-PORTUGAL
S.UNICORNE-SA
P.MACULANS
......
(J\
Ul
166
Figure 5: Phylogram produced using the Heuristic search option of PAUP. Midpoint
rooting was used. Bootstrap values are expressed as % confidence intervals.
P.MACULANS 167
A.MEARNSI 1(4149)
,
r--
A.MEARN SII(4152)·
-
~ A.MEARNSII(4148)
.._ A.MEA,RNSI1(4150)
~ A.MEARNSII(4151)
S.CARDIN ALE-ITALY
~ S.UNICORNE-P ORTUGAL
r--
- S.UNICORNE-LIN COLN
L.CUPRESSI-G REECE
100
A .MEARNSII(1758)
...__
S.UNIC ORNE-SA
SEIRIDIUM 4723
168
Figure 6: Dendogram generated from UPGMA analysis of the ITS region of the
ribosomal RNA operon. Seiridium cardinale (1) - Italy; S. cardinale (2) - New Zealand;
S. cardinale (3, 4, 5, 9) - South Africa; S. cupressi (6) - Greece; S. unicorne (7) _
Portugal; S. unicorne (8) - New Zealand; S. unicorne (9) - South Africa; S. unicorne
(lO) - Lesotho; S. unicorne (11) - South Africa; Seiridium sp. (12) - South Africa,
Cupressus (RSA) - C. lusitanica, South Africa. Three digit numbers refers to CMW
numbers (Table 1).
169
PEsrA.LOTIO PSIS ,IdA C ULANS
...J.C..J.CL..J.
I S. C..J.RDINALE (1)
...J.C..J.CL.:J
ACACL4
S. CARDINALE (2)
S. CUPRESSI (6)
ACACL.:J
S. CARDINALE (3)
S. CARDINALE (4)
S. UNICORNE(8)
r·
S. UNICORNE (9)
S. UNICORlVE (lO)
r
S. UNICORNE (7)
r
'- ACACL4
r '- CUPRESSUS (RSA)
'- ...J.C..J.CL.:J
r- S. CARD/NALE (5)
- S. UN/CORlVE (Il)
- SElRiD/[;'!'v/ (12)

171
6
ENDOPHYTIC FUNGI ASSOCIATED WITH ACACIA MEARNSII IN
SOUTH AFRICA
ABSTRACT
Many pathogens of plants can exist as latent or endophytic infections within their host,
without any external symptom or sign of disease. Under certain conditions, such as
drought or mechanical damage, these organisms are, however, activated, spreading
through the entire host, leading to disease and death. To determine which fungi can occur
as endophytes of the economically important Acacia mearnsii in South Africa, a study was
undertaken to identify pathogens with the ability to live as symptomless endophytes in this
tree species. Isolations were made from the leaves and stems of healthy trees in
plantations in the KwaZulu-Natal Province. Both summer and winter collections were
made. The plant material was surface sterilized and isolations made on agar amended with
streptomycin. Thirty genera of fungi were isolated. The most abundantly isolated
endophytes were species of Fusarium, Nigrospora, Nodulisporium, Pestalotiopsis and
Xylaria. A number of potential pathogens of A. meamsii were also isolated. These
included Botryosphaeria dothidea, Cylindrocladium candelabrum, Diplodia spp.,
Fusarium graminearum and Lasiodiplodia theobromae. No obvious differences in
endophytic assemblages were found between winter and summer sampling. Further
studies are planned to determine the relative importance of these fungi in the health of A.
mearnsii trees.
172
INTRODUCTION
Interest in fungal endophytes of vascular plants has increased considerably in recent years
and fungal endophytes have been found in all plants that have been investigated. Varying
opinions exist as to what the correct definition of an endophyte is (Wenstrëm, 1994).
These could be all organisms capable of colonizing internal plant tissues (Wilsón, 1995),
but it was also suggested that they should include only non-pathogenic organisms, thus
excluding latent pathogens (Petrini, 1991). As knowledge of endophytes has increased,
the definition has changed to include latent pathogens that can live in their host for some
time without causing disease (petrini, 1991). The Dictionary of The Fungi (1995) defines
endophytes as "fungi or bacteria that form symptornless infections, for part of, or all their
life cycle, within the healthy leaves and stems of plants" (Hawksworth et al., 1995). More
recently, endophytes have been described as being either parasitic or symbiotic and
contained entirely within the plant (Sinclair & Cerkauskas, 1996). For the purpose of this
paper we have considered endophytes as any organism capable of infecting its host and
surviving within it, without causing any outward signs or symptoms of disease or
infection. This thus includes pathogenic fungi and those that may never lead to any
negative effect to their host.
A number of different effects, both positive and negative, on the host plant have been
attributed to endophytic organisms. Endophytes have been reported to protect their hosts
against natural enemies such as herbivores and pathogenic microbes (Carroll 1988; Latch,
1993). Vertically transmitted grass endophytes, such as Neothyphodium spp. (formally
Acremonium spp.), for example, are important to the fitness of their hosts, providing them
with increased insect resistance, drought tolerance and resistance to herbivory (Siegel,
Latch & Johnson, 1985; Petrini et al., 1992; Zhi-Qiang et al., 1993; Bacon & Hill,
1996). Animals grazing on tall fescue (Festuca arundinacea Schreb.) and perennial rye
grass (Lolium perenne L.) often show symptoms of toxicoses and "staggers", caused by
the fungal endophytes within these grasses (Siegel et al., 1985).
173
Endophytes have been reported to provide genetic, physiological and biochemical
advantages (Zhi-Qiang et al., 1993). This is achieved by inducing biochemical changes in
response to infection by the endophytes and may lead to enhanced resistance to insects
and pathogenic fungi, longevity and increased photosynthetic capacities of infected plant
cells (White 1988; Sinclair & Cerkauskas, 1996). Endophyte infection may thus lead to
changes in plant physiology, morphology and phenology (Siegel et al., 1987; Bacon &
Hill, 1996; Wilson, 1999).
Many endophytes are latent pathogens and a number of serious tree and plant diseases are
caused by them (Kulik, 1984; Sinclair, 1991; Johnson et al., 1992; Smith, Wingfield &
Petrini, 1996a; Stone & White, 1997). The period of latency depends on a wide variety
of factors, including environmental conditions such as drought and cold, the genetic
constitution of the host plant and the virulence of the endophyte (Cerkauskas & Sinclair,
1980; Petrini, 1991; Sinclair, 1991; Sieber & Dorworth, 1994; Agrios, 1997). Several
forest pathogens in South Africa are capable of infecting their hosts without causing
immediate symptoms of disease. Botryosphaeria dothidea (Moug.) Ces. & De Not. is a
well known pathogen of many woody hosts (Ramos et al., 1991; Johnson et aI., 1992)
and causes severe cankers and die-back of Eucalyptus spp. (Smith, Kemp & Wingfield,
1994). It is also one of the most economically important pathogens of Eucalyptus spp. in
South Africa (Wingfield & Kemp, 1993; Smith et ar, 1994). Recent studies on
Botryosphaeria canker in South African eucalypt plantations have shown that the causal
agent, B. dothidea, occurs as a symptomless endophyte in Eucalyptus grand is Hill ex
Maid., E. camuldulensis Dehnh., E. smithii RT. Bak. and E. nitens (Deane et Maid.)
Maid. (Smith, Wingfield & Petrini, 1996a; Smith et al., 1996b). Similarly, Sphaeropsis
sapinea (Fr.:Fr.) Dyko & B. Sutton, which is a serious pathogen of Pinus spp., has
recently been shown to exist as a symptomless endophyte in Pinus patuia Schl. et Cham.
and P. radiata D. Don. in South Africa (Smith et al., 1996b).
In a disease survey of Acacia mearnsii de Wild (black wattle) in South Africa, isolates of
B. dothidea and an unidentified Sphaeropsis sp. were obtained from discoloured wood on
174
dying trees (Roux, Wingfield & Morris, 1997; Roux & Wingfield, 1997). These isolates
have subsequently been found to be pathogenic to both A. mearnsii and an E. grandis
clone (Roux & Wingfield, 1997; Roux et al., 1997; Roux, unpublished). These
pathogens also belong to genera of fungi that are well known endophytes. For this reason
it was of interest to gain a more complete view of the endophytic fungi that occur on A.
mearnsii in South Africa. The aim of this study was, therefore, to conduct isolations from
symptomless A. mearnsii trees in order to gain information on the occurrence of possible
pathogenic fungi in these trees. We were particularly interested in the possible endophytic
occurrence of species of Botryosphaeria and Sphaeropsis. This study will, however, also
provide the first list of endophytic fungi of A. mearnsii and will thus contribute towards
the mycological data available on this tree.
MATERIALS & METHODS
Collection sites
Endophytes were isolated from 38 A. mearnsii trees grown in commercial plantations on
the Bloemendal Experimental Farm (290 32. 93S; 30027. 33E) in the Pietermaritzburg area
of the KwaZulu-Natal Province. All trees were grown from commercially produced seed
and ranged between 2 and 3 years of age. Trees were planted with a 1.5 m spacing and
were approximately 4 to 6 meters tall. The older branches from the lower part of the
stems were collected, to increase the possibility that endophytic infections would have
taken place. Branches were between a half and one centimeter in diameter and were dark
green in colour. A total of 90 branches were sampled at 4 different collection times, i.e.
February 1996 (3 trees, 5 branches/tree), July 1996 (20 trees, 2 branches/tree), August
1996 (10 trees, 2 branches/tree) and January 1998 (5 trees, 3 branches/tree). Two
collections were made during winter (July and August) and 2 during summer (January and
February). All branches collected were free of visible disease symptoms and were
collected from asymptomatic trees. The sampled branches were sealed in plastic bags and
175
refrigerated until isolations could be undertaken. Isolations were conducted within 48
hours of sampling.
Isolation methods
Branch and rachi samples (Fig. 1) were split lengthwise into 2 sections, using sterile
scissors and sterilized by immersion in 96% ethanol for 1 min, undiluted household bleach
(3.5 hyperchlorite) for 5 min, 96% ethanol for 1 min and then rinsed thoroughly in sterile
distilled water. The material was then transferred to malt extract agar (MEA) (2 gIL
Biolab malt extract, 15 gIL Biolab Agar), amended with 0.1 % streptomycin sulfate
(Sigma) to suppress bacterial growth. Petri dishes were incubated at 25°C and isolates
were transferred to fresh plates, until the original Petri dishes were completely overgrown,
making recognition of individual isolates impossible. Rapidly growing fungi could be
transferred from the original plates within 48 hours. Many of the isolates obtained did not
sporulate on MEA and were subsequently transferred to water agar (2% Biolab agar) to
which sterile pieces of A. mearnsii wood had been added. This technique generally
stimulated the production of fungal fruiting structures.
For the isolation of endophytes from the rachi, 5 rachi were selected per branch and 4
segments (1.5 cm long) were collected per rachis. This was done by removing the
pinnules from the rachis and then splitting them length wise. The epidermis was left intact,
because it is extremely thin and impossible to remove without damaging the entire
structure. Care was taken to ensure that each segment had three wounded sides; one at
each end of the rachis, and the length wise wound created by the splitting of the rachis.
This was to provide many wounds to allow endophytes to emerge.
Branch samples were treated in a similar fashion to the rachi. Ten segments (1.5 cm long)
were collected per branch (5 branches split length wise). For the branches the bark was,
however, removed using a scalpel, creating wounds on all sides of the branch. Five
segments were incubated per Petri dish. In a pilot trial, isolations were also attempted
176
from pinnules, but less than 1% of the structures sampled yielded any fungi. It was,
therefore, decided not to sample pinnules for endophytes.
The overall rate of infection was determined for all isolates using the technique described
by Carroll & Carroll (1978). This value represents the percentage of infection by each
fungal taxon as a percentage of the total number of isolates obtained.
RESULTS
Two hundred and three isolates were obtained from branches and 608 from rachi. Of
these, 30 fungal taxa were identified. A total of 438 isolates did not sporulate and were
not identified (Table 1).
Nigrospora oryzae (Berk. & Br.) Petch. was the most abundantly isolated fungus (9.9%).
The majority of fungi isolated were black/gray in appearance. Many of these isolates did,
however, not sporulate and were grouped together as "black isolates" (6.2%). Those
black cultures that could be induced to sporulate were either B. dothidea, N oryzae or
Diplodia spp. The non-sporulating black isolates were divided into those that have a
"flat" mycelial appearance and those that had a "fluffy" mycelium. Other commonly
isolated taxa were species of Fusarium (5.4%) (F. graminearum Schwabe. and unknown
Fusarium spp.), Nodulisporium sp. (4.4%) andXylaria spp. (3.8%).
A number of the light coloured isolates that were collected, sporulated, but could not be
identified. These isolates are grouped as "unidentified". They included many isolates
producing small, hyaline ameroconidia in stromata or pycnidia. Some of the light coloured
isolates did not sporulate and were grouped together with those designated as
"unidentified". In total, these two groups accounted for 50.6% of the isolates collected.
There were no distinct differences in the frequency of occurrence of endophytes collected
during the summer and the winter (Table 2). The majority of endophytic fungi, such as .
177
Cylindrocladium candelabrum Viégas and species of Fusarium, Pestalotiopsis and
Xylaria were isolated during both the summer and winter months. A number of the less
frequently isolated taxa were, however, found in only one of the isolation periods. For
example, B. dothidea isolates were detected only in the summer, while Diplodia sp. A and
Lasiodiplodia theobromae (Pat.) Griffon & Maubl. were isolated only during the winter.
The endophytes isolated in this study showed no apparent preference for the tissue types
examined. The most abundant isolates could be found in both the xylem and rachi, while
some of the rare isolates, such as Colletotrichum gloeosporioides (Penz. ) Penz. & Sacc.
(rachi), L. theobromae (rachi) and B. dothidea (side branches), were found only in one
tissue type.
DISCUSSION
This survey of A. mearnsii endophytes has provided a valuable insight into the role of
healthy plant tissue as a source for disease causing fungi. Knowledge of the endophytic
fungal flora of A. mearnsii, will provide valuable information regarding the development
and occurrence of diseases of these trees. This is especially important in understanding
disease development associated with latent pathogens that become problematic during
unfavourable environmental conditions. This is particularly applicable to A. mearnsii in
South Africa, that is often planted on poor sites with shallow, rocky soil. Areas in which
these trees are planted in South Africa, also often suffer from severe cold stress and
regularly experience periods of drought. These conditions predispose the trees to
infection by opportunistic pathogens which also appear to be amongst the common
endophytes.
Most of the fungal taxa isolated from A. mearnsii in this study are known to be endophytic
on other plant species. As has been shown in other studies of endophytes (Carroll &
Carroll, 1978; Petrini, 1996), a few dominant taxa were found, with the majority of the
taxa having a low level of occurrence. Nigrospora oryzae, the most frequently isolated
178
taxon in this study, is a common endophyte of bracken (Pteridium aquilinum (L.) Kuhn)
(Petrini & Fisher, 1993) Eucalyptus spp., Musa spp. and many plant other species (Petrini
& Fisher, 1993; Smith et al., 1996a; Brown, Hyde & Guest, 1998).
Two different Fusarium spp. were isolated in the study and these included F.
graminearum, which is a pathogen of maize and wheat (Marasas êt al., 1988). 'Fusarium
spp. are common endophytes of many plant species. Endophytic Fusarium spp. include
Fusarium avenaceum (Fr.) Sacc occurring on wheat and bracken (Petrini & Fisher, 1993;
Crous, Petrini & Marais, 1995), F. oxysporum Schlecht. Emend. Snyd. & Hans. and F.
solani (Mart.) Appel & Wollenw. Emend. Snyd. & Hans. on soybeans (Carroll, 1990) and
F. moniliforme Sheldon on Eucalyptus nitens and com (Foley, 1962; Carroll, 1990;
Leslie et al., 1990; Fisher, Petrini & Sutton, 1993). All of these Fusarium spp.· are
capable of causing disease under unfavourable environmental conditions.
A number of the other endophytic taxa collected in this study are known pathogens of
trees and could play a role in disease development. These include L. theobromae (syn.:
Botryodiplodia theobromae Pat., Diplodia natalensis Pole Evans.), the cause of stem
canker and death of Eucalyptus spp. (Sharma, Mohanan & Florence, 1984), blue-stain and
die-back of Pinus spp. (Cilliers, Swart & Wingfield, 1993), root and collar rot of Acacia
spp. (Lenné, 1992; Lee, 1993), as well as other diseases of trees and agronomic crops
(Punithalingam, 1980). The fungus is a weak pathogen associated with unfavourable
environmental conditions such as heat and lack of moisture (Sharrna et al., 1984; Mullen
et al., 1991). lts role in disease of A. mearnsii has yet to be determined.
Species of Cylindrocladium are well-known pathogens of forest plantation trees, causing
losses to Acacia, Eucalyptus and Pinus plants (Gib son, 1975; Ahmad, 1987; Crous,
Phillips & Wingfield, 1991). This genus has a worldwide distribution and leads to root
rot, damping off and stem and leaf lesions of infected seedlings in nurseries (Gibson, 1975;
Lee, 1993; Crous et al., 1991). It has also been reported as the cause of tree mortality in
recently established plantations of A. mearnsii and Eucalyptus spp. (Crous et al., 1991).
179
Cylindrocladium spp. have also regularly been isolated from diseased A. mearnsii
seedlings in South Africa and its isolation as a endophyte of this tree is of interest and
concern.
Seven isolates of Glomerella cingulata (Stonem.) Spaulding & v. Schrenk were isolated,
mostly from rachi. This fungus has been described as a serious pathogen of Acacia
seedlings under moist conditions (Gibson, 1975; Ahmad, 1987; Lenne, 1993; Lee, 1993).
It affects a number of different species of Acacia, causing serious leaf drop and in many
cases girdling branches and stems of young seedlings. It has not previously been reported
from A. mearnsii, but G. acaciae (K. Ito & Shibukawa) K. Ito has been reported as the
cause of anthracnose in Japan (Hodges, 1964). The role ofG. cingulata in disease ofA.
mearnsii in South Africa deserves investigation.
Two species of Diplodia were isolated as endophytes of A. mearnsii in this study.
Diplodia sp. A has a dark colony colour, while Diplodia sp. B has a white to cream
colony colour with a distinctly fruity aroma. Diplodia sp. A resembles D. pinea (Desm.)
Kickx, Petrak & Sydow f sp. cupressi SoleI, Madar, Kimchi & Golan (Roux & Wingfield,
1997), a stress related pathogen of Cupressus sempervirens L. in Israel and South Africa
(SoleI et al., 1987; Linde, Kemp & Wingfield, 1998). Diplodia sp. B could not be
identified to the species level using morphological characteristics and the identity as well
as importance of both species needs further assessment.
The small number of isolates of B. dothidea obtained in this study might not accurately
reflect its level of occurrence as an endophyte in A. mearnsii. The large number of non-
sporulating black isolates most likely include many more isolates of this fungus, than those
that could be identified with certainty. This can only be verified once isolates can be
induced to sporulate, or through the application of molecular techniques. The same may
be true for the frequency of species of Sphaeropsis, Diplodia and L. theobromae, which
may all be represented by some of the dark, non-sporulating isolates. Nigrospora isolates
180
sporulated readily suggesting that none, or very few, of the remaining black-coloured
isolates represent this fungus.
Xylariaceous fungi including Xylaria and Nodulisporium spp. are common endophytes of
many plant species (petrini & Petrini, 1985; Redlin & Carris, 1996) and were regularly
isolated from A. mearnsii in this study. These fungi have been reported as pathogens on
trees and other plants (Chapela, Petrini & Bielser, 1993). Their significance as endophytes
and possible contribution to disease of A. mearnsii is uncertain. The identification of
Xylaria spp. is notoriously difficult because the teleomorph states are rare in culture, with
the anamorph states being the most frequently isolated (Petrini & Petrini, 1985;
Rodriques, 1996). In this study it was possible only to identify these species to the genus
level and further studies are required to identify them further. Such studies should also
provide clues to their relative importance.
Many endophytes show specificity to the plant tissues that they inhabit (Fisher et al.,
1993). This is often correlated with the age of the tissue (petrini et al., 1992). In other
studies, fungi such as Verticicladium trifidum Preuss, Rhinocladiella atrovirens Nannf.
and others thus showed a distinct preference for specific host tissues, with R. atrovirens
being isolated only from the xylem, while V. trifidum was isolated mostly from surface
tissues (petrini & Fisher, 1988). No obvious tissue specificity could be found for any of
the taxa in this study. Only some of the less frequently isolated taxa appeared to be
restricted to specific tissues, but because of their low frequencies of isolation, this
observation is probably not relevant.
Using different modes of tissue preparation can affect the genera of fungi isolated from
plant material (petrini et aI., 1992). Xylariaceous fungi, in particular, may be under-
represented in this study, since pretreatment of the tissue by drying can increase its
occurrence (Petrini et aI., 1992). Numbers provided in this study for species of
Botryosphaeria, Sphaeropsis, Xylaria and other fungi may thus be an under-
representation of their true abundance as endophytes of A. mearnsii. Petrini et al. (1992)
181
determined that sampling between 30-40 individuals of a given tree/plant species may yield
up to 80% of the total endophyte taxa present. This is, however, dependent on the site
and also on the host examined (Petrini et al., 1992). This study has thus fulfilled the
requirement regarding the number of host plants to be sampled. The data represented here
should give a reasonable approximation of the fungal endophytes of A. mearnsii in a South
African plantation, although we recognise that this value is dependent on the time of year,
the location and the size of the sampling unit.
This study provides a valuable preliminary list of endophytic fungi of A. mearnsii. We
were especially interested in the possibility that species of Botryosphaeria and
Sphaeropsis might occur as latent pathogens in these trees. A number of fungi with
known pathogenic abilities, especially when associated with environmental stress, such as
drought and frost damage, are recorded. The possible role of these fungi in diseases of A.
mearnsii must still be determined. With the exception of Diplodia sp. A, isolates of B.
dothidea, Fusarium, Seiridium and Sphaeropsis, produced lesions when inoculated into
the stems of trees during field pathogenicity trials on 18-month-old trees (Roux &
Wingfield, 1997). Further investigations regarding the pathogenicity of B. dothidea are
needed and results of pathogenicity trials with F. graminearum on A. mearnsii are
reported elsewhere in this thesis.
182
REFERENCES
Agrios, G.N. (1997). Plant Pathology. 4th Edition. Academic Press.
Ahmad, N. (1987). Current potentially dangerous diseases of plantation trees and
ornamental trees in Malaysia. Forest Pests and Diseases in Southeast Asia: Biotrop
Special Publication No. 26.
Bacon, C.W. & Hill, N.S. (1996). Symptornless grass endophytes: Products of
eoevolutionary symbioses and their role in the ecological adaptations of grasses. In
Endophytic fungi in grasses and woody plants. Systematics, Ecology and Evolution.
(eds. S.C. Redlin & L.M. Cams). pp. 155-178. APS Press, St. Paul, Minnesota.
Brown, K.B., Hyde, K.D. & Guest, D.1. (1998). Preliminary studies on endophytic fungal
communities of Musa acuminata species complex in Hong Kong and Australia. Fungal
Diversity 1, 27-5l.
Carroll, G. (1988). Fungal endophytes in stems and leaves: From latent pathogen to
mutualistic symbiont. Ecology 69, 2-9.
Carroll, G.C. (1990). Fungal endophytes in vascular plants: Mycological research
opportunities in Japan. Transactions of the Mycological Society of Japan 31, 103-116.
Carroll, G.C. & Carroll, F.E. (1978). Studies on the incidence of coniferous needle
endophytes in the Pacific North West. Canadian Journal of Botany 56,3034-3043.
Carruthers, V. (1997). The wildlife oJ Southern Africa. A field guide to the animals and
'plants of the region. Southern Book Publishers, Halfway House, South Africa.
183
Cerkauskas, R.F. & Sinclair, lB. (1980). Use of paraquat to aid detection of fungi in
soybean tissues. Phytopathology 70, 1036-1038.
Chapela, LH., Petrini, O. & Bielser, G. (1993). The physiology of ascospore occlusion in
Hypoxylon fragiforme: Mechanisms in the early recognition and establishment of an
endophytic symbiosis. Mycological Research 97, 157-162.
Cilliers, Al, Swart, W.l & Wingfield, MJ. (1993). A review of Lasiodiplodia
theobromae with particular reference to its occurrence on coniferous seeds. South
African Forestry Journal 166, 47-52.
Crous, P.W., Petrini, O. & Marais, G.F. (1995). Occurrence of fungal endophytes in
cultivars of Triticum aestivum in South Africa. Mycoscience 36, 105-111.
Crous, P.W., Phillips, AlL. & Wingfield, M.l (1991). The genera Cylindrocladium and
Cylindrocladiella in South Africa, with special reference to forest nurseries. South
African Forestry Journal 157, 69-85.
Fisher, P.J., Petrini, O. & Sutton, B.C. (1993). A comparative study of the fungal
endophytes in leaves, xylem and bark of Eucalyptus nitens in Australia and England.
Sydowia 45, 338-345.
Foley, D.C. (1962). Systemic infection of. corn by Fusarium moniliforme.
Phytopathology 52, 870-872.
Gibson, LAS. (1975). The Leguminosae. In Diseases offorest trees widely planted as
exotics in the tropics and Southern Hemisphere. Part L Important members of the
Myrtaceae, Leguminosae, Verbenaceae and Meliaceae (ed. LAS. Gibson), pp. 21-34,
Commonwealth Forestry Institute, University of Oxford: Oxford ..
184
Hawksworth, D.L., Kirk, P.M., Sutton, B.e. & Pegier, D.N. (1995). Ainsworth and
Bisby's Dictionary of the fungi. CAB International, Wallingford, Oxon, United Kingdom.
Hodges, G.S. (1964). Seed and seedling diseases of forest trees of the world.
FAO/IUFRO Symposium on Internationally Dangerous Forest Diseases and Insects,
Oxford, July 1964.
Johnson, G.!., Mead, AJ, Cooke, AW. & Dean, JR. (1992). Mango stem end rot
pathogens - Fruit infection by endophytic colonization of the inflorescence and pedicel.
Annals of Applied Biology 120, 225-234.
Kulik, M.M. (1984). Symptomless infection, persistence, and production of pycnidia in
host and non-host plants by Phomopsis batatae, Phomopsis phaseoli, and Phomopsis
sojae, and the taxonomic implications. Mycologia 76,274-291.
Latch, G.C.M. (1993). Physiological interactions of endophytic fungi and their hosts.
Biotic stress tolerance imparted to grasses by endophytes. Agriculture, Ecosystems and
Environment 44, 142-156.
Lee S.S. (1993). Diseases. In Acacia mangium. Growing and Utilization. (eds. K.
Awang & D. Taylor), pp. 203-223. Winrock International and The Food and
Agricultural Organization of the United Nations, Bangkok: Thailand.
Lenné, JM. (1992) Diseases of multipurpose woody legumes in the tropics: A review.
Nitrogenfixing tree research reports 10, 13-29.
Leslie, JF., Pearson, e.AS., Nelson, PE. & Tousson, T.A (1990). Fusarium spp. from
corn, sorghum, and soybean fields in the central and eastern United States.
Phytopathology 80, 343-349.
185
Linde, C., Kemp, G.H.l & Wingfield, M.l (1998). First report of Sphaeropsis canker on
Cypress in South Africa. European Journal of Forest Pathology 27, 173-177.
Marasas, W.F.O., Voigt, W.G.l, Lamprecht, S.C. & Van Wyk, P.S. (1988). Crown rot
and head blight of wheat caused by Fusarium graminearum groups 1 and 2 in the
southern Cape Province. Phytophylactica 20, 385-389.
Mullen, lM., Gilliam, c.H., Hagan, A.K. & Morgan-Jones, G. (1991). Canker of
dogwood caused by Lasiodiplodia theobromae, a disease influenced by drought stress or
cultivar selection. Plant Disease 75, 886-889.
Petrini, O. (1991). Fungal endophytes of tree leaves. In Microbial Ecology of Leaves.
(Eds. lH. Andrews & S.S. Hirano), pp. 179-197. Springer-Verlag Inc., New York.
Petrini, O. (1996). Ecological and physiological aspects of host-specificity in endophytic
fungi. In Endophytic fungi in grasses and woody plants. Systematics, Ecology and
Evolution. (eds. S.C. Redlin & L.M. Carris), pp. 87-100. APS Press, St. Paul,
Minnesota.
Petrini, O. & Fisher, P.l (1988). A comparative study of fungal endophytes in xylem and
whole stem of Pinus sylvestris and Fagus sylvatica. Transactions of the British
Mycological Society 91, 233-238.
Petrini, O. & Fisher, P. (1993). Fungal endophytes of bracken (Pteridium aquilinum),
with some reflections on their use in biological control. Sydowia 44, 282-293.
Petrini, L. & Petrini, O. (1985). Xylariaceous fungi as endophytes. Sydowia, Annales
Mycologici Ser. II, 38, 216-234.
186
Petrini, 0., Sieber, T.N., Toti, L. & Viret, O. (1992). Ecology, metabolite production and
substrate utilization in endophytic fungi. Natural toxins 1, 185-196.
Punithalingam, E. (1980). Plant diseases attributed to Botryodiplodia theobromae Pat.
Bibliotheca Mycologica, J. Cramer, Germany.
Ramos, L.l, Lara, S.P., McMillan lR. & Narayanan, KR. (1991). Tip die-back of
Mango (Mangifera indica) caused by Botryosphaeria ribis. Plant Disease 75, 315-318.
Redlin, S.C. & Carris, L.M. (1996). Endophytic fungi in grasses and woody plants.
Systematics, Ecology and Evolution. APS Press, St. Paul, Minnesota.
Rodriques, KF. (1996). Fungal endophytes of palms. In Endophytic fungi in grasses and
woody plants. Systematics, Ecology and Evolution. (eds. S.C. Redlin & L.M. Carris), pp.
121-132. APS Press, St. Paul, Minnesota. ~
Roux, J. & Wingfield, M.l (1997). Survey and virulence of fungi occurring on diseased
Acacia mearnsii in South Africa. Forest Ecology andManagement 99,327-336.
Roux, L, Wingfield, M.l & Morris, MJ. (1997). Botryosphaeria dothidea, a pathogen of
Acacia mearnsii in South Africa. South African Society of Plant Pathology Abstracts,
South African Journal of Science 93, xii.
Sharma, lK, Mohanan, C. & Florence, E.lM. (1984). A new stem canker disease of
Eucalyptus caused by Botryodiplodia theobromae in India. Transactions of the British
Mycological Society 83, 161-163.
Sieber, T.N. & Dorworth, C.E. (1994). An ecological study about assemblages of
endophytic fungi in Acer macrophyllum in British Colombia: In search of candidate
mycoherbicides. Canadian Journal of Botany 72, 1397-1402.
187
Siegel, M.R, Latch, G.e.M. & Johnson, M.e. (1985). Acremonium fungal endophytes of
tall fescue and perennial rye grass: Significance and control. Plant Disease 69, 179-183.
Siegel, M.R, Latch, G.e.M. & Johnson, M.e. (1987). Fungal endophytes of grasses.
Annual Review of Phytopathology 25,293-315.
Sinclair, lB. (1991). Latent infection of soybean plants and seeds by fungi. Plant
Disease 75, 220-224.
Sinclair, lB & Cerkauskas, RF. (1996). Latent infection vs. endophytic colonization by
fungi. In Endophytic fungi in grasses and woody plants. Systematics, Ecology and
Evolution. (eds. S.C. Redlin & L.M. Carris), pp. 3-29. APS Press, St. Paul, Minnesota.
Smith, H., Kemp, G.H.l & Wingfield, M.l (1994). Canker and die-back of Eucalyptus in
South Africa caused by Botryosphaeria dothidea. Plant Pathology 43, 1031-1034.
Smith, H., Wingfield, M.l & Petrini, O. (l996a). Botryosphaeria dothidea endophytic in
Eucalyptus grand is and Eucalyptus nitens in South Africa. Forest Ecology and
Management 89, 189-195.
Smith, H., Wingfield, M.l, Crous, P.W. & Coutinho, T.A. (1996b). Sphaeropsis sapinea
and Botryosphaeria dothidea endophytic in Pinus. spp. and Eucalyptus spp. in South
Africa. South African Journal of Botany 62, 86-88.
SoleI, Z., Madar, Z., Kimchi, M. & Golan, Y. (1987). Diplodia canker of Cypress.
Canadian Journal of Plant Pathology 9, 115-118.
188
Stone, J.K. & White, J.F. (1997). Biodiversity of endophytic fungi. In Measuring and
monitoring biological diversity: standard methods for fungi (eds. G.M. Mueller, G.F.
Bills, AY. Rossman & HH Burdsall). Smithsonian Institution Press, Washington D.C.
Wenstrëm, A. (1994). Endophyte - the misuse of an old term. Oikos 71,535-536.
White, J.F. (1988). Endophyte-host associations in forage grasses. XI. A proposal
concerning origin and evolution. Mycologia 80,442-446.
Wilson, D. (1995). Endophyte - the evolution of a term, and clarification of its use and
definition. Oikos 73, 274-276.
Wilson, D. (1999). The ecology of tree Endophytes. In Microbial Endophytes (Ed. M.
Decker). In press.
Wingfield, M.J. & Kemp, G.H.J. (1993). Diseases of Pines, Eucalypts and Wattle. In
South African Forestry Handbook. (ed. H.A Van der Sijde), pp. 231-248. The South
Afiican Association of Forestry, Pretoria, South Afiica.
Zhi-Qiang A, Siegel, M. R., Hollin W., Tsai, H-F., Schmidt D. & Schardl, C. L. (1993).
Relationships among non-Acremonium sp. fungal endophytes in five grass species.
Applied and Environmental Microbiology 59, 1540-1548.
189
Table 1: Fungal taxa, and their frequency, isolated from healthy Acacia mearnsii tissue.
Fungal taxa Number of isolates Rate of Infection
Side Rachi (%) a
branch
Alternaria sp. 2 1 0.37
Botryosphaeria dothidea 3 0.37
Chaetomium sp. 3 0.37
Cladosporium sp. 1 0.12
Colletotrichum gloeosporioides 1 0.12
Curvularia sp. 1 0.12
Cylindrocladium candelabrum 2 15 2.10
Cytospora sp. 1 0.12
Diplodia sp. A 3 1 0.49
Diplodia sp. B 6 1 0.86
Drechslera sp. 1 0.12
Epicoccum sp. 5 9 1.73
Fusarium graminearum 4 7 1.36
Fusarium spp. 15 18 4.07
Gelasinospora cerealis Dowding 5 0.62
Glomerella cingulata 1 6 0.86
Lasiodiplodia theobromae 2 0.25
Micropshaeropsis sp. 1 0.12
Nigrospora oryzae 22 58 9.86
Nodulisporium sp. 10 26 4.44
Periconia sp. 11 1.36
Pestalotiopsis sp. (3) 13 22 4.32
Pestalotiopsis sp. (2) - 1 0.12
Phomopsis archerii 1 15 1.97
190
Fungal taxa Number of isolates Rate of Infection
(%) a
Side Rachi
branch
Pithomyces chartarum (Berk. & Curt.) M. B. Ellis 1 0.12
Seiridium cardinale (Wagener) Sutton & Gibson 1 1 0.25
Sordaria sp. 4 0.49
Sporormiella sp. 6 12 2.22
Virgaliella sp. 1 0.12
Xylaria sp. 6 25 3.82
Black isolates - fluffy 8 23 3.82
Black isolates - flat 2 17 2.34
Unidentified 91 319 50.55
Total 203 608 100
a Rate of infection calculated as described by Carroll & Carroll (1978).
191
Table 2: Distribution of endophytic isolates obtained from A. mearnsii in winter and
summer isolations
Fungal taxa Number of isolates
Winter Summer
Stem Rachi Stem Rachi
Alternaria sp. 1 1 1
Botryosphaeria dothidea 3
Chaetomium sp. 3
Cladosporium sp. 1
Colletotrichum gloeosporioides 1
Curvularia sp. 1
Cylindrocladium candelabrum 1 8 1 7
Cytospora sp. 1
Drechslera sp. 1 1
Diplodia sp. A 3 1
Diplodia sp. B 6 1
Epicoccum sp. 4 6 1 3
Fusarium graminearum 2 2 2 5
Fusarium spp. 12 6 3 12
Gelasinospora cerealis 3 2
Glomerella cingulata 1 4 2
Lasiodiplodia theobromae 2
Micropshaeropsis sp. 1
Nigrospora oryzae 17 30 5 28
Nodulisporium sp. 10 20 6
Perteoma sp. 11
Pestalotiopsis sp. (3) 8 6 5 16
Pestalotiopsis sp. (2) 1
192
Fungal taxa Number of isolates
Winter Summer
Stem Rachi Stem Rachi
Phomopsis archerii 1 8 7
Pithomyces chartarum 1
Seiridium cardinale 1 1
Sordaria sp. 4
Sporormiella sp. 4 3 2 9
Virgaliella sp. 1
Xylaria sp. 6 15 10
Black isolates - fluffy 5 23 3
Black isolates - flat 4 2 13
Unidentified 84 261 7 58
Total 167 410 36 198
193
Pinna
Pinmlle
Rachis
¥4~¥ Rachilla
W:::U;i:;;:;:;i:ii.'i':1::: Stalk
Figure 1: Diagram of a bipinnate leaf of Acacia meamsii
Diagram taken from Carruthers et al. (1997)

195
7
FUSARIUM GRAMINEARUM, A PATHOGEN OF THE
PLANTATION TREE ACACIA MEARNSII
ABSTRACT
During a survey of diseases of Acacia mearnsii in South Africa, isolates of an unknown
and non-sporulating red fungus were collected. Symptoms associated with this fungus
included branch die-back and stem cankers. The fungus was also isolated as an endophyte
from healthy plant tissue during a survey of endophytes of A. mearnsii. The unidentified
fungus was identified using DNA sequence analysis and its relative pathogenicity to A.
mearnsii was determined in pathogenicity trials. Pathogenicity tests were conducted by
inoculating 18-month-old A. mearnsii trees in a plantation. None of the isolates of this
pathogen produced spores, making its identification, based on morphology, impossible.
Sequencing of the beta tubulin gene and analysis of the data led us to identify the fungus
as Fusarium graminearum. All the isolates tested produced significant lesions on A.
mearnsii. Fusarium graminearum is a well-known pathogen of maize and wheat, with a
world-wide distribution. lts occurrence on A. mearnsii is thus intriguing, and as far as we
are aware, this is the first report of the fungus associated with a disease of a woody host.
196
INTRODUCTION
South Africa has nearly 1.5 million hectares of plantations of exotic forest trees, of which
Acacia mearnsii plantations encompass about 7%. (Anonymous, 1998). Despite the
relatively small proportion of land planted to A. mearnsii, the industry is one of the most
popular amongst private farmers, that constitute about 75% of the industry (Anonymous,
1994). Both the wood and the bark of A. mearnsii are harvested. The wood is used for
the production of paper and pulp and the tannins are extracted from the bark to be used in
the manufacture of adhesives and for leather tanning (Sherry, 1971; Anonymous, 1994;
Anonymous 1997).
Interest in the diseases affecting A. mearnsii gained prominence in 1988 with the outbreak
of a new wilt disease, known as Ceratocystis wilt (Morris, Wingfield & de Beer, 1993).
Subsequently, intensive disease surveys have been conducted in an effort to identify all
pathogens infecting these trees (Roux & Wingfield, 1997). During these surveys, an
unidentified and non-sporulating fungus, with a red mycelium in culture, was isolated from
stem cankers (Roux & Wingfield, 1997). This fungus was also isolated from apparently'
healthy plant material in a study of the endophytes occurring in non-symptomatic A.
mearnsii tissue (Chapter 6). Based on superficial morphological and cultural
characteristics, this fungus was tentatively identified as a species of Fusarium.
Fusarium spp. are well-known pathogens of a wide range of plants including vegetables,
agricultural crops and forestry trees (Boyer, 1961·; Nelson, Toussoun & Cook, 1981;
Lamprecht, Knox-Davies & Marasas, 1984; Kumar & Nath, 1988; Marasas et af., 1988;
SoleI, Runion & Bruck, 1988). Diseases caused by Fusarium spp. are associated not only
with crop losses, but also with the mycotoxins produced by some species (Versonder &
Hesseltine, 1981; Desjardins & Hohn, 1997). Disease symptoms include damping-off of
young plants (Lamprecht et al., 1984; Huang & Kuhlman, 1990; Lenné, 1992; Viljoen,
Wingfield & Crous, 1992), root disease (Cook, 1968; Lamprecht et al., 1984; Lenné,
1992; Viljoen, Wingfield & Marasas, 1994), stem cankers (Hepting & Roth, 1946;
197
Boyer, 1961; Lenné, 1992) and wilting and top death (Hepting & Roth, 1946; Kumar &
Nath, 1988). The best known Fusarium sp., pathogenic to mature plantation trees is F
circinatum Nirenberg et O'Donnell (Syn.: F. subglutinans f. sp. pint (Wollenw. &
Reinking) Nelson, Toussoun & Marasas), that causes the serious disease known as pitch
canker (Hepting & Roth, 1946; Dwinell, Kuhlman & Blakeslee, 1981; Correll et al.,
1991; Nirenberg & O'Donnell, 1998). This fungus is also a serious pathogen in forestry
nurseries in South Africa (Viljoen et al., 1994).
A number of Fusarium spp. have been reported from diseased A. mearnsii in South Africa
and elsewhere (Stephens & Goldschmidt, 1938; Zeijlemaker, 1968; Bakshi, 1976; Lee,
1993). Most of these reports are from nurseries where species such as F oxysporum
Schlecht and F solani (Mart.) Saac. cause damping-off of young seedlings (Bakshi, 1976;
Lenné, 1992; Lee, 1993). Fusarium spp. have also been reported from other
commercially grown plantation Acacia spp. In Malaysia, an unidentified Fusarium sp. is
reported to be associated with leaf spot and lesions of A. mangium (Lee, 1993). In South
Africa, an unknown species was isolated from a serious wilt disease in the 1930' s
(Stephens and Goldschmidt, 1938). Fusarium oxysporum has also been isolated regularly
from trees suffering from a disease known as "black butt" (Zeijlemaker, 1968).
Fusarium spp. can be secondary, opportunistic pathogens of A. mearnsii. There are many
records of Fusarium spp. playing active roles in disease associated with other pathogens
(Schilling, Moller & Geiger, 1996) and as secondary, opportunistic agents of disease
(Skelly & Wood, 1966). In a recent survey of diseased A. mearnsii, additional isolates of
the unidentified red, non-sporulating Fusarium sp. that had been found in previous
surveys, were collected. The objective of this study was to confirm the pathogenicity of
this fungus to A. mearnsii and then to determine its identity based on DNA sequence data.
198
MATERlALS & METHOI)S
Symptoms and Isolations
Cankers from which the non-sporulating red coloured fungus were isolated occurred on
side branches (Fig. la) and on the main stems of trees. Isolations were made from the
leading edges of lesions onto 2% malt extract agar (MEA) (20 gIL Biolab Malt Extract,
15 gIL Biolab Agar). Symptoms from which isolations were made also included basal
cankers, associated with black butt disease (Zeijlemaker, 1971), blister and mottle lesions
associated with Ceratocystis wilt (Morris et aI., 1993) and mechanical wounds on stems
and branches. A representative set of isolates that were used in further tests, as well as
isolates of other fungi used for comparative purposes (Table 1) are maintained in the
culture collection of the Forestry and Agricultural Biotechnology Institute (FABI),
University of Pretoria, South Africa.
Pathogenicity tests
Inoculation experiments on A. mearnsii were conducted at the Bloemendal Field
Experiment Station [South African Wattle Growers Union (SAWGU) and the Institute for
Commercial Forestry Research (ICFR)] (290 32. 93S, 300 27. 33E). During January of
1998, 4 strains (CMW4375; CMW4490, CMW4492, CMW4493) of the unidentified
fungus from A. mearnsii were each inoculated into twenty I8-month-old A. mearnsii
trees. Twenty trees were also included as controls. The entire experiment was repeated in
February of the same year.
All cultures were grown on 3.9% potato dextrose agar (PDA) (Merck Potato Dextrose
Agar). Actively growing isolates were inoculated by removing a 9 mm diameter bark plug
from the trees, by using a cork borer. Mycelial plugs, of equal dimension, were placed
into each wound with the mycelium facing inwards. For the controls, trees were
inoculated with sterile agar plugs to simulate the same process that was used for the fungal
199
inoculations. All inoculation wounds were covered with masking tape to prevent
desiccation of the wounds and the inoculum. Lesions were measured after 6 weeks and
statistical differences in lesion length were determined using Tukey's studentised range
test (P=O. 05).
Pathogen identification
Morphological characteristics
None of the isolates, associated with disease symptoms could be induced to sporulate.
This is despite the fact that the cultures were subjected to different light regimes and
grown on a wide range of different media. They were incubated under UV light,
continuous darkness, continuous light and alternating day/night cycles, as well as at
different temperatures on different growth media. Growth media tested included :MEA,
PDA and water agar to which sterilised A. mearnsii twigs had been added. Since we
believed that this fungus most closely resembled a Fusarium sp., it was also transferred to
carnation leaf agar (CLA) (Nelson, Toussoun & Marasas, 1983) in a further attempt to
induce sporulation.
f)-tubulin sequencing
Sequencing of the J3-tubulin gene has proven most effective in distinguishing between
species of Fusarium (O'Donnell & Cigelnik, 1997; O'Donnell, Cigelnik & Nirenberg,
1998). Three isolates of the fungus from A. mearnsii had also been tentatively identified
as F. graminearum by Dr. K. O'Donnell (National Center for Agricultural Utilisation
Research, Peoria, Illinois) based on J3-tubulin sequence data. This was an unusual
diagnosis and we, therefore, undertook a study to confirm these results.
Three isolates from A. mearnsii were selected and their J3-tubulin genes sequenced and
compared to 3 isolates ofF. graminearum from wheat in South Africa and 2 isolates of F.
200
crookwellense Burgess, Nelson & Toussoun (Table 1). Fusarium crookwellense was
selected as outgroup for sequencing since it has been shown to be a closely related
species, and is morphologically difficult to distinguish from F. graminearum (Burgess,
Nelson & Toussoun, 1982; Sydenham et al., 1991).
DNA Isolation
For the isolation of DNA, isolates were grown on 2% MEA plates until these were
covered with mycelium. Because these isolates form a thick mat of aerial mycelium,
mycelium was scraped directly from the surface of the agar in Petri dishes. Care was
taken not to include agar when collecting the mycelium. Mycelium was transferred to
sterile 1.5 mL Eppendorftubes and 200 ,.i.l ofCTAB added. The tubes were immersed in
liquid nitrogen and the mycelium ground until fine. An additional 800 ,.i.l of CTAB was
added for each sample and the samples were incubated in a warm water bath at 60DC for
five min. Samples were centrifuged at 12000 g for 30 min and the supernatant transferred
to sterile Eppendorf tubes. Equal volumes of phenol and chloroform (500 ,.i.l each) was
added and mixed with the samples. Samples were centrifuged at 12 000 g for 5 min and
the supernatant transferred to sterile Eppendorf tubes. The phenol/chloroform washes
were repeated until the interphase was clean.
DNA was precipitated overnight at -20DC by the addition of 50 Jll sodium acetate (NaAc)
(3M) and 300 Jll isopropanol. Samples were centrifuged at 13 000 g for 30 min to collect
the DNA. DNA was then washed with 70% ice cold ethanol and centrifuged at 10000 g
for 10 min. Pellets were dried in a SpeedVac (Savant SC 100) and the DNA resuspended
in 100 Jll sterile SABAX water and stored at -20DC.
O-tubulin amplification
Primers Tl (5'-AACATGCGTGAGATTGTAAGT-3') and T22 (5'-
TCTGGATGTTGTTGGGAATCC-3') were used to amplify the l3-tubulin gene
201
(O'Donnell & Cigelnik, 1997). Reactions were run on a Touchdown Thermocycler
(Hybaid) for 40 cycles at: 94°C for 30 sec, 50°C for 30 sec and noc for 90 sec. PCR
reactions contained 0.2 mM DNTP's, 0.3 ng/ul primer, 1 mM MgCb, 10X Buffer with
MgCb and PCR polymerase (Expand™, Boehringer Mannheim, South Africa). The PCR
products were stained with ethidium bromide and visualised under UV light on 1%
agarose gels.
Sequence analysis
All PCR products were purified usmg a QIAquick PCR purification kit (QIAGEN,
Germany). Sequence reactions were carried out with an ABI PRISMTMDye Terminator
Cycle Sequencing Kit with Amplitaq® DNA polymerase, FS (Perkin-Elmer, Warrington,
UK). An ABI PRISMTM377 DNA autosequencer (perkin-Elmer) was used for the
sequencing. Primers Tl and T22 were used for sequencing. The obtained sequences were
manually aligned by the insertion of gaps. Phylogenetic relationships among isolates were
determined using PAUP (phylogenetic Analysis Using Parsimony; Swofford, 1985) and
bootstrap analysis (Bootstrap confidence intervals on DNA parsimony) (Felsenstein,
1988).
RESULTS
Pathogenicity tests
Lesions were produced by all the isolates tested in this study (Table 2). The largest
lesions for the January inoculations were an average of38.1 cm in length (CMW4492) and
for the February inoculations 37.8 cm (CMW4490 and CMW4375). Isolate CMW4493
produced the smallest lesions in both experiments (21.7 cm and 28.8 cm). Lesions were
characterised by black discolouration of the outer bark surface and the formation of
sunken cankers, spreading from the point of inoculation. Extensive death of the xylem,
spreading from the inoculation point was also observed (Fig. 1b). No lesions were
202
produced in the control inoculations and all the inoculation wounds were rapidly covered
by callus tissue.
Pathogen identification
None of the isolates of the unidentified pathogen could be induced to sporulate in culture,
despite the various techniques used. Sequencing of the l3-tubulin gene of the unidentified
A. mearnsii pathogen and various isolates of F. graminearum and F. crookwellense made
it possible to analyse a total of 583 base pairs for the Tl primer and 526 bp's for the T22
primer. Sequences were manually aligned by the insertion of gaps (Fig. 2, 4). The
heuristic search option, with no branch swopping, produced a single tree for each primer
(Fig. 3, 5). Values for the Consistency Index (Cl), Retention Index (RI) and Homoplasy
Index (HI) for Tl was 0.818, 0.818 and 0.182 respectively and for T22 it was 0.880,
0.824 and 0.120. Bootstrap analysis using the Heuristic option with no branch swopping
grouped the fungus from A. mearnsii with Fusarium graminearum Schwabe from wheat
with a confidence interval of 95% for the Tl primer (Fig. 3) and 87% for the T2 primer
(Fig. 5). The two isolates of F. crookwellense formed a clade separate from the F. .
graminearum isolates. Based on these data and the superficial morphological similarity of
isolates to those of F. graminearum, we feel confident that the A. mearnsii pathogen
represents this species.
DISCUSSION
In this study we have clearly shown that the unknown, non-sporulating, fungus associated
with die-back and canker symptoms of A. mearnsii (Roux & Wingfield, 1997) is F.
graminearum . This is an intriguing discovery as the fungus has, to the best of our
knowledge, never previously been associated with a tree disease. In contrast, F.
graminearum is a well-known pathogen of maize and wheat in may parts of the world,
including South Africa (Cook, 1968; Marasas et al., 1987; Blaney & Dodman, 1988;
Marasas et al., 1988a; Marasas et al., 1988; Ouellet & Seifert, 1993).
203
The role of F. graminearum as a pathogen of A. mearnsii is not clear. The fungus is
generally isolated from canker and die-back symptoms attributed to other primary
pathogens of A. mearnsii, such as Ceratocystis albofundus Wingfield, De Beer & Morris.
It has been isolated from the major A. mearnsii growing areas in the KwaZulu-Natal
Midlands, as well as from the South Eastern Mpumalanga Province. It thus has a wide
distribution in the commercial growing areas, where it was isolated from collar rots and
stem cankers.
Fusarium graminearum was also isolated from asymptomatic tissues of A. mearnsii
(Chapter 6) and is thus believed to be an endophyte of this tree. Nevertheless,
pathogenicity tests conducted in this study have provided unequivocal evidence to show
that F. graminearum can cause well defined lesions on trees inoculated with isolates of
this fungus from A. mearnsii. In a previous study by Roux & Wingfield (1997),
inoculation with a single isolate of F. graminearum produced only small lesions in artificial
inoculation trials. The same isolate was used in this study, as well as three additional
isolates. Results showed that all isolates are capable of causing lesions on A. mearnsii.
All isolates produced considerably larger lesions than produced in the earlier study by
Roux & Wingfield (1997). This could possibly be explained by differences in
environmental conditions between the earlier inoculations and the 1998 inoculations, as
well as by genetic differences in the trees inoculated.
We believe that F. graminearum is probably a latent pathogen of A. mearnsii that
contributes to disease development after the onset of stress. This will not be unique for
this genus, since many other Fusarium species have been reported as endophytes, capable
of causing disease under conducive conditions (CarrolI, 1990). It is also common for
Fusarium diseases in forest nurseries to be more severe under periods of environmental
stress (Tint, 1945; Bloomberg, 1981).
204
Fusarium graminearum (teleomorph: Gibberella zea (Schw.) Petch) is an economically
important plant pathogen with a world wide distribution (Nelson et al., 1981; Blaney &
Dodman, 1988; Marasas et al., 1988; Ouellet & Seifert, 1993). It is a common
inhabitant of soil (Marasas et aI., 1988) and a recognised pathogen of maize (Marasas et
al., 1987) and wheat (Marasas et al., 1988a) in South Africa. It has also been reported
from diseased Medicago spp. and from Panicum coloratum L. in this country (Lamprecht
et al., 1984, Marasas et al. 1987). On wheat F. graminearum causes crown rot and head
scab and on maize it causes cob and stalk rot (Blaney & Dodman, 1988). Fusarium
graminearum is well-known for its ability to produce mycotoxins on infested grain,
causing disease of cattle (Hart, Braselton & Stebbins, 1982; Blaney & Dodman, 1988;
Desjardins & Hohn, 1997). These mycotoxins are also thought to play an important role
in disease development on plants (Desjardins & Hohn, 1997).
Fusarium graminearum exists in two populations, known as group I and group II (Francis
& Burgess, 1977; Nelson et al., 1981). Group I isolates produce no perithecia on their
host and occur mainly on wheat, causing diseases of the crowns of plants (Francis &
Burgess, 1977; Cook, 1981). Group II isolates readily produce perithecia on their hosts
and occur mainly on maize, causing disease of the aerial parts of plants (Francis &
Burgess, 1977; Cook, 1981). Francis and Burgess (1977) also reported differences in the
cultural characteristics of the two groups. From these descriptions and the fact that they
do not sporulate in culture, the A. mearnsii isolates most closely resemble Group I isolates
with the abundant mustard yellow, dense floccose aerial mycelium which rapidly fills Petri
dishes.
Group I isolates of F. graminearum have been described as being mainly soil borne
pathogens and they, therefore, do not sporulate abundantly (Francis & Burgess, 1977).
This would be consistent with our observation that isolates from A. mearnsii have failed to
sporulate in culture. Sequence data in this study confirm a close relationship with wheat
isolates of F. graminearum . It will now be of interest to also consider isolates from maize
and this question will be addressed as soon as relevant isolates become available.
205
In this study we have been able to highlight one of the many advantages of being able to
utilise DNA sequencing techniques in fungal identification. Despite considerable effort,
the fungus associated with disease symptoms considered in this study could not be induced
to sporulate. The cultures, however, superficially resembled a species of Fusarium. In the
absence of sequence data we would not have been able to confirm the identification of
what is an intriguing new pathogen of A. mearnsii.
This report of F graminearum from diseased A. mearnsii is enigmatic and, as far as we
can tell, represents the first report of this fungus as a pathogen of a woody host. The
importance of F. graminearum as a pathogen of A. mearnsii needs further evaluation.
Indications are, however, that F graminearum plays an important role in disease
development on A. mearnsii in South Africa and we have found that it has a wide
distribution on this plant in the country.
206
REFERENCES
Anonymous. (1994). South African Wattle Growers Union. Annual Report and Accounts
for the year ended 31 August 1994. Pietermaritzburg, South Africa.
Anonymous. (1997). South African wattle extract, a natural product. Wattlé Industry
Centre, Pietermaritzburg, South Africa.
Anonymous. (1998). Abstract of South African Forestry Facts for the year 1996/7.
Forest Owners Association. Rivonia, South Africa
Bakshi, B.K. (1976). Wattles - Acacia spp. In Forest Pathology: Principles and
practice in forestry. F.K.!. Press, Forest Research Institute and Colleges: Dehra Dun,
India. pp. 191-194.
Blaney, B.l & Dodman, R.L. (1988). Production of the Mycotoxins Zearalenone, 4-
Deoxynivlenol and Nivalenol by isolates of Fusarium graminearum Groups 1 and 2 from
cereals in Queensland. Australian Journal of Agricultural Research 39, 21-29
Bloomberg, W.l (1981). Diseases caused by Fusarium in Forest nurseries. In Fusarium:
Diseases, Biology and Taxonomy. The Pennsylvania State University Press, University
Park and London. pp. 178-187.
Boyer, M.G. (1961). A Fusarium canker disease of Populus deltoides Marsh. Canadian
Journal of Forestry 39, 1195-1204.
Burgess, L.W., Nelson, P.E. & Toussoun, T.A. (1982). Characterisation, geographic
distribution and ecology of Fusarium crookwellense sp. nov. Transactions of the British
Mycological Society 79, 497-505.
207
Carroll, G.C. (1990). Fungal endophytes in vascular plants: Mycological research
opportunities in Japan. Transactions of the British Mycological Society 31, 103-116.
Cook, RJ. (1968). Fusarium root and foot rot of cereals in the pacific Northwest.
Phytopathology 58, 127-131.
Cook, RJ. (1981). Fusarium diseases of wheat and other small grains in North America.
In Fusarium: Diseases, Biology and Taxonomy. The Pennsylvania State University
Press, University Park and London. pp. 39-52.
Carrell, r.c., Gordon, T.R, McCain, A.H., Fox, lW., Koehler, C.S., Wood, D.L. &
Schultz, M.E. (1991). Pitch canker disease in California: Pathogenicity, distribution and
canker development on Monterey pine (Pinus radiata). Plant Disease 75, 676-682.
Desjardins, A.E. & Hohn, T.M. (1997). Mycotoxins in Plant Pathogenesis. Molecular
Plant Microbe Interactions 10, 147-152.
Dwinell, L.D., Kuhlman, E.G. & Blakeslee, G.M. (1981). Pitch canker of Southern Pines.
In Fusarium: Diseases, Biology and Taxonomy (eds. P.E. Nelson, T.A. Toussoun and
Rl Cook). pp. 188-194. The Pennsylvania State University Press, University Park,
Pennsylvania.
Felsenstein, J. (1988). DNABOOT - Bootstrap Confidence Intervals on DNA parsimony
3.1. University of Washington.
Francis, RG. & Burgess, L.W. (1977). Characteristics of two populations of Fusarium
roseum 'graminearum ' in eastern Australia. Transactions of the British Mycological
Society 68,421-427.
208
Hart, L.P., Braselton, W.E. & Stebbins, T.C. (1982). Production of Zearalenone and
Deoxynivalenol in commercial sweet com. Plant Disease 66, 1133-1135.
Hepting, G.H. & Roth, E.R (1946). Pitch canker, a new disease of some Southern Pines.
Journal of Forestry 44, 742-744.
Huang, lW. & Kuhlman, E.G. (1990). Fungi associated with damping-off of slash pine
seedlings in Georgia. Plant Disease 74, 27-30.
Kumar, A. & Nath, V. (1988). Fusarium solani causing wilt of Eucalyptus. Current
Science 57, 907-908.
Lamprecht, S.C., Knox-Davies, P.S. & Marasas, W.F.O. (1984). Fusarium spp.
associated with diseased root and crown tissue of annual Medicago spp. Phytophylactica
16, 195-200.
Lee S.S. (1993). Diseases. In Acacia mangium. Growing and Utilisation. (eds. K.
Awang & D. Taylor). pp 203-223. Winrock International and the Food and Agricultural
Organisation of the United Nations, Bangkok, Thailand.
Lenné, lM. (1992). Diseases of multipurpose woody legumes in the tropics: A review.
Nitrogen Fixing Tree Research Reports 10, 13-16.
Marasas, W.F.O., Lamprecht, S.C., Van Wyk, P.S. & Anelich, RY. (1987). Bibliography
of Fusarium (Fungi: Hyphomycetes) in South Africa, 1945-1985. Bothalia 17, 97-104.
Marasas, W.F.O., Burgess, L.W., Anelich, RY., Lamprecth, S.C. & van Schalkwyk, D.l
(1988). Survey of Fusarium species associated with plant debris in South African soils.
South African Journal of Botany 54, 63-71.
209
Marasas, W.F.O., Voigt, W.G.l, Lamprecht, S.c. & van Wyk, P.S. (1988a). Crown rot
and head blight of wheat caused by Fusarium graminearum groups 1 and 2 in the
Southern Cape Province. Phytophylactica 20,385-389.
Morris, M.l, Wingfield, M.l & de Beer, C. (1993). Gummosis and wilt of Acacia
meamsii in South Africa, caused by Ceratocystisfimbriata. Plant Pathology 42,814-817.
Nelson, P.E., Toussoun, TA. & Cook, R.l (1981). Metabolites of Fusarium. In
Fusarium: Diseases, Biology and Taxonomy. The Pennsylvania State University Press,
University Park and London.
Nelson, P.E., Toussoun, TA. & Marasas, W.F.O. (1983). Fusarium species - an
illustrated manual for identification. Pennsylvania State University, University Park,
Pennsylvania.
Nirenberg, H.I. & O'Donnell, K (1998). New Fusarium species and combinations within
the Gibberellafujikuroi species complex. Mycologia 90,434-458.
O'Donnell, K & Cigelnik, E. (1997). Two divergent intragenornic rDNA ITS2 types
within a monophyletic lineage of the fungus Fusarium are non-orthologous. Molecular
Phylogenetics and Evolution 7, 103-116.
O'Donnell, K, Cigelnik, E. & Nirenberg, H.I. (1998). Molecular systematics and
phylogeography of the Gibberella fujikuroi species complex. Mycologia 90, 465-493.
Ouellet, T & Seifert, KA. (1993). Genetic characterisation of Fusarium graminearum
strains using RAPD and PCR amplification. Phytopathology 83, 1003-1007.
Roux, J. & Wingfield, M.l (1997). Survey and virulence of fungi occurring on diseased
Acacia mearnsii in South Africa. Forest Ecology andManagement 99,329-338.
210
Schilling, A.G., Moller, E.M. & Geiger, H.R. (1996). Polymerase chain reaction-based
assays for species-specific detection of Fusarium culmorum, F. graminearum and F
avenaceum. Phytopathology 86, 515-522.
Sherry, S.P. (1971). The Black Wattle (Acacia mearnsii de Wild.) University of Natal
Press: Pietermaritzburg, South Africa.
Skelly, JM. & Wood, F.A. (1966). The occurrence and aetiology of an annual canker of
sugar maple in Pennsylvania. Canadian Journal of Botany 44, 1401-1411.
Solel, Z., Runion, G.B. & Bruck, RI. (1988). Fusarium equiseti pathogenic to pine.
Transactions of the British Mycological Society 91,536-537.
Stephens, RP. & Goldschmidt, W.B. (1938). A preliminary report on some aspects of
wattle pathology. Journal of the South African Forestry Association 2, 40-43.
Swofford, D.L. (1985). PAUP Phylogenetic Analysis using Parsimony. Version 2.4.1:
Champaign, Illinois.
Sydenham, E.W., Marasas, W.F.O., Thiel, P.G., Shephard, G.S. & Nieuwenhuis, JJ
(1991). Production of mycotoxins by selected Fusarium graminearum and F
crookwellense isolates. Food Additives and Contaminants 8, 31-41.
Tint, H. (1945). Studies in the Fusarium damping-off of conifers. III. Relation of
temperature and sunlight to the pathogenicity of Fusarium. Phytopathology 35, 498-510.
Versonder, RF. & Hesseltine, C.W. (1981). Metabolites of Fusarium. In Fusarium:
Diseases, Biology and Taxonomy. (Eds. P.E. Nelson, T.A. Toussoun & RJ Cook), pp
350-364. The Pennsylvania State University Press, University Park and London.
211
Viljoen, A, Wingfield, M.l & Crous, P.W. (1992). Fungal pathogens in Pinus and
Eucalyptus seedling nurseries in South Africa: A Review. South African Forestry
Journal 161, 45-51.
Viljoen, A, Wingfield, MJ. & Marasas, W.F.O. (1994). First report of Fusarium
subglutinans f. sp. pini on pine seedlings in South Africa. Plant Disease 78, 309-312.
Zeijlemaker, F.C.l (1968). The gummosis of black wattle, a complex of diseases. Report
of the Wattle Research Institute for 1967-1968, 40-43.
Zeijlemaker, F.C.l (1971). Black butt disease of black wattle caused by Phytophthora
nicotianiea var. parasitica. Phytophylactica 61, 144-145.
212
Table 1: List of Fusarium species used in DNA sequencing and pathogenicity studies.
ISOLATE NUMBER ORIGIN HOST
Fusarium graminearum
CMW4375 Piet Retief, South Africa Acacia mearnsii
CMW4490 Dalton, South Africa "
CMW4492 " "
CMW4493 " "
F. graminearum
l\1RC4517 Bethlehem, South Africa Wheat, crown rot
l\1RC4977 Caledon, South Africa "
l\1RC5049 George, South Africa Wheat, head blight
F. crookwellense
l\1RC2878 Michigan, USA Soil
l\1RC3926 Bethlehem, South Africa Wheat
aCMW numbers are housed in the culture collection of the Tree Pathology Co-operative
Programme (TPCP), Forestry and Agricultural Biotechnology Institute (FABI), University
of Pretoria.
l\1RC numbers are housed in the culture collection of the Medical Research Council,
Tygerberg, Cape Town, South Africa.
213
Table 2: Lesions produced by Fusarium graminearum isolates on Acacia mearnsii.
ISOLATE NUMBER LESION LENGTH (mm)
January" February"
CMW4492 38.la 34.5b
CMW4375 35.4a 37.8b
CMW4490 30.8ab 37.8b
CMW4493 21.7c 28.8bc
Control 10d 10d
a Each value represents an average of 20 measurements.
CV= 29.52% (January)
CV= 25.93%(February)
a Values followed by different letters differ significantly at P=O.05
214
Figure 1: Lesions associated with Fusarium graminearum on Acacia mearnsii.
Fig. la: Lesion on a side branch from which F. graminearum was isolated.
Fig. 1b: Lesion produced on a stem after inoculation.

216
Figure 2: Aligned nucleotide sequences for isolates of Fusarium graminearum and F.
crookwellense useing the Tl primer. Homologous base pairs are indicated by a dot (.),
gaps by dashes (-) and missing data by N.
10 20 30 40 50 60 70
CROOK l\fELLNESE ---------A CTGACGCTCT GTCACTCAAC CAAACTGACT TTTTCTTTCT T----AGGTC CACGTCCAGG
CROOKI\fELLENSE -------TG. ........ T. · ......... · ......... · ......... ---- . ..
ACACIA ---------- · ......... ......... T ·......... · ......... -.
ACACIA -------T-. · ......... ........TT · ......... · ......... . ..
ACACIA -ACTC-CTG . ....... .T . ........ .T · ......... · ..
GRAMINEARUM ---------_ .......C .. ........ .T · ......... · ... - . .... .CCCC.
GRAMINEARUM -------TG . ...... .CT . ........ .T · ......... · ... - . .... .CCCC.
GRAl'-NlEIARUM AACTCTCTG . ....... .T. ·......... ·......... · ......... -C---
80 90 100 110 120 130 140
CROOKHELLENSE TCGGCCAATG TGTAAGGGCG AACCCACCAC CAAAAAAAAA CTTTGAGGGA CATATGTTGA GTTGATGAAT
CROOK~\lELLENSE · ......... · ......... · ......... · .........
ACACIA · ......... · ......... · ......... · .....
ACACIA · ......... · ......... · ......... ·...
ACACIA · ......... · ......... ·......... · ....... · ......... . .........
GRAMINEARUH · ......... ·......... ·......... · ....... · .....
GRAMINEARillvl · ......... · ......... · .......
GRAl'-lINEARUM · ......... · ......... · ......... ......... C
150 160 170 180 190 200 210
CROOKHELLENSE CTTTGTAGGG CAACCAAGTC GGTTCCAGCT TCTGGTGAGT CTTTTTTTAT AAGCTTTAAG CTCAATTGAA
CROOK ~\lELLNESE · ......... · ......... · ......... " ........
ACACIA · ......... · ......... · ......... ......A ... • • Il ••••••• . .......
ACACIA · ......... · ......... • •• Il •••••• ......A.
ACACIA · ......... · ......... ·......... ......A ... · . ,. ..
GRAMINEARUM ·......... ·......... ·......... ......A ... ...C ...... ...... .G.
GRAMINEARUM · ......... · ......... ·......... ......A ... ...C ...... .......G ............
GRAMINEARUM · ......... · ......... · ......... ......A ... · .......
~tv
--..J
220 230 240 250 260 270 280
CROOK HELLE NSE TCCTTGGAAC CTAGATCTAA CCGTATTTCC AGGTCCACCG TCTCCAAGGA GCACGGCATT GATGGCAGCG
CROOKHELLENSE ................... .. .................. .. .................. .. .................. .. .................. .. ........
ACACIA ......A ... .. .. .. .. .. .. .. .. .. .. ........T. · .................. .. .................. ......T . ".
ACACIA ......A ... .. .. .. .. .. .. .. .. .. .. ........T. · .................. .. .................. ......T .
ACACIA ......A ... .. .. .. .. .. .. .. .. .. .. ........T. · .................. .. .................. ......T ..
GRAMINEARUM .................... .. .................. .. .................. .. .. .. .. .. .. .. .. .. .. .. .................. .. ..................
GRAMINEARUM .. .. .. .. .. .. .. .. .. .. .................... .. .................. .. .................. .. .................. .. ......
GRAMINEARUM ......A ... .. .. .. .. .. .. .. .. .. .. .. .................. .. .................. .. .................. ......T .
290 300 310 320 330 340 350
CROOK~·fELLENSE GCGCGTGAGT CAACAACGTC ACCGACTTTA TGCCTCACAC TTTTGTCTAA CCTGAGCATT AGATACCACG
CROOK~.fELLENSE .. .. .. .. .. .. .. .. .. .. .................... .. .................. .. ..............
ACACIA .. .. .. .. .. .. .. .. .. .. .................... .. .................. .. .................. .. .................. .....A ...C
ACACIA .. .. .. .. .. .. .. .. .. .. .................... .. .................. .. .................. .. .................. .....A ...C
ACACIA .. .. .. .. .. .. .. .. .. .. .................... .. .................. .. .................. .. .................. .,..·.A...C
GRAMINEARUM .. .. .. .. .. .. .. .. .. .. .................... .. .................. .. .............. ,. .. .. .................. .....A ...C
GRAMINEARUM .. .. .. .. .. .. .. .. .. .. ........... · ......... · ......... · ......... .....A ...C
GRAMINEARUM · ......... · ......... · ......... · ......... · ......... .....A ...C
360 370 380 390 400 410 420
CROOKlfELLENSE GAACTTCAGA CCAGCAAGCG TGAGCGCATC AA-CGTCTAC TTTG-TGAGG TGGAGTACCA ATTGCA-T-T
CROOK~.fELLENSE · ......... · ......... · ......... · .- ·...... ....C.T.
ACACIA · ......... · ......... · ......... ·.A....... · ... - · .... · .- · ...... ......G.A.
ACACIA · ......... ·......... · ......... ·.A....... ....N ..... · ......... ......G.A.
ACACIA · ......... · ..... - ·.. ·.........
· ......... ·..... · ......... · .
- · ...... · ... - · .... · .- · ...... ......G.A.
GRAMINEARUM - · .. · .- · ...... .... C ..... · .C- ...... ..... .G.-
GRAMINEARUM · ......... · ......... · ......... · .- ·...... · ... - · ... - · .c- ...... ......G.-
GRAMINEARUM · ......... ·..... - · .. · ......... · .- · ...... · ... - · .... · .- · ...... ....G-----
l..V...
()O
430 440 450 460 470 480 490
CROOKHELLENSE GCA------- ------ATTG CAAATGCAAA TT-CA----- A-CGTGATTC CTAACTTTCT CAGGGCGGCA
CROOK~'lliLLENSE · .. ------- ------ .... ,. ......... · - - ----- .A - .
ACACIA ---------- ------ .... ...T ...... · .- .. ----- .-. . . . . . .. . .
ACACIA ---------- ------ .... ...T. - ----- .A ..••.•............
ACACIA ---------- ------ .... ...T ...... · .- .. ----- .A - .
GRAMINEARUM ...GTCGCAG TCGCAT .... ..-T ..... - ·.G ..TATTC .A - . . -
GRAMINEARUM ...GTCGCAG TCGCAT .... ..-T ..... - ·.G ..TATTC .A - . . ... - .....
GRAMINEARUM - ..GT----- ----AT .... ...T ...... - ----- -A - .
500 510 520 530 540 550 560
CROOKHELLENSE CACA------ ---------- ---------- ---------- ---------- ---------- --- _______
CROOKHELLENSE '" .A----- ---------- ---------- ---------- ---------- ---------- ----------
ACACIA .... --GTAC GTCCCCGTGC TGT-CTGGTC GATCTTT-GA AGTCGGCCCA -GATGCCATC CGCGCCGGCC
ACACIA ·...A----- ---------- ---------- ---------- ---------- ---------- ------- ___
ACACIA .... -GGTAC GTCCCCGTGC TGT-CTGGTC GATCTTT-GA -GTCGCC--A -GATGCCATC -GCGC-----
GRAMINEARUM ·...ANNNAC NTCCCCGTGC TGT-CTGGTC GATCTT--GA -GTCGGCC-A -GATGC-ATC -GCGCCGGCC
GRAMINEARUM ....--GTAC GTCCCCGTGC TGTTCTGGTC GATCTTT-GA AGTCGGCC-A -GATGCCATC -GCGC-GGC-
GRAMINEARUM .... --GNAC GTCCCCGTGC TGT-CTGGTC GAT-TTT-GA -GTCGCC--A -GATGCCATC -GCGCCGGC-
570 580
CROOKHELLENSE ---------- ----------
CROOK~'lliLLENSE ---------- ----------
ACACIA TTAGG----- ----------
ACACIA ---------_ ----------
ACACIA ---------- ----------
GRAMINEARUM TTAGGCAAGC TCTTCGCCGA CAC
GRAMINEARUM TTAGGCA-GC T--TCGCCGA CAC
GRAMINEARUM TTN-GC---- ----------
tv
t-'
\0
220
Figure 3: Phylogenetic tree generated for the Tl primer using the Heuristic search option
ofPAUP. Bootstrap values (1000 replicates) were computed with the branch and bound
option.
Crookwellense 221
Croo.kwellense
Acacia
Acacia
Acacia
95 %
Graminearum
Graminea rum
Gramlnearum
222
Figure 4: Aligned nucleotide sequences for isolates of Fusarium graminearum and F.
crookwellense useing the T22 primer. Homologous base pairs are indicated by a dot (.),
gaps by dashes (-) and missing data by N.
10 20 30 40 50 60 70
CROOKWELLENSE
CROOKWELLENSE ---------- ---------- ---------- --TGTATCGA TAACGAGG-C TCTGTACGAT A-TCTACGAG---------- ---------- ---------T TC ........
ACACIA · ....... - . · ..... ----------- ---------- ---------- _--------- ---------- ---------- ----------
ACACIA ---------- ---------- -GACGAGACT TC ........ ••..... . G.
ACACIA .. . . . . . . . . . .A .---------- ---------- -GACGAGACT TC ........ • •••••• a -. - - - -
GRAMINEARUM ----------- ---------- -----AGACT TC ........ ·.CGAG. -
GRAMINEARUM TGA-CAGCTG TCGAGA--TN TNAC-AGACT TC ........ ·....... -
GRAMJNEARUM · ......... ----------- ---------- ---------- -- - .N - -
80 90 100 110 120 130 140
CROOKWELLENSE AGACCCTTCA A-GATCGCCG ATCCTT-CGT ACGCC-GATC TCAACTACCC TGATTTCCAC CGGTCATGGC
CROOKItVELLENSE · ......... • -lO ••••••• ...... T ... .... .C. ___ · .............
ACACIA - .......... - ........ · ......... .·..... - ·.. ..... C .... -
ACACIA · - - - - - - -.AGA ..C ... • -lO ••••••• · ..... - · .. ..... C ....
ACACIA · ...-GA ..C ... • -lO ••••••• • ••••• -lO •• ...NN- .... · ................ - -
GRAMINEARUM ·-GA ..C ... --lO ••••••• • ••••• -lO •• ..... C .... · ........ -
GRAMINEARUM · ......... - . ..·-GA ..--... • -lO ••••••• · ..... - · .. · .... - . ... · ......... -- -
GRAMINEARUM ·-GA ..- ... --lO •••••• " · ..... - · .. ..... C.
150 160 170 180 190 200 210
CROOK ~VELLEN SE TGGTGTGACG ACCATGTTTC CGATTCCCCG GACAGCTCAA CTCGGATCTG CGAAAGCTCG CTGTTAACAT
CROOKWELLENSE ·..... " ... ·......... ·......... · .........
· ·.........· · ......... .ACACIA C ......... ......... ......... · ......... · .G.
ACACIA C ......... · .- ·...... ·......... · .........· ·.N ..ACACIA C ......... · .- ...... ·......... · .......... ·.N.
GRAMINEARUM ·......... · .- ·...... ·......... · .........
GRAl'HNEARUM · ......... · .- ·...... · ......... · ·.......... · .............. .. ............... - ...............
GRAMINEARUM C ......... ·.A ....... · .............. · ............ · ..
tv
tv
W
220 230 240 250 260 270 280
CROOKWELLENSE GATTCCGTTC CCCCGACTTC ACTT-CTTCA TGGTCGGATT TGCCCCTCTG ACTGGTCGCA ACATGAAGAC
CROOKWELLENSE '" .................. .. .................. .. ...... - .. ........ .. ..................
ACACIA .. .. .. .. .. .. .. .. '" .. · ..... '" ..... ....T ..... · . '" .. '" ....... · .......... '" .... . .... '" .....
ACACIA '" ... '" ... '" ..... .. ............ '" · ...... - . '" .... '" '" . '" '" ..... '" · ..
ACACIA '" '" '" ........... .. .............. · .... - .. '" .. '" · '" . '" '" ...... · .
GRAMINEARUM .... '" ........ '" . · ....... '" ....... .. '" ... - '" .... '" ... '" .... '" . '" '" · '" .....
GRAMINEARUM · '" .... '" '" .. '" .. '" · ............. · .... '" - . '" ..... .. '" .......... '" · ..
GRAMINEARUM · . '" ....... '" '" .. .. ..... '" ........ '" .... '" - .. ...... · . '" .... '" .. '" .... '" . '" .... . . '" '" '" . '" ... '" ..
290 300 310 320 330 340 350
CROOKWELLENSE CTTCCAGCAC GTTACCGTCC CCGGCCTTGC TCAGCAGATT TTCGACAACA AGAACATCAT GGCCGCTGCC
CROOKWELLENSE ........ '" ..... · ...... '" . '" .... .. .. '" .. '" '" '" ... .. . '" ... '" ..... ·.
ACACIA .. .. . .. . . . . .. .. · .... '" ..... '" .... '" .... '" .. .. .......... '" ·.T.
ACACIA · ............ '" '" ..... '" ...... · ........... '" · '" ........ ·.T.
ACACIA '" ............ · .......... '" '" .. · .............. .. ..... '" ...... ·.T.
GRAMINEARUM · ..... '" .... '" . · ....... '" .... ....T.'.... '.'.. '" ........ '" .. · ... '"
GRAMINEARUM · ...... '" ..... '" ............. ....T ....
GRAMINEARUM T ......... .. . '" ........ · ......... .. .. '" .
360 370 380 390 400 410 420
CROOKHELLENSE GATTTCCGCA ACGGACGATA CCTCGCTTGT TCCGCTATCT TGTAAGTTTT GAAACCGACC AAATTTCAAA
CROOKHELLENSE · ................. .. .......... · ......... · ......... · ......... . ......... . ........
ACACIA · ......... · ......... ·......... .... .C .... ·......... ..... T .
ACACIA · ......... · ........... .. .................. .... .C .... .. .................. ..... T .
ACACIA .. .. " .............. .. .................. .. .................. .... .C .... .. .................. ..... T .... .. ........
GRAMINEARUM .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .................. .... .C .... .. .................. ..... T .... .. ......
GRAMINEARUM .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. ..... C .... .. .................. .... .T.
GRAMINEARUM .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .................. ..... C .... .. .................. .....T .... .. ........
tv
tv
~
430 440 450 460 470 480 490
CROOKWELLENSE AACACCAAAA CTAATGAAAT TCCCAGCCGC GGACGTCTCT CAACAAAGGA GATCGAGGAC CAGATGCTCA
CROOKWELLENSE .................... .. .................. .. .................. .. ............
ACACIA .................... .. .................. ......... T .. .................. .. ................
ACACIA .................... .. .................. ......... T .. .................. .. .................. .. ..........
ACACIA .................... .. .................. ......... T .. ................. .. .................. .. .................. . .
GRAMINEARUM .................... .. .................. .. ..........
GRAMINEARUM .................... .. .................. .. .................. .. .................. .. ................
GRAMINEARUM .....A .... .. .................. .. .................. .. .................. . .
500 510 520
CROOKWELLENSE AGGTTCAGAC CAAGAACTCC GA-------- ------
CROOKWELLENSE .................... .. .................. ·.GTACTTCG CGACTA
ACACIA .................... .. .................. ·.GTACTTNG CGACTA
ACACIA ................... .. .................. ..GTACTTGT CGACTA
ACACIA .................... .. .................. ·.GTACATG- CGACTA
GRAMINEARUM .................... .. .................. ·.GTAC-TTG CGACTA
GRAM INEARUM .................... .. .................. ..GTACTNTG CGACTA
GRAMINEARUM .. .. .. .. .. .. .. .. .. .. .................... ·.GTACNTGN CGACTA
tv
tv
Ul
226
Figure 5: Phylogenetic tree generated for the T22 primer using the Heuristic search
option ofPAUP. Bootstrap values (1000 replicates) were computed with the branch and
bound option.
crookwe11ense 227
cr ookwe Ll ense
Acacia
Acac ia
Acacia
87 % Graminearum
Graminearum
Gramlnearum
228
SUMMARY
The Acacia mearnsii industry is a relatively small, though very profitable industry in South
Africa. Wood derived from A. mearnsii is currently in greater demand than that of either
pine or eucalyptus in South Africa. Despite the importance of this industry, very little
attention has been given to the genetic improvement, disease tolerance or general
improvement of A. meamsii as a forestry species. The result has been that, during the last
few decades, pathogens have become adapted to, and spread through plantations of this
tree. Although relatively little research has been conducted on the impact of pathogens on
A. mearnsii, this situation has changed during the past nine years, and particularly since
the identification of Ceratocystis wilt.
The planting of exotics has many advantages over native plants. In South Africa, exotic
forestry species, such as Eucalyptus spp., Pinus spp. and A. mearnsii were introduced to
halt the uncontrolled logging of native forests. These native forests were logged mainly
for furniture and building material, but also for fuel wood, resulting in the near complete
destruction of South Africa's native forests. The introduced exotics prevented the further
destruction of these forests and soon became a large industry. This was particularly due
to the fact that it was found that they also had a superior growth rate when compared to
native species. This accelerated growth rate brought rapid results from breeding trials
and, thus, a relatively rapid improvement of the material planted. Because they had been
separated from their natural enemies, these trees were also initially disease free.
The A. mearnsii industry has, and will continue, to face many problems and challenges
from pests and diseases. After the initial phase in which the tree was removed from the
pathogens affecting it in it's native range, it faced attacks by native South African pests
and diseases. These can spread from native Acacia species, or from any other native
plants in the same, or even different families. Exotic, mono culture industries are also
constantly under threat from the introduction of pathogens from other countries, including
the country of origin. This can be done by the introduction of new germ plasm or on any
229
other plant species or plant material brought into a country. Because A. mearnsii is now
planted as a monoculture, in contrast to it's native situation, diseases and pests can
potentially be much more severe and will spread more rapidly and widely throughout even
aged and genetically uniform stands.
Propagation of A. mearnsii has, recently, advanced considerably and this is concurrent
with increased demand for this wood on world markets. Lessons learned from eucalypt
and pine forestry need, however, to be heeded to save unnecessary losses and time. With
the advent of vegetative propagation of A. mearnsii in South Africa, it is important to
include disease screening trials at the early stages of the development of clones. In order
to do this, a knowledge of all possible pathogens of A. mearnsii is needed. This includes
pathogens known in South Africa and those that occur beyond the borders of the country.
It is also necessary to have a detailed knowledge of the biology and population structure
of these pathogens in order to gain an impression of the possible success of control
measures.
This thesis is a compilation of work conducted on some of the known pathogens of A.
mearnsii in South Africa. It also includes a large component dealing with the
identification and clarification of previously unknown pathogens of A. mearnsii. It,
therefore, does not focus only on diseases of A. mearnsii, but includes a chapter on a
disease of Eucalyptus. The causal agent of this disease has, however, also recently been
found on A. mearnsii in South Africa and this chapter aims at elucidating the possible
origin of the isolates from South Africa. It also illustrates the potential threat of this
pathogen to the A. mearnsii industry.
South Africa is a semi-arid country that regularly suffers from severe drought. Forestry
activities in the country are also mainly restricted to areas with poorer soil and where
agriculture cannot be pursued on a profitable basis. Factors such as drought, hail, frost
and sub-optimal soil conditions can all contribute to increased stress on trees. Under these
conditions, many fungi can act as opportunistic pathogens, causing large scale losses.
230
They often live as endophytes within their hosts, not causing any negative affect until the
onset of stress. At this stage, they spread throughout trees, preventing them from
recovering from the stress condition and leading to cankers and tree death. Careful
management, particularly site/species matching, is required to minimise losses caused by
these pathogens.
This thesis provides a basis for future research on the development of management
strategies to control diseases of A. mearnsii in South Africa. Information, however, also
provide valuable knowledge for forestry industries outside South Africa by highlighting
the threat of exotic pathogens and the importance of strict quarantine measures to prevent
the spread of pathogens. This is true for the movement of not only A. mearnsii material,
but as was seen here, the movement of any forestry products, since many pathogens have
a wide host range. Although the thesis is comprised of a series of individual entities, these
all provide information regarding the hygiene of A. mearnsii plantations. This thesis thus
aims at identifying future focus points for intensive research, while at the same time
focusing on those pathogens that have been known to the South African industry for a
longer period of time.
Chapter one provides a review of the available literature on diseases affecting not only A.
mearnsii, but also other Acacia spp. important to the forestry industry, world wide. It
also highlights some of the uses of these species in the countries where they are planted.
The multi-purpose use of Acacia spp. is an important aspect emerging from this review.
In many countries, Acacia spp. are not only planted as forestry species but are also used
for soil reclamation, nitrogen fixation and fodder. The main focus of the chapter,
however, is on the A. mearnsii industry in South Africa, with a brief discussion on all the
diseases currently known to occur in the country. It is concluded that much research is
still needed to reduce the impact of these diseases and to ensure that the Industry
functions optimally.
231
Ceratocystis albofundus must be considered as one of the most important pathogens of
Acacia spp., world-wide. Currently this pathogen occurs only in South Africa, but if it is
to spread to other countries, large scale losses will be incurred. It may also affect, not
only A. mearnsii, but most likely many other plant species. Breeding programmes for A.
mearnsii in South Africa focus strongly on this pathogen. In Chapter two, the population
diversity of C. albofundus was investigated and compared with data for other Ceratocystis
spp., using nuclear and mitochondrial DNA fingerprinting. It was found that the C.
albofundus population has a greater genetic diversity than any of the species with which it
was compared. This will thus mean that intensive breeding programmes will be necessary
to ensure durability of disease tolerance. It also supports previous hypotheses that C.
albofundus is native to South Africa and may be a temperate species, not found in tropical
areas where its close relative, C. fimbriata, commonly occurs.
The first unequivocal report of C. fimbriata and Ch. elegans from A. mearnsii is
presented in Chapter three. Both these fungi were isolated from dying trees with typical
symptoms of Ceratocystis wilt caused by C. albofundus. Both were shown to be capable
of causing disease to seedlings under green house conditions. It was, however, found that
C. albofundus is more virulent than either Ch. elegans or C. fimbriata. Both isolates were
identified using molecular and morphological approaches. Unfortunately only one isolate
of each exists and surveys to obtain additional samples continue to be a priority.
The first report of a wilt disease of Eucalyptus, caused by Ceratocystis fimbriata in the
Republic of the Congo in West Africa is recorded in Chapter four. This is not only the
first report of C. fimbriata as a pathogen of Eucalyptus in Africa but is also one of the few
unequivocal reports of this fungus from the continent. Pathogenicity of C. fimbriata on
Eucalyptus spp. was confirmed in glass house tests. In this Chapter, C. fimbriata and C.
albofundus from A. mearnsii, and C. fimbriata from Eucalyptus in Brazil were also
compared to the C. fimbriata from the Congo. Comparison of the lTS region of the
rRNA operon showed that isolates from all three areas grouped together in a clade of C.
fimbriata, separate from European isolates. Sequence data showed that C. fimbriata from
232
A. mearnsii in South Africa is nearly identical to the fungi from Eucalyptus in Brazil and
Congo, suggesting that they may have a common origin. These findings stress the
importance of sound quarantine measures to prevent the introduction of potentially
devastating pathogens to South Africa. It is not yet known why C. fimbriata has not
caused more diseases on A. mearnsii or Eucalyptus spp. in the country, but the situation
will need to be monitored closely.
Apart from C. albofundus, there are many other fungi that cause disease of A. mearnsii in
South Africa. Chapter five reports on a species of Seiridium that was isolated from stem
cankers on A. mearnsii. Morphological and molecular comparisons, as well as
pathogenicity studies have shown that the species from A. mearnsii is similar to those
species responsible for Cypress canker in many parts of the world. It also confirms
previous reports that the taxonomy of the three Seiridium spp. causing cypress canker
needs re-evaluation, since molecular data support the view that the three species, represent
a single taxon. Pathogenicity trials on mature Cuppressus lusitanica and on A. mearnsii
trees showed that both the cypress and A. mearnsii isolates are capable of causing lesions
on both hosts.
Many of the fungi isolated from diseased A. mearnsii during the current and previous
studies of diseases resulted in the isolation of fungi, commonly found as latent pathogens
on other forest trees. Chapter six encompassed a survey of the endophytic fungi of A.
mearnsii, with the specific aim of identifying possible pathogens. Thirty different fungal
taxa were found as endophytes of the xylem and rachi. These included F. graminearum
and Botryosphaeria dothidea, which are known pathogens. During periods of
environmental stress, these fungi can apparently cause disease. This is especially true
because A. mearnsii is often planted on marginal sites in South Africa.
Chapter seven represents the first report of Fusarium graminearum from A. mearnsii and
presents evidence for the fungus being involved in disease of A. mearnsii. This pathogen
was first isolated during 1994-95 disease surveys, but was not identified due to the fact
233
that cultures on artificial media did not sporulate. In the current study, additional isolates
were obtained from stem cankers and die-back symptoms and the fungus was identified
based on J3-tubulin gene sequences. Field inoculations using F. graminearum showed
extensive lesion formation in the xylem. Previously, this Fusarium sp. was known only as
a pathogen of maize and wheat in various parts of the world. Results of this study are,
therefore, enigmatic and intriguing.
234
OPSOMMING
Die Acacia mearnsii industrie is 'n klein, dog uiters winsgewende industrie in Suid-Afrika.
Hout vanaf hierdie boom is tans in meer aanvraag as enige van die ander bosbouspesies in
Suid-Afrika. Min aandag is egter geskenk aan die genetiese verbetering, ontwikkeling van
siekte weerstandbiedende spesiesIkIone en die algemene verbetering van hierdie boom as
'n bosbouspesie. Dit het tot die gevolg gehad dat siektes die kans gekry het om aan te
pas, te versprei en ernstige probleme te veroorsaak op A. mearnsii. Hierdie situasie het
egter gedurende die afgelope paar jaar verander, veral na die identifikasie van Ceratocystis
wilt aan die einde van die 1980's.
Die verbouing van uitheemse boomspesies, in teenstelling met inheemse spesies, het baie
voordele. In Suid-Afrika is uitheemse bosbouspesies aanvanklik geplant om die totale
vernietiging van die land se inheemse woude te voorkom. Hierdie woude is teen 'n
ontstellende tempo afgekap om aan boumateriaal, meubel- en vuurmaakhout te voorsien.
Uitheemse bosbouspesies het nie net vinniger groeitempos as die inheemse spesies nie,
maar het aanvanklik min siektes gehad. Na die aanvanklike fase waartydens die uitheemse
spesies van hul natuurlike vyande verwyder was, het Suid-Afrikaanse peste en siektes by
hierdie bome begin aanpas. Dit het ook vir die A. mearnsii boom gegeld. Patogene kan
van 'n verskeidenheid ander gashere versprei na A. mearnsii. Dit sluit uitheemse
organismes wat vanaf die boom se land van oorsprong na Suid-Afrika versprei, asook
organismes vanaf ander lande af, in. Omdat A. mearnsii nou as mono-kultuur aangeplant
word, in teenstelling met sy land van oorsprong, kan peste en patogene teen 'n baie
vinniger tempo versprei onder die geneties uniforme plantasies in Suid-Afrika.
Die produksie van A. mearnsii het aansienlik verbeter, net soos die aanvraag van hierdie
hout verhoog het op die internasionale markte. Met die ontwikkeling van vegetatiewe
voortplanting van A. mearnsii d.m.v steggies, is dit egter van uiterste belang om in 'n
vroeë fase van die proses alle nageslag teen siektes te toets. Hiervoor is 'n kennis van al
die moontlike patogene van A. mearnsii van belang. Dit sluit beide die patogene in Suid-
235
Afrika, sowel as patogene in ander lande in. Hierdie kennis moet ook insluit inligting oor
die biologie en populasie diversiteit van die patogene. Hierdie inligting sal 'n aanduiding
gee van die moontlike sukses van beheermaatreëls.
Hierdie tesis is 'n samestelling van werk wat gedoen is op sommige van die bekende
patogene van A. mearnsii. Dit sluit cok'n groot gedeelte in wat handeloor die
identifikasie van voorheen onbekende patogene van hierdie boom. Dit sluit 'n hoofstuk in
oor 'n nuwe siekte van Eucalyptus spp., 'aangesien die patogeen ook op A. mearnsii
gevind is tydens hierdie studie. Laasgenoemde hoostuk ondersoek die moontlike
konneksie tussen die oorsprong van die isolate op A. mearnsii i.v.m die van Eucalyptus
spp.
Suid-Afrika is 'n land wat gereeld deur ernstige droogtes geteister word. Die meeste
bosboupraktyke is egter beperk tot areas van swakker grondkwaliteit en ongereelde
reënval. Buiten droogte stres, dra hael, ryp en die swak grond by tot verhoogte
streskondisies vir bosbou. Onder hierdie toestande kan opportunistiese patogene
grootskaalse verliese tot gevolg hê. Hierdie organismes leef dikwels as endofiete in hul
gashere, waar hul aanvanklik geen siektes veroorsaak nie. Sodra die boom egter onder
stres verkeer, versprei hulle in die boom en verhoed hulle die boom om te herstel van die
strestoestande. Hulle lei ook dikwels tot die uiteindelike dood van die boom. Goeie
bestuurspraktyke, veral die korrelasie an area met spesie, word benodig om verliese deur
hierdie patogene te verminder.
Hierdie tesis lê die grondslag vir verdere navorsing oor die verbetering en bestuur van
strategieë teen siektes van A. mearnsii. Die potensiële bedreiging deur uitheemse
patogene en die noodsaaklikheid van streng kwarentyn work ook uitgelig. Al bestaan die
tesis uit 'n reeks individuele hoofstukke, handel almal oor die patogene van A. mearnsii en
hul impak op hierdie boom. Hierdie tesis lig fokuspunte uit vir verdere navorsing en
verskaf ook meer inligting oor die patogene van A. mearnsii wat reeds aan die wetenskap
bekend is.
236
Hoofstuk een verskaf 'n literatuuroorsig van die siektes van A. mearnsii sowel as van
ander Acacia spp. wat belangrik is vir die bosboubedryf wêreldwyd. Hierdie hoofstuk lig
ook sommige van die ander gebruike van hierdie bome, in die lande waar hulle verbou
word, uit. Dit is duidelik dat die multi-gebruikspotensiaal van hierdie genus 'n belangrike
aspek vorm van sy gebruik as bosbouspesie. In die meeste lande word Acacias
byvoorbeeld ook geplant om te help met grondherwinning, stikstofvaslegging en as
veevoer. Hoofstuk een se hoof fokuspunt is egter die A. mearnsii industrie in Suid-Afrika
en die siektes van hierdie boom in die land word bespreek. Dit is duidelik dat, om te
verseker dat die industrie maksimaal funksioneer, baie navorsing nog benodig word
aangaande die siektes van hierdie spesie.
Ceratocystis albofundus kan as een van die ernstigste siektes van Acacia spp. in die
wêreld beskou word. Telingsprogramme met A. mearnsii in Suid-Afrika fokus daarom op
hierdie ernstige patogeen. In Hoofstuk twee het ons die populasiediversiteit van hierdie
patogeen in Suid-Afrika ondersoek en die data vergelyk met die van ander Ceratocystis
spp. Dit is gedoen deur gebruik te maak van nukluêre en mitochondriale DNA profiele.
Daar is gevind dat C. albofundus 'n hoër populasiediversiteit as enige van die ander drie
Ceratocystis spp. het. Dit beteken dat intensiewe telingsprogramme benodig sal word om
die duursaamheid van siekteweerstand te verseker. Resultate in hierdie hoofstuk
ondersteun ook vorige hipotesisse dat C. albofundus inheems aan Suid-Afrika is. Dit is
heel moontlik dat C. albofundus 'n spesie vanaf 'n gematigde klimaat is, wat In
teenstelling met die nabyverwante C. fimbriata, nie in tropiese areas gevind word nie.
In Hoofstuk drie verskyn die eerste onteenseglike aanmelding van C. fimbriata vanaf A.
mearnsii. Hierdie hoofstuk verteenwoordig ook die eerste aanmelding van Chalara
elegans vanaf A. mearnsii. Beide hierdie fungi is identifiseer deur gebruik te maak van
morfologiese en molekulêre tegnieke. Ongelukkig kon slegs een isolaat van elk verkry
word en verdere opnames om meer isolate te kry is 'n prioriteit vir toekomstige navorsing.
Beide spesies is in staat om siekte van jong saailinge in die glashuis te versaak.
237
Ceratocystis albafundus was egter die virulentste van die spesies wat getoets IS vir
patogenisiteit.
Hoofstuk vier verteenwoordig die eerste aanmelding van C. fimbriata as die oorsaak van
'n ernstige verwelksiekte van Eucalyptus in Afrika. Die patogenisiteit van C. fimbriata op
Eucalyptus is in die glashuis bevestig. In hierdie hoofstuk is C. fimbriata vanaf A.
mearnsii en Eucalyptus in Brazil, asook C. albofundus, met Congo isolate vergelyk.
Vergelyking van die ITS gebied van die rRNA operon van isolate vanaf die Congo, Brazil
en Suid Afrika toon dat isolate vanaf al drie areas saam groepeer as C. fimbriata, maar
apart van Europese C. fimbriata isolate. Dit is ook gevind dat C. fimbriata vanaf A.
mearnsii in Suid-Afrika feitlik identiese DNA profiele het as C. fimbriata isolate vanaf
Eucalyptus in Brazil en Wes-Afrika. Dit is dus heel waarskynlik dat hierdie isolate 'n
gemeenskaplike oorsprong mag deel.
Buiten vir C. albofundus, is daar verskeie ander fungi wat ook siektes van A. mearnsii
veroorsaak in Suid-Afrika. Hoofstuk vyf handeloor 'n Seiridium sp. wat vanaf stam
kankers geisoleer is. Morfologiese en molekulêre, asook patogenisiteits toetse toon dat
die spesie vanaf A. mearnsii soortgelyk is aan die Seiridium spp. wat verantwoordelik is
vir sipreskanker in verskeie lande van die wêreld. Resultate verkry in hierdie studie
bevestig vorige verslae dat die taksonomie van die drie spesies verantwoordelik vir
sipreskanker herevaluering benodig. Molekulêre data toon dat die drie sipreskanker
spesies in werklikheid een spesie verteenwoordig. Inokulasies van sytakke van volwasse
Cupressus lusitanica en van A. mearnsii toon dat beide die sipres en Acacia isolate
patogenies is op hulonderskeie gashere.
Baie van die fungi wat gedurende siekteopnames geisoleer is, is bekend as latente
patogene van ander bosbou spesies. In Hoofstuk ses is 'n opname van die endofitiese
fungi van A. mearnsii gedoen, met die spesifieke doelom potensiële patogene te
identifiseer. Dertig verskillende taxa is as endofiete geisoleer vanuit die xileem en ragisse
van gesonde bome. Hierdie taxa het onder andere F. graminearum en Batryasphaeria
238
dothidea ingesluit. Die rol van hierdie fungi gedurende tydperke van ongunstige
omgewingstoestande is van uiterste belang omdat A. mearnsii dikwels op marginale
gebiede geplant word en dus onder gereelde stres verkeer. Hierdie stres kan tot gevolg hê
dat latente patogene aktief raak en siekte en dood van die bome veroorsaak.
Fusarium graminearum is 'n bekende en ernstige patogeen van mielies en koring, maar in
Hoofstuk sewe word dit vir die eerste keer as patogeen van A. mearnsii aangemeld. Dit is
vir die eerste keer gedurende 1994-95 geisoleer tydens siekteopnames, maar is nie
geidentifiseer nie aangesien die isolate vanaf A. mearnsii nie in kultuur sporuleer nie. In
die heidige studie is meer isolate vanaf stamkankers verkry en identifiseer deur vergelyking
van die f3-tubulien geen. Veldinokulasies met F. graminearum het ekstensiewe
kankerformasie in die xileem tot gevolg gehad.
u:o.v.~.BlBOOTEE